
ID   BX664015; SV 1; circular; genomic DNA; STD; PRO; 274762 BP.
AC   BX664015;
DT   10-NOV-2003 (Rel. 77, Created)
DT   23-OCT-2008 (Rel. 97, Last updated, Version 6)
DE   Serratia marcescens plasmid R478
KW   complete plasmid.
OS   Serratia marcescens
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacterales;
OC   Yersiniaceae; Serratia.
OG   Plasmid R478
RN   [1]
RP   1-274762
RX   DOI; 10.1016/j.plasmid.2004.06.006.
RX   PUBMED; 15518875.
RA   Gilmour M.W., Thomson N.R., Saunders M., Parkhill J., Taylor D.E.;
RT   "The complete nucleotide sequence of the resistance plasmid R478: defining
RT   the backbone components of incompatibility group H conjugative plasmids
RT   through comparative genomics";
RL   Plasmid 52(3):182-202(2004).
RN   [2]
RP   1-274762
RA   Thomson N.R.;
RT   ;
RL   Submitted (10-OCT-2003) to the INSDC.
RL   Thomson N. R., submitted on behalf of the Pathogen Sequencing Unit, Sanger
RL   Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA
RL   E-mail: nrt@sanger.ac.uk
DR   MD5; 413da5fcc2995b6044d9f7799b6e3fee.
DR   EuropePMC; PMC1538643; 16870767.
DR   EuropePMC; PMC2151457; 17698627.
DR   EuropePMC; PMC2786348; 19786598.
DR   EuropePMC; PMC2812134; 19995930.
DR   EuropePMC; PMC3457417; 22837330.
DR   EuropePMC; PMC4087019; 25003758.
DR   EuropePMC; PMC4383531; 25836671.
DR   EuropePMC; PMC4384309; 25888127.
DR   EuropePMC; PMC4432211; 25779570.
DR   RFAM; RF00240; RNA-OUT.
DR   RFAM; RF01794; sok.
DR   RFAM; RF02005; group-II-D1D4-6.
FH   Key             Location/Qualifiers
FT   source          1..274762
FT                   /organism="Serratia marcescens"
FT                   /plasmid="R478"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:615"
FT   CDS             1..876
FT                   /transl_table=11
FT                   /gene="repHIA"
FT                   /locus_tag="SMR0001"
FT                   /product="putative rep protein"
FT                   /note="Previously sequenced: Serratia marcescens putative
FT                   Rep protein SWALL:O06449 (EMBL:U62007) (291 aa) fasta
FT                   scores: E(): 7.7e-117, 100% id in 291 aa. Also Highly
FT                   similar to Salmonella typhimurium, and Salmonella typhi
FT                   replication protein RepA or RepA2 SWALL:Q07464
FT                   (EMBL:M95772) (291 aa) fasta scores: E(): 5e-102, 86.2% id
FT                   in 290 aa"
FT                   /db_xref="GOA:O06449"
FT                   /db_xref="InterPro:IPR000525"
FT                   /db_xref="UniProtKB/TrEMBL:O06449"
FT                   /protein_id="CAE51533.1"
FT                   SPKLALAKQG"
FT   misc_feature    112..840
FT                   /note="Pfam match to entry PF01651 RepA, RepA family ,
FT                   score 603.6, E-value 7.6e-179"
FT   misc_feature    337..402
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1311.000, SD 3.65 at aa 113-134, sequence
FT   CDS             2025..2378
FT                   /transl_table=11
FT                   /gene="trhA"
FT                   /locus_tag="SMR0004"
FT                   /product="putative pilin"
FT                   /note="Previously sequenced: Serratia marcescens HtdZ
FT                   SWALL:Q936A6 (EMBL:U62007) (126 aa) fasta scores: E():
FT                   4.7e-47, 100% id in 117 aa. Highly similar to Salmonella
FT                   typhi putative pilin TrhA SWALL:Q935P5 (EMBL:AL513383) (117
FT                   aa) fasta scores: E(): 3.9e-28, 65.81% id in 117 aa. Note
FT                   the differing N-terminus with that previously published."
FT                   /db_xref="GOA:Q6MY35"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY35"
FT                   /protein_id="CAE51534.1"
FT                   KIISTFMDAGVPL"
FT   misc_feature    2025..2153
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.998) with cleavage
FT                   site probability 0.989 between residues 43 and 44"
FT   misc_feature    join(2202..2270,2289..2357)
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 27-45, 60-82 and 89-111"
FT   CDS             2396..2746
FT                   /transl_table=11
FT                   /gene="trhL"
FT                   /locus_tag="SMR0005"
FT                   /product="putative plasmid transfer protein"
FT                   /note="Previously sequenced: Serratia marcescens HtdL
FT                   SWALL:Q936A5 (EMBL:U62007) (116 aa) fasta scores: E():
FT                   6.6e-50, 100% id in 116 aa. Also highly similar to
FT                   Salmonella typhi TrhL SWALL:Q9RGT2 (EMBL:AF105019) (116 aa)
FT                   fasta scores: E(): 4.9e-36, 71.55% id in 116 aa"
FT                   /db_xref="GOA:Q936A5"
FT                   /db_xref="InterPro:IPR009838"
FT                   /db_xref="UniProtKB/TrEMBL:Q936A5"
FT                   /protein_id="CAE51535.1"
FT                   YFNDPFIRDLYS"
FT   misc_feature    2429..2590
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.704) with cleavage
FT                   site probability 0.666 between residues 54 and 55"
FT   misc_feature    2522..2590
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 32-54"
FT   CDS             2758..3546
FT                   /transl_table=11
FT                   /gene="trhE"
FT                   /locus_tag="SMR0006"
FT                   /product="putative pilus assembly protein"
