spacer

EBI Dbfetch

>ENA|AJ242600|AJ242600.1 Loligo opalescens mRNA for glutamate receptor (gluR gene), splice variant 1 
CACGAGCGAGCATGTAACGTCACGAAGGCACCACCCAGACTATGGAGGATCTGATCCCAG
TTTTTCCGCGTGACCCTTACGACCAGTGACAACGATTACAACACCGTGTAGTTCTACTGT
GGTACCACCAACAGACCCAGGATGGCTCCAGCCATCGGACTACCACCGGCCAGCACGTTC
CCCCAGCTGTGTTTCGTTATTCTCGCTCTATCCGGATCTGCAATAGCAGCTAAGGGGTCT
ACAAAACGCATATCAATAGGCTCAGTATTCGACGTTGAATCGGAAAAAATCCAGACGGCG
TTTCGCTTTGCTGTGGATCGCTTTAACACAATCGAGAATTCCGCCCAACTGAAATTGAAC
CCCCTTTCGCGAGGAAATCGACGAACAGATAGTTTCTCCCTCGGCAATGCACTCTGTTCC
ATTATGTCCAAGGGTGTTTTTGCTGTATTCGGAAAGGCGAACTCTTCAATGCTGGCGACA
GTCAAGTCGTACAGTGACACCTTCCAAATTCCGTATCTAACTACAAGTATGGCCATGAAC
ACAACAGATCAGTCGCCCTACATGCTATTTTTGCGTCCCATTAACATCCGGGCTATTGTC
GACCTCATAGAGCACTTGGGGTGGAGGGTGGTTCATTACATATATATTTCGAACGAAGGT
TTAATGCGTGTTCAGCAACTGTTTCAGGTGATGGGGAAGAGCGATCTTCAAATGACCCTG
AACGTCAAACGTGCGTCCGATGTCACTAGTTACGTAATTCTTAAAGAACTTCATCATACC
AACCCCGAGTTGGACATTCATGCCGTGCTGGATATGTCAATACCTATGGCGAGTGAACTA
ATGAATCTGCTGAGTGAGGATCCACGAGTCCACAACAGACGATTTCACTTCTTGCTAGTA
GAGCCAGGAATCCAAGAATTGGACTTTGCCAAGATTGGATTGTATGGCTACAATGTAAGT
GGCTTCCAACTGGTCGACTTCAATAATATGACTGTTCGGCTATTTCTCTCGGACTGGACG
AAAATCGACCCAGCAGAATGGCCCGGGGCTGGGGTGAAAACAATCACGTACGAGGCGGCG
TTGGCAGTCGACGCCGTCAGCTTGTTTACGCGTGCAATGAAGAATTTGTCCAATCTCGGT
TTATTTGAGTCCCTTTTCATCCGCGCTAGGAGTGGAGCCAACAGCAGCAAAACTTGTGCA
GCCGAGCGTCTGAATGTGTGGAACAAAGGTAAACATGTGCTCAAGGCAATGAAAGAGACG
GAGTTTGATGGCCTTACTGGTCGAGTGGCATTTGACGATAGAGGTCACCGCAAAGAGTTC
ACTCTGGATGTTCTTGATATAGGAATTACCCGCGGCGCAGTCAAGATTGGTTACTGGACC
CCGAGGGATGGATTGACTATGCTCAAGCGTAAAATGGTCCGCCCTATTAATGCGCCCAGC
TCTGAGAACAGAACAAGGATTGTGACTACGATCCAGACTCCTCCTTACATAATGAAGAAA
CCGAAGCCGATAGACGGTCACCCTCTTATAGGCAATGACAAGTACGAAGGATATTGTGTA
GACCTTGCTCGAAAGGTTGCGCATGAAGTTGGCTTTGACTACGTGTTCCAGATGGTAAAA
GATGGCGCCTACGGTTCGAAGCTCGCAAATGATTCGTGGAATGGTATGGTAGGAGAACTA
ATAAGGCTGGAGGCGGATATGGCCATTGCCCCACTGACGATCTCAGCTGTGCGGGAGAGG
GTCATTGATTTCTCCAAACCCTTTATGAGCCTGGGAATCAGTATCATGATAAAAAAACCA
GCGGACCAGAAAGCTCACGTGTTCTCGTTCCTCGACCCGTTATCCTACGAGATCTGGATG
TGCATCTTGTTTGCCTTCATTGGAGTCAGCGTGGTCTTGTTTTTGGTCAGTCGCTTCAGC
CCTAGCGGGTGGCACGTGGAAGATGAGTCGAATATTACGAATGATTTTACCATTTCCAAC
AGCCTCTGGTTTTCGCTGGGCGCCTTCATGCAACAGGGATGTGATTTCTCACCTCGATCG
ATTTCTGGACGTATAGTCGGAAGCGTATGGTGGTTCTTCACCCTGATCATTATTTCGTCT
TACACTGCCAACCTGGCCGCCTTCCTCACAGTGGAAAGAATGTCCACTCCGATTGAATCC
GCTGAGGATCTTGCCAAACAGACGGAAATCGAATATGGAACTTTAAGGTCAGGCACAACA
GAAGCTTTCTTTAAGACTTCTAAGGTAGCGGTCTATGAGCGAATGTGGGCTTATATGACA
TCAAAGACCCCTAGTGTCTTTACGGATAAAATCCAAGATGGCATAACCAGCGTTCGAGAT
TCCAACGGAAAGTATGCTTTCCTCGTCGAATCCTCTACTAACGATTATATCAACAACCGT
TTGCCCTGTGATACAATGAAAGTCGGATCAAATCTTGACTCAAAAGGTTTCGGCATCGCT
ACACCAGCCGGCTCCGACTTAGGAGATAAACTCACACTTGCTGTTCTCAAGTTGCGCGAA
GATGGAGAGTTAGATAAGCTGCAAAAATTCTGGTGGGTGGGGAAAGGTCAGTGTACGCCA
CAGGACAAGAATACTGATGGAGGCCAAAGTGCCCTTACATTGTCCAACGTGGCTGGCATT
TTCTACATCCTTATCGGAGGACTCATATTAGCCATCATCGTCGCAGTCGCGGAATTCCTT
TATAAATCTAAAGTTGACAGTAAAAAATCAAAGACATCATTTGGACTTGCCCTGAAATCA
AAAGCCAGACTTTCTTTCCGAAGCCATCCTGCTCGGGAAGATAGCAGCTCGGGAACCCTT
CTCAGAAAGTCCATGTCAAGGTATACCTACACGGGCCCATCCCAGAGTATGGGATTTGAC
ACGGTACCGGAAGGTAACACTCACACTCAAGTGTGAGATGTTAAATTGACCAACTGCAGT
GAACCAGCGAGTGACACTCAGTCGTTACCTGCCATTCAGGACATTTTTTTGCTCATTATA
AACACAATTCAGAACGAAAGAAGAAAAAATTGTTTAATGAAAGGAAGAAAAGAAACAGGA
TCGAAACCCTGTTCGTAAATGCTCACTGGAAAGGGAGACACTTGTTCGCCTAAAACAAAA
GGGAATTCTAATGTTCAGGTGGAAACACGAATGAGTGTATCCGCGTGTGGGTCAGCTGGG
ATTATTGTTAGCAAGATGGCAGCGTACCCACACTGGCAAAAAAAAAAAAAAAAA


spacer
spacer