spacer

EBI Dbfetch

>ENA|D87894|D87894.1 Rhizopus oligosporus DNA for chitinase, complete cds. 
AATAATGAAACCACTAATTCAAGAGTATTGTGTGTATGCCTTGTTATTTCTTCATGATCC
AAGGGTTTCTCGCGTCAACAGTATGTTCTGAGCTTTTTGTTGTTGTCATATCTACTTATT
CATGTTTGGAATGAAATGTCAATTGTCTCATCTTCCTAAAGTGTATACAAGTTTTTGTTC
TACAATAGAACTCTACAACAGCTGAATATAATGATAAAAATAGATATTTTCTTGGCTCTT
TTTTTCATTTTACTTTTCTTGACTTCTCATATGGAACCACCTCCAGCAACAAACGGACCT
GTTATTGCAGGTTACTTTGCTAATTGGTAACATTGCATAACAAAGGCAAAAGGGGAGCTT
AACTCAACTAACTAGAATGTAATAGGGGAATCTACGATAGAAAATACAATGTTGTTGATG
TAGCTACTCAAGCCAATAAGTTGACTCATATTTTATATGCATTTGCTAATGTCCAACCGG
ATGGTCAAGTTGTTCTTGGGGTAGTATAAATTATTGCAAGATATAGAATATAATAATAAT
AATTATAAATATAGGACGCTTATGCAGATATTGAAAAGCATTTTCCAGCAAGTAAAAAAA
TAATAATAAACAAATATAAAACCTCTCCCTAATTCATACATAATATGTAGACCAAGCAGT
CAACCGAAAAGAAGATGGATGGAATGATCCAGGCAAGAACCTTTACGGTAACTTTAAGCA
GTTCTATTTACTCAAGCAACAACACCGTCATCTCAAAGTGTCGCTTAGCATTGGCGGATA
TACATGGTCCACTCATTTTGGCCCGGTTGCGCGTGATCCTCAGAAACGCAGATTGTTTGT
AGATAGCAGCATCAAACACCTAGCCAACTTGGGTCTGGACGGGCTAGATATTGACTGGGA
GTACCCCAAAGATGATGAGGAAGCGTTTTATTATGTGCATCTGCTCTATGAGTTGCGACT
GGCGCTTGACAGATATCAACAACAGTGCCAACAACTGATTCAGTCGCGACTATTACTCAC
AGTAGCCGTGCCTTGTGGCCCTGACCATTATCGTAAATTGAGATTGACCGAAATGCAACC
TTACGTGGACCTATTTTACCTCATGGCATACGACTATGCTGGTTCATGGGATTCTTTCGC
AGATCATCAAGCGGCTGTTTATGGTGGCAGATTGAATACAGAACAAGCAGTACAGCACTA
TATCGCCTGTGGTATCCCTCCATATAAGCTAGTCGTAGGCATGCCTTTATATGGTCGAGG
ATTCTGCAATACGGCGGGGCCAGGTCATCCTTTCCAAGGACTGCCTCGCGGTACCTGGGA
AGAGGGTCAATTTAATTACAAGACATTGCCAAAACCGGGCGCTGTAGAATACCACGACTT
TAATCGACTAGCCTCATGGTCTTATGACCCTCAGGCTCGTGAATTTATCACCTATGATAC
ACCTCAGATGGTTGCTGCAAAGTGCAATTACATACAACAAAGACGGTTGGGTGGTGCCAT
GTTTTGGGAACTAAGTGCGGATTGTCCTCAGAGAAGCCTGATCAACGCGGCCTATGACGG
CTTAGGAAGGCGATTAGATCAGGTACCTAATCATTTAGATTATCCAATGAGTGAGTATGA
CAATGTACGAAACGGTATGAAATAAAGCATCCCTTTTGGCAGGTGGTTCTCAAA


spacer
spacer