FT                   /note="Previously sequenced: Serratia marcescens HtdE
FT                   SWALL:Q936A4 (EMBL:U62007) (262 aa) fasta scores: E():
FT                   3.6e-102, 100% id in 262 aa. Also similar to Salmonella
FT                   typhi TrhE SWALL:Q9RGT3 (EMBL:AF105019) (265 aa) fasta
FT                   scores: E(): 2.6e-76, 74.32% id in 261 aa"
FT                   /db_xref="GOA:Q936A4"
FT                   /db_xref="InterPro:IPR007973"
FT                   /db_xref="UniProtKB/TrEMBL:Q936A4"
FT                   /protein_id="CAE51536.1"
FT   misc_feature    2959..3027
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 68-90"
FT   CDS             3546..4817
FT                   /transl_table=11
FT                   /gene="trhK"
FT                   /locus_tag="SMR0007"
FT                   /product="putative exported protein"
FT                   /note="Previously sequenced: Serratia marcescens HtdP
FT                   SWALL:Q936A3 (EMBL:U62007) (423 aa) fasta scores: E():
FT                   8.2e-142, 100% id in 423 aa. Also highly similar to
FT                   Salmonella typhi hypothetical 44.4 kDa protein R0031 or
FT                   Hcm1.71 SWALL:Q9RGT4 (EMBL:AF105019) (410 aa) fasta scores:
FT                   E(): 1.6e-100, 79.66% id in 423 aa"
FT                   /db_xref="InterPro:IPR010563"
FT                   /db_xref="UniProtKB/TrEMBL:Q936A3"
FT                   /protein_id="CAE51537.1"
FT   misc_feature    3546..3623
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.994) with cleavage
FT                   site probability 0.986 between residues 26 and 27"
FT   CDS             4819..5280
FT                   /transl_table=11
FT                   /gene="htdO"
FT                   /locus_tag="SMR0008"
FT                   /product="putative exported protein"
FT                   /note="Previously sequenced: Serratia marcescens HtdO
FT                   SWALL:Q936A2 (EMBL:U62007) (153 aa) fasta scores: E():
FT                   1e-59, 100% id in 153 aa. Also highly similar to Salmonella
FT                   typhi hypothetical 16.4 kDa protein R0030 or Hcm1.72
FT                   SWALL:Q9RGT5 (EMBL:AF105019) (146 aa) fasta scores: E():
FT                   4.6e-18, 45.13% id in 144 aa"
FT                   /db_xref="GOA:Q936A2"
FT                   /db_xref="UniProtKB/TrEMBL:Q936A2"
FT                   /protein_id="CAE51538.1"
FT   misc_feature    4819..4881
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.982) with cleavage
FT                   site probability 0.971 between residues 21 and 22"
FT   misc_feature    4828..4896
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-26"
FT   CDS             5270..6625
FT                   /transl_table=11
FT                   /gene="trhB"
FT                   /locus_tag="SMR0009"
FT                   /product="putative transfer protein"
FT                   /note="Previously sequenced: Serratia marcescens HtdB
FT                   SWALL:Q9Z4H6 (EMBL:U62007) (451 aa) fasta scores: E():
FT                   2.4e-144, 100% id in 451 aa. Also highly similar to
FT                   Salmonella typhi putative transfer protein TrhB
FT                   SWALL:Q9L5U6 (EMBL:AF250878) (452 aa) fasta scores: E():
FT                   1.5e-128, 86.5% id in 452 aa"
FT                   /db_xref="GOA:Q9Z4H6"
FT                   /db_xref="InterPro:IPR005498"
FT                   /db_xref="UniProtKB/TrEMBL:Q9Z4H6"
FT                   /protein_id="CAE51539.1"
FT   misc_feature    5303..5371
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34"
FT   CDS             6633..7115
FT                   /transl_table=11
FT                   /gene="htdV"
FT                   /locus_tag="SMR0010"
FT                   /product="putative membrane protein"
FT                   /note="Similar in the N-terminus to the previously
FT                   published: Serratia marcescens HtdV SWALL:Q936A1
FT                   (EMBL:U62007) (112 aa) fasta scores: E(): 4.9e-24, 100% id
FT                   in 73 aa. The amino acid sequence differences are the
FT                   possible consequence of a frame shift in the sequence.
FT                   Similar over the entire length to Salmonella typhi
FT                   hypothetical protein 30863 or R0028 or Hcm1.74 SWALL:Q9RGT7
FT                   (EMBL:AF105019) (170 aa) fasta scores: E(): 1.2e-25, 53.28%
FT                   id in 152 aa"
FT                   /db_xref="GOA:Q6MY29"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY29"
FT                   /protein_id="CAE51540.1"
FT   misc_feature    6756..6824
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 42-64"
FT   CDS             7129..7986
FT                   /transl_table=11
FT                   /gene="htdT"
FT                   /locus_tag="SMR0011"
FT                   /product="putative plasmid transfer protein"
FT                   /note="Highly similar to Salmonella typhi putative plasmid
FT                   transfer protein Hcm1.75 SWALL:Q935P4 (EMBL:AL513383) (285
FT                   aa) fasta scores: E(): 3.7e-91, 78.24% id in 285 aa.
FT                   Previously sequenced as: Serratia marcescens HtdT
FT                   SWALL:Q9Z4H5 (EMBL:U62007) (326 aa) fasta scores: E():
FT                   1.1e-111, 99.64% id in 285 aa. Note the differing N-termini
FT                   when compared to that previously published."
FT                   /db_xref="InterPro:IPR012336"
FT                   /db_xref="InterPro:IPR033954"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY28"
FT                   /protein_id="CAE51541.1"
FT                   FETN"
FT   misc_feature    7129..7194
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.961 between residues 22 and 23"
FT   CDS             7996..8946
FT                   /transl_table=11
FT                   /gene="trhV"
FT                   /locus_tag="SMR0012"
FT                   /product="putative plasmid transfer protein"
FT                   /note="Previously sequenced: Serratia marcescens HtdD
FT                   SWALL:Q9Z4H4 (EMBL:U62007) (316 aa) fasta scores: E():
FT                   1.3e-107, 100% id in 316 aa. Also highly similar to
FT                   Salmonella typhi TrhV SWALL:Q9RGT9 (EMBL:AF105019) (316 aa)
FT                   fasta scores: E(): 2.3e-89, 80.06% id in 316 aa"
FT                   /db_xref="InterPro:IPR014118"
FT                   /db_xref="UniProtKB/TrEMBL:Q9Z4H4"
FT                   /protein_id="CAE51542.1"
FT   misc_feature    7996..8058
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.991) with cleavage
FT                   site probability 0.873 between residues 21 and 22"
FT   CDS             8955..11636
FT                   /transl_table=11
FT                   /gene="trhC"
FT                   /locus_tag="SMR0013"
FT                   /product="putative pilus assembly protein"
FT                   /note="Previously sequenced: Serratia marcescens HtdC
FT                   SWALL:Q9Z4H3 (EMBL:U62007) (893 aa) fasta scores: E(): 0,
FT                   100% id in 893 aa. Also highly similar to Salmonella typhi
FT                   plasmid transfer protein TrhC SWALL:Q935P3 (EMBL:AL513383)
FT                   (893 aa) fasta scores: E(): 0, 83.87% id in 893 aa and to
FT                   Escherichia coli TraC protein required for the assembly of
FT                   the mature F-pilin subunits SWALL:TRAC_ECOLI (SWALL:P18004)
FT                   (875 aa) fasta scores: E(): 2.7e-09, 22.88% id in 900 aa"
FT                   /db_xref="InterPro:IPR025955"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q9Z4H3"
FT                   /protein_id="CAE51543.1"
FT   misc_feature    10341..10364
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   repeat_region   12057..12298
FT                   /note="hmmsearch hit to HMM parS major repeat (1 - 257),
FT                   score: 169.7, E-value: 8.3e-52"
FT   repeat_region   12064..12089
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   12518..12772
FT                   /note="hmmsearch hit to HMM parS major repeat (1 - 257),
FT                   score: 312.5, E-value: 8.4e-95"
FT   repeat_region   12525..12551
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   12773..12799
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   12773..13013
FT                   /note="hmmsearch hit to HMM parS major repeat (8 - 249),
FT                   score: 270.9, E-value: 2.9e-82"
FT   repeat_region   13015..13270
FT                   /note="hmmsearch hit to HMM parS major repeat (1 - 257),
FT                   score: 310.9, E-value: 2.5e-94"
FT   repeat_region   13022..13048
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   13271..13297
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   13271..13517
FT                   /note="hmmsearch hit to HMM parS major repeat (8 - 257),
FT                   score: 270.6, E-value: 3.5e-82"
FT   repeat_region   13518..13544
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   13518..13750
FT                   /note="hmmsearch hit to HMM parS major repeat (8 - 257),
FT                   score: 162.7, E-value: 1e-49"
FT   repeat_region   13968..14224
FT                   /note="hmmsearch hit to HMM parS major repeat (1 - 257),
FT                   score: 311.6, E-value: 1.6e-94"
FT   repeat_region   13975..14001
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   14225..14251
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   14225..14475
FT                   /note="hmmsearch hit to HMM parS major repeat (8 - 250),
FT                   score: 209.4, E-value: 9.1e-64"
FT   repeat_region   14476..14731
FT                   /note="hmmsearch hit to HMM parS major repeat (1 - 257),
FT                   score: 301.0, E-value: 2.5e-91"
FT   repeat_region   14483..14509
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   14732..14758
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   14732..14980
FT                   /note="hmmsearch hit to HMM parS major repeat(8 - 257),
FT                   score: 295.8, E-value: 9.3e-90"
FT   repeat_region   14981..15007
FT                   /note="Highly conserved sub-region within parS major
FT                   repeat"
FT   repeat_region   14981..15136
FT                   /note="hmmsearch hit to HMM parS major repeat (8 - 165),
FT                   score: 75.4, E-value: 2e-23"
FT   CDS             15475..16728
FT                   /transl_table=11
FT                   /gene="parA"
FT                   /locus_tag="SMR0014"
FT                   /product="putative plasmid partition protein"
FT                   /note="Highly similar to Salmonella typhi ParB or R0020 or
FT                   Hcm1.86 putative plasmid partition protein SWALL:Q9RGU3
FT                   (EMBL:AF105019) (417 aa) fasta scores: E(): 1.6e-143,
FT                   89.42% id in 416 aa and to Vibrio cholerae ParA family
FT                   protein vca1115 SWALL:Q9KKJ2 (EMBL:AE004436) (407 aa) fasta
FT                   scores: E(): 5.6e-23, 27.59% id in 395 aa"
FT                   /db_xref="InterPro:IPR025669"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY25"
FT                   /protein_id="CAE51544.1"
FT                   QQFINEIKSFSAKQGVNA"
FT   misc_feature    15622..15687
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1006.000, SD 2.61 at aa 50-71, sequence
FT   misc_feature    16129..16488
FT                   /note="Pfam match to entry PF00991 ParA, ParA family ATPase
FT                   , score 6.9, E-value 0.00044"
FT   CDS             16725..17729
FT                   /transl_table=11
FT                   /gene="parB"
FT                   /locus_tag="SMR0015"
FT                   /product="plasmid partition protein"
FT                   /note="Similar to Escherichia coli plasmid partition
FT                   protein ParB SWALL:PARB_ECOLI (SWALL:P07621) (343 aa) fasta
FT                   scores: E(): 1.2e-15, 28.72% id in 289 aa. Also highly
FT                   similar to Salmonella typhi RepA or r0019 or hcm1.87
FT                   SWALL:Q9RGU4 (EMBL:AF105019) (335 aa) fasta scores: E():
FT                   1.8e-88, 72.12% id in 330 aa"
FT                   /db_xref="InterPro:IPR003115"
FT                   /db_xref="InterPro:IPR011991"
FT                   /db_xref="InterPro:IPR014884"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY24"
FT                   /protein_id="CAE51545.1"
FT   misc_feature    17244..17309
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1299.000, SD 3.61 at aa 174-195, sequence
FT   CDS             complement(17791..18180)
FT                   /transl_table=11
FT                   /gene="trhZ"
FT                   /locus_tag="SMR0016"
FT                   /product="putative exported protein"
FT                   /note="Similar to Salmonella typhi hypothetical 14.1 kDa
FT                   protein r0018 or Hcm1.88C SWALL:Q9RGU5 (EMBL:AF105019) (130
FT                   aa) fasta scores: E(): 2.3e-38, 80.46% id in 128 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY23"
FT                   /protein_id="CAE51546.1"
FT   misc_feature    complement(18127..18180)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.999) with cleavage
FT                   site probability 0.998 between residues 18 and 19"
FT   CDS             complement(18177..18698)
FT                   /transl_table=11
FT                   /locus_tag="SMR0017"
FT                   /product="lipoprotein"
FT                   /note="Similar to Salmonella typhi putative lipoprotein
FT                   Hcm1.89C SWALL:Q935P2 (EMBL:AL513383) (173 aa) fasta
FT                   scores: E(): 1.8e-37, 58.33% id in 168 aa and to Salmonella
FT                   typhi hypothetical 19.0 kDa protein R0017 SWALL:Q9RGU6
FT                   (EMBL:AF105019) (173 aa) fasta scores: E(): 2.9e-37, 57.73%
FT                   id in 168 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY22"
FT                   /protein_id="CAE51547.1"
FT                   YLLFLNEDNL"
FT   misc_feature    complement(18636..18698)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.985) with cleavage
FT                   site probability 0.740 between residues 21 and 22"
FT   misc_feature    complement(18651..18683)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS             complement(18691..19527)
FT                   /transl_table=11
FT                   /locus_tag="SMR0018"
FT                   /product="putative exported protein"
FT                   /note="Similar to several including: Salmonella typhi
FT                   putative surface exclusion protein R0016 or Hcm1.90C
FT                   SWALL:Q9RGU7 (EMBL:AF105019) (279 aa) fasta scores: E():
FT                   3.7e-35, 45.14% id in 237 aa, as well as many
FT                   penicillin-binding proteins from Haemophilus influenzae
FT                   penicillin-binding protein 3 Fts1 SWALL:AAL12577
FT                   (EMBL:AY055683) (217 aa) fasta scores: E(): 4.4, 24.4% id
FT                   in 168 aa"
FT                   /db_xref="InterPro:IPR008972"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY21"
FT                   /protein_id="CAE51548.1"
FT   misc_feature    complement(19465..19527)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.992) with cleavage
FT                   site probability 0.801 between residues 21 and 22"
FT   CDS             complement(19524..20471)
FT                   /transl_table=11
FT                   /gene="trhO"
FT                   /locus_tag="SMR0019"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0015 SWALL:Q9L5V0 (EMBL:AF250878) (315 aa) fasta scores:
FT                   E(): 1.2e-95, 71.65% id in 314 aa and to Salmonella typhi
FT                   putative surface exclusion protein Hcm1.91C SWALL:Q9RGU8
FT                   (EMBL:AF105019) (323 aa) fasta scores: E(): 1.3e-95, 71.65%
FT                   id in 314 aa"
FT                   /db_xref="GOA:Q6MY20"
FT                   /db_xref="InterPro:IPR004843"
FT                   /db_xref="InterPro:IPR029052"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY20"
FT                   /protein_id="CAE51549.1"
FT   misc_feature    complement(20286..20426)
FT                   /note="Pfam match to entry PF00149 Metallophos,
FT                   Calcineurin-like phosphoesterase , score 18.4, E-value
FT                   8.7e-05"
FT   CDS             20835..21872
FT                   /transl_table=11
FT                   /gene="parM"
FT                   /locus_tag="SMR0020"
FT                   /product="plasmid partition protein"
FT                   /note="Previously sequenced: Serratia marcescens StbA
FT                   SWALL:P95793 (EMBL:U59131) (345 aa) fasta scores: E():
FT                   2.9e-123, 99.71% id in 345 aa. Also highly similar to
FT                   Salmonella typhi StbA or Hcm1.92 SWALL:Q9RGU9
FT                   (EMBL:AF105019) (344 aa) fasta scores: E(): 7.7e-101,
FT                   80.23% id in 344 aa and to Escherichia coli protein StbA
FT                   SWALL:STBA_ECOLI (SWALL:P11904) (320 aa) fasta scores: E():
FT                   2.6e-24, 31.96% id in 316 aa"
FT                   /db_xref="InterPro:IPR009440"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY19"
FT                   /protein_id="CAE51550.1"
FT                   TIYSE"
FT   CDS             21884..22522
FT                   /transl_table=11
FT                   /gene="parR"
FT                   /locus_tag="SMR0021"
FT                   /product="conserved hypothetical protein"
FT                   /note="Previously sequenced: Serratia marcescens
FT                   hypothetical protein SWALL:P95794 (EMBL:U59131) (206 aa)
FT                   fasta scores: E(): 6.5e-73, 100% id in 202 aa. Also similar
FT                   to Salmonella typhi R0013 SWALL:Q9RGV0 (EMBL:AF105019) (225
FT                   aa) fasta scores: E(): 1.2e-19, 41.44% id in 222 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY18"
FT                   /protein_id="CAE51551.1"
FT   CDS             22925..23377
FT                   /transl_table=11
FT                   /gene="htdA"
FT                   /locus_tag="SMR0022"
FT                   /product="IncHI2 transfer repressor"
FT                   /note="Previously sequenced: Serratia marcescens IncHI2
FT                   transfer repressor HtdA SWALL:P75013 (EMBL:L20341) (150 aa)
FT                   fasta scores: E(): 1.1e-60, 100% id in 150 aa. Also highly
FT                   similar to Escherichia coli and Salmonella typhi IncHI1
FT                   transfer repressor HtdA SWALL:Q52322 (EMBL:L20342) (150 aa)
FT                   fasta scores: E(): 2e-51, 84.56% id in 149 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY17"
FT                   /protein_id="CAE51552.1"
FT   CDS             23367..23792
FT                   /transl_table=11
FT                   /gene="htdF"
FT                   /locus_tag="SMR0023"
FT                   /product="putative exported plasmid transfer protein"
FT                   /note="Previously sequenced as: Serratia marcescens HtdF
FT                   SWALL:P95791 (EMBL:U59129) (141 aa) fasta scores: E():
FT                   7.1e-55, 100% id in 141 aa. Also highly similar to
FT                   Salmonella typhimurium and Salmonella typhi HtdF protein
FT                   involved in conjugal plasmid transfer SWALL:P96054
FT                   (EMBL:U59130) (144 aa) fasta scores: E(): 2e-24, 50.7% id
FT                   in 142 aa"
FT                   /db_xref="UniProtKB/TrEMBL:P95791"
FT                   /protein_id="CAE51553.1"
FT   misc_feature    23367..23423
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.994) with cleavage
FT                   site probability 0.979 between residues 19 and 20"
FT   CDS             23801..24355
FT                   /transl_table=11
FT                   /gene="htdK"
FT                   /locus_tag="SMR0024"
FT                   /product="HtdK"
FT                   /product="putative plasmid transfer protein"
FT                   /note="Previously sequenced as: Serratia marcescens HtdK
FT                   SWALL:P95792 (EMBL:U59129) (177 aa) fasta scores: E():
FT                   3.1e-69, 100% id in 175 aa. Also similar to Salmonella
FT                   typhi HtdK SWALL:Q9RGV1 (EMBL:AF105019) (187 aa) fasta
FT                   scores: E(): 2.6e-34, 51.33% id in 187 aa"
FT                   /db_xref="GOA:Q6MY15"
FT                   /db_xref="InterPro:IPR009044"
FT                   /db_xref="InterPro:IPR013742"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY15"
FT                   /protein_id="CAE51554.1"
FT   CDS             24475..28779
FT                   /transl_table=11
FT                   /locus_tag="SMR0025"
FT                   /product="putative exported protein"
FT                   /note="Similar to several plasmid proteins of unknown
FT                   function from Salmonella typhi including: Hcm1.97
FT                   SWALL:Q935P0 (EMBL:AL513383) (1432 aa) fasta scores: E():
FT                   0, 83.68% id in 1428 aa and SWALL:Q9RGV2 (EMBL:AF105019)
FT                   (960 aa) fasta scores: E(): 0, 84.84% id in 950 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY14"
FT                   /protein_id="CAE51555.1"
FT   misc_feature    24475..24543
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.997) with cleavage
FT                   site probability 0.612 between residues 23 and 24"
FT   CDS             29057..29569
FT                   /transl_table=11
FT                   /gene="trhF"
FT                   /locus_tag="SMR0026"
FT                   /product="putative signal peptidase I"
FT                   /note="Similar to several putative signal peptidases
FT                   including: Salmonella typhi TrhF SWALL:Q9RGV5
FT                   (EMBL:AF105019) (170 aa) fasta scores: E(): 2.8e-52, 77.64%
FT                   id in 170 aa and Synechocystis sp. LepB1 or sll0716
FT                   SWALL:LEP1_SYNY3 (SWALL:P72660) (196 aa) fasta scores: E():
FT                   0.015, 23.92% id in 163 aa"
FT                   /db_xref="GOA:Q6MY13"
FT                   /db_xref="InterPro:IPR000223"
FT                   /db_xref="InterPro:IPR015927"
FT                   /db_xref="InterPro:IPR019533"
FT                   /db_xref="InterPro:IPR028360"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY13"
FT                   /protein_id="CAE51556.1"
FT                   GKTYAIF"
FT   misc_feature    29090..29158
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34"
FT   misc_feature    29447..29548
FT                   /note="Pfam match to entry PF00461 Peptidase_S26, Signal
FT                   peptidase I , score 19.8, E-value 2.9e-06"
FT   CDS             29556..31067
FT                   /transl_table=11
FT                   /gene="trhW"
FT                   /locus_tag="SMR0027"
FT                   /product="plasmid exported transfer protein"
FT                   /note="Similar to Salmonella typhi plasmid transfer protein
FT                   TrhW SWALL:Q935N8 (EMBL:AL513383) (502 aa) fasta scores:
FT                   E(): 1.9e-147, 80.47% id in 502 aa and to Escherichia coli
FT                   TraW protein precursor SWALL:TRAW_ECOLI (SWALL:P18472) (210
FT                   aa) fasta scores: E(): 0.0001, 25.9% id in 193 aa"
FT                   /db_xref="InterPro:IPR019106"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY12"
FT                   /protein_id="CAE51557.1"
FT   misc_feature    29556..29639
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.999) with cleavage
FT                   site probability 0.870 between residues 28 and 29"
FT   CDS             31206..32267
FT                   /transl_table=11
FT                   /gene="trhU"
FT                   /locus_tag="SMR0028"
FT                   /product="plasmid exported transfer protein"
FT                   /note="Similar to several orthologues of the Escherichia
FT                   coli TraU protein precursor thought to be involved in
FT                   plasmid transfer SWALL:TRAU_ECOLI (SWALL:P18471) (330 aa)
FT                   fasta scores: E(): 1e-33, 33.12% id in 323 aa. Others
FT                   include: Salmonella typhi TrhU SWALL:Q9RGV7 (EMBL:AF105019)
FT                   (335 aa) fasta scores: E(): 5.6e-145, 97% id in 334 aa and
FT                   to Providencia rettgeri trau SWALL:AAM08014 (EMBL:AY090559)
FT                   (342 aa) fasta scores: E(): 5.2e-46, 36.44% id in 343 aa.
FT                   Although highly similar to the predicted Salmonella typhi
FT                   TrhU protein product, the predicted product of the S.
FT                   marcescens traU is thought to have an N-terminal extension
FT                   which would encompass a signal sequence. This is consistent
FT                   with the Escherichia coli TraU protein which is thought to
FT                   be exported to the periplasm. Note the alternate possible
FT                   translational start sites at codon 2 and 18."
FT                   /db_xref="InterPro:IPR009649"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY11"
FT                   /protein_id="CAE51558.1"
FT                   RYNDCCVRYIPGA"
FT   misc_feature    31206..31292
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.915) with cleavage
FT                   site probability 0.915 between residues 62 and 63"
FT   CDS             32286..35474
FT                   /transl_table=11
FT                   /gene="trhN"
FT                   /locus_tag="SMR0029"
FT                   /product="putative exported plasmid transfer protein"
FT                   /note="Similar to several involved in plasmid transfer:
FT                   Salmonella typhi TrhN SWALL:Q9RGV8 (EMBL:AF105019) (1058
FT                   aa) fasta scores: E(): 0, 87.57% id in 1062 aa, and to
FT                   Sphingomonas aromaticivorans mating pair stabilization
FT                   protein precursor TraN SWALL:O85935 (EMBL:AF079317) (704
FT                   aa) fasta scores: E(): 0.0077, 26.82% id in 123 aa"
FT                   /db_xref="InterPro:IPR014121"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY10"
FT                   /protein_id="CAE51559.1"
FT                   TTLDPVTGKQLPKY"
FT   misc_feature    32286..32402
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.999) with cleavage
FT                   site probability 0.872 between residues 39 and 40"
FT   CDS             complement(35503..36375)
FT                   /transl_table=11
FT                   /locus_tag="SMR0030"
FT                   /product="lipoprotein"
FT                   /note="Similar to Salmonella typhi hypothetical 31.1 kDa
FT                   protein R0004 or Hcm1.106C SWALL:Q9RGV9 (EMBL:AF105019)
FT                   (290 aa) fasta scores: E(): 1.2e-89, 75.86% id in 290 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY09"
FT                   /protein_id="CAE51560.1"
FT                   FPEKTLKAK"
FT   misc_feature    complement(36307..36375)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.997) with cleavage
FT                   site probability 0.746 between residues 23 and 24"
FT   misc_feature    complement(36310..36342)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS             36555..38339
FT                   /transl_table=11
FT                   /gene="trhI"
FT                   /locus_tag="SMR0031"
FT                   /product="putative DNA helicase"
FT                   /note="Similar to Haemophilus influenzae DNA helicase II
FT                   UvrD or MutB or Hi1188 SWALL:UVRD_HAEIN (SWALL:Q02322) (727
FT                   aa) fasta scores: E(): 5e-13, 26.44% id in 639 aa, and to
FT                   Salmonella typhi TrhI SWALL:Q9RGW0 (EMBL:AF105019) (618 aa)
FT                   fasta scores: E(): 9.3e-199, 82.43% id in 592 aa"
FT                   /db_xref="GOA:Q6MY08"
FT                   /db_xref="InterPro:IPR000212"
FT                   /db_xref="InterPro:IPR014016"
FT                   /db_xref="InterPro:IPR014017"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY08"
FT                   /protein_id="CAE51561.1"
FT                   EEKIKEAANIRISPLYTE"
FT   misc_feature    36564..37889
FT                   /note="Pfam match to entry PF00580 UvrD-helicase, UvrD/REP
FT                   helicase , score 76.1, E-value 4.7e-20"
FT   misc_feature    36621..36644
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   repeat_region   36679..36693
FT                   /note="hmmsearch hit to HMM parS major repeat (1 - 15),
FT                   score: 0.5, E-value: 0.42"
FT   CDS             38734..39606
FT                   /transl_table=11
FT                   /locus_tag="SMR0034"
FT                   /product="putative membrane protein"
FT                   /note="Similar to Salmonella typhi hypothetical 33.4 kDa
FT                   protein r0002 or Hcm1.108 SWALL:Q9L5V4 (EMBL:AF250878) (291
FT                   aa) fasta scores: E(): 1.2e-60, 60.13% id in 291 aa. Weakly
FT                   similar to Campylobacter jejuni putative two-component
FT                   response regulator Cj0643 SWALL:Q9PHM4 (EMBL:AL139075) (414
FT                   aa) fasta scores: E(): 4.2, 26.1% id in 226 aa"
FT                   /db_xref="GOA:Q6MY07"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY07"
FT                   /protein_id="CAE51562.1"
FT                   FMYVTNKFI"
FT   misc_feature    39535..39588
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 268-285"
FT   CDS             39664..40041
FT                   /transl_table=11
FT                   /locus_tag="SMR0035"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   r0001 or hcm1.109 SWALL:Q9L5V5 (EMBL:AF250878) (125 aa)
FT                   fasta scores: E(): 3e-41, 87.2% id in 125 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY06"
FT                   /protein_id="CAE51563.1"
FT   CDS             40102..41079
FT                   /transl_table=11
FT                   /locus_tag="SMR0036"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0210 or Hcm1.110 SWALL:Q9L5D8 (EMBL:AF250878) (328 aa)
FT                   fasta scores: E(): 5.1e-71, 56.88% id in 327 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY05"
FT                   /protein_id="CAE51564.1"
FT   CDS             41137..42195
FT                   /transl_table=11
FT                   /locus_tag="SMR0037"
FT                   /product="putative ATP-binding protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.111 SWALL:Q935N4 (EMBL:AL513383) (350 aa) fasta
FT                   scores: E(): 8.2e-99, 75.71% id in 350 aa. Also weakly
FT                   similar to several others e.g. Yersinia pestis CobS homolog
FT                   or ypmt1.88 SWALL:O68771 (EMBL:AF053947) (411 aa) fasta
FT                   scores: E(): 0.00023, 25.34% id in 292 aa"
FT                   /db_xref="GOA:Q6MY04"
FT                   /db_xref="InterPro:IPR011704"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY04"
FT                   /protein_id="CAE51565.1"
FT                   KSLEYFTAKKSS"
FT   misc_feature    41443..41466
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS             42327..42500
FT                   /transl_table=11
FT                   /locus_tag="SMR0038"
FT                   /product="hypothetical protein"
FT                   /note="Similar in part to the Salmonella typhi hypothetical
FT                   protein r0208 or Hcm1.112 SWALL:Q9L5E0 (EMBL:AF250878) (89
FT                   aa) fasta scores: E(): 1.2e-07, 52.72% id in 55 aa. Note
FT                   there is no suitable translational start site to extend
FT                   this CDS upstream."
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY03"
FT                   /protein_id="CAE51566.1"
FT                   FPGILLIAPEKL"
FT   CDS             42564..43691
FT                   /transl_table=11
FT                   /locus_tag="SMR0039"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0207 or Hcm1.114 SWALL:Q9L5E1 (EMBL:AF250878) (375 aa)
FT                   fasta scores: E(): 1.4e-106, 79.1% id in 378 aa"
FT                   /db_xref="InterPro:IPR021496"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY02"
FT                   /protein_id="CAE51567.1"
FT   CDS             43769..45775
FT                   /transl_table=11
FT                   /locus_tag="SMR0040"
FT                   /product="hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0206 or Hcm1.116 SWALL:Q9L5E2 (EMBL:AF250878) (670 aa)
FT                   fasta scores: E(): 3.5e-139, 62.64% id in 672 aa. Also
FT                   similar to many other proteins between residues 250-420
FT                   e.g. Pseudorabies virus immediate-early protein Rsp40
FT                   SWALL:IE68_PRVKA (SWALL:P24827) (364 aa) fasta scores: E():
FT                   0.0012, 25.98% id in 177 aa. Database hits over this
FT                   central region fall within a low complexity acidic region
FT                   containing a high proportion of the amino acids Glu and Asp
FT                   and so should be viewed with caution."
FT                   /db_xref="InterPro:IPR002035"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY01"
FT                   /protein_id="CAE51568.1"
FT   misc_feature    45263..45754
FT                   /note="Pfam match to entry PF00092 vwa, von Willebrand
FT                   factor type A domain , score -16.7, E-value 0.00095"
FT   CDS             45848..46069
FT                   /transl_table=11
FT                   /locus_tag="SMR0041"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0205 or Hcm1.116A SWALL:Q9L5E3 (EMBL:AF250878) (73 aa)
FT                   fasta scores: E(): 5e-18, 65.75% id in 73 aa. Also similar
FT                   to the very C-terminal flavin binding domain of
FT                   Schizosaccharomyces pombe thioredoxin reductase Spbc3f6.03
FT                   SWALL:TRXB_SCHPO (SWALL:Q92375) (322 aa) fasta scores: E():
FT                   7.9, 26.47% id in 68 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MY00"
FT                   /protein_id="CAE51569.1"
FT   CDS             46183..47415
FT                   /transl_table=11
FT                   /locus_tag="SMR0042"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.117 SWALL:Q935N3 (EMBL:AL513383) (417 aa) fasta
FT                   scores: E(): 9.6e-140, 78.53% id in 410 aa. Note the
FT                   differing N-terminal translational start point with
FT                   Hcm1.117"
FT                   /db_xref="InterPro:IPR006171"
FT                   /db_xref="InterPro:IPR034154"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ9"
FT                   /protein_id="CAE51570.1"
FT                   IHWAPECLNQL"
FT   CDS             47685..48206
FT                   /transl_table=11
FT                   /locus_tag="SMR0043"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0203 or Hcm1.118 SWALL:Q9L5E5 (EMBL:AF250878) (174 aa)
FT                   fasta scores: E(): 2.9e-50, 69% id in 171 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ8"
FT                   /protein_id="CAE51571.1"
FT                   RYIDNVMATV"
FT   CDS             48285..49163
FT                   /transl_table=11
FT                   /locus_tag="SMR0044"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to two Salmonella typhi plasmid hypothetical
FT                   proteins: R0202 SWALL:Q9L5E6 (EMBL:AF250878) (292 aa) fasta
FT                   scores: E(): 3.2e-59, 51.37% id in 292 aa and Hcm1.119
FT                   SWALL:Q935N2 (EMBL:AL513383) (321 aa) fasta scores: E():
FT                   8.5e-59, 51.37% id in 292 aa. Note the differing N-terminal
FT                   translational start point with Hcm1.119."
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ7"
FT                   /protein_id="CAE51572.1"
FT                   GRNKDLGLTDF"
FT   CDS             49233..50168
FT                   /transl_table=11
FT                   /locus_tag="SMR0045"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0201 or Hcm1.120 SWALL:Q9L5E7 (EMBL:AF250878) (311 aa)
FT                   fasta scores: E(): 9.5e-66, 52.41% id in 311 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ6"
FT                   /protein_id="CAE51573.1"
FT   CDS             50237..51157
FT                   /transl_table=11
FT                   /locus_tag="SMR0046"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar over the entire length to Salmonella typhi
FT                   hypothetical protein R0200 or Hcm1.121 SWALL:Q9L5E8
FT                   (EMBL:AF250878) (306 aa) fasta scores: E(): 1.8e-59, 55.33%
FT                   id in 300 aa. Weakly similar in the C-terminus to
FT                   Streptococcus pneumoniae histidine kinase Hk06 or Sp2192
FT                   SWALL:Q9S1J3 (EMBL:AJ006395) (443 aa) fasta scores: E():
FT                   4.3, 27.17% id in 195 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ5"
FT                   /protein_id="CAE51574.1"
FT   CDS             51224..52162
FT                   /transl_table=11
FT                   /locus_tag="SMR0047"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to several proteins of unknown function e.g.
FT                   Salmonella typhi hypothetical protein Hcm1.122 SWALL:Q935N1
FT                   (EMBL:AL513383) (311 aa) fasta scores: E(): 5.1e-52, 47.41%
FT                   id in 310 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ4"
FT                   /protein_id="CAE51575.1"
FT   CDS             52328..53290
FT                   /transl_table=11
FT                   /locus_tag="SMR0048"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.123 SWALL:Q935N0 (EMBL:AL513383) (318 aa) fasta
FT                   scores: E(): 1.8e-79, 63.52% id in 318 aa. Note the
FT                   differing N-terminal translational start. Also similar in
FT                   part to Salmonella typhi hypothetical protein R0198
FT                   SWALL:Q9L5F0 (EMBL:AF250878) (183 aa) fasta scores: E():
FT                   8.6e-47, 66.66% id in 183 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ3"
FT                   /protein_id="CAE51576.1"
FT   CDS             53524..53829
FT                   /transl_table=11
FT                   /locus_tag="SMR0049"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar towards the C-terminus to Salmonella typhi
FT                   hypothetical protein R0193 or Hcm1.124 SWALL:Q9L5F2
FT                   (EMBL:AF250878) (89 aa) fasta scores: E(): 8.3e-13, 50% id
FT                   in 80 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ2"
FT                   /protein_id="CAE51577.1"
FT   CDS             53874..54464
FT                   /transl_table=11
FT                   /locus_tag="SMR0050"
FT                   /product="putative inner membrane protein"
FT                   /note="Similar to Salmonella typhi putative membrane
FT                   protein Hcm1.125 SWALL:Q935M9 (EMBL:AL513383) (196 aa)
FT                   fasta scores: E(): 1.5e-47, 62.75% id in 196 aa"
FT                   /db_xref="GOA:Q6MXZ1"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ1"
FT                   /protein_id="CAE51578.1"
FT   misc_feature    join(53886..53945,53973..54041,54054..54122)
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 5-24, 34-56 and 61-83"
FT   CDS             54472..54729
FT                   /transl_table=11
FT                   /locus_tag="SMR0051"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0191 or Hcm1.126 SWALL:Q9L5F4 (EMBL:AF250878) (85 aa)
FT                   fasta scores: E(): 6.3e-18, 64.7% id in 85 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXZ0"
FT                   /protein_id="CAE51579.1"
FT   CDS             54803..55339
FT                   /transl_table=11
FT                   /locus_tag="SMR0052"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0190 or Hcm1.127 SWALL:Q9L5F5 (EMBL:AF250878) (178 aa)
FT                   fasta scores: E(): 2.1e-46, 57.86% id in 178 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY9"
FT                   /protein_id="CAE51580.1"
FT                   FPRTTIMMQHTSAIH"
FT   CDS             55356..55802
FT                   /transl_table=11
FT                   /locus_tag="SMR0053"
FT                   /product="putative inner membrane protein"
FT                   /note="Similar to Salmonella typhi putative membrane
FT                   protein Hcm1.128 SWALL:Q935M8 (EMBL:AL513383) (151 aa)
FT                   fasta scores: E(): 7.7e-33, 57.77% id in 135 aa"
FT                   /db_xref="GOA:Q6MXY8"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY8"
FT                   /protein_id="CAE51581.1"
FT   misc_feature    join(55404..55463,55491..55550)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 17-36 and 46-65"
FT   CDS             55893..56855
FT                   /transl_table=11
FT                   /locus_tag="SMR0055"
FT                   /product="putative DNA replication-termination protein"
FT                   /note="Similar to many proteins involved in the termination
FT                   of DNA replication e.g. Salmonella typhi DNA replication
FT                   terminus site-binding protein Tus or Sty1652
FT                   SWALL:TUS_SALTI (SWALL:Q8Z6R7) (309 aa) fasta scores: E():
FT                   0.21, 20.83% id in 288 aa and to Klebsiella pneumoniae DNA
FT                   replication terminus site-binding protein Tus
FT                   SWALL:TUS_KLEPO (SWALL:O52715) (310 aa) fasta scores: E():
FT                   1.6, 22.99% id in 187 aa. Also similar to Salmonella typhi
FT                   hypothetical protein r0186 or hcm1.131 SWALL:Q9L5F9
FT                   (EMBL:AF250878) (319 aa) fasta scores: E(): 1.9e-71, 59.81%
FT                   id in 316 aa."
FT                   /db_xref="GOA:Q6MXY7"
FT                   /db_xref="InterPro:IPR008865"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY7"
FT                   /protein_id="CAE51582.1"
FT   CDS             56865..57770
FT                   /transl_table=11
FT                   /locus_tag="SMR0056"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0185 or Hcm1.132 SWALL:Q9L5G0 (EMBL:AF250878) (302 aa)
FT                   fasta scores: E(): 2.3e-101, 78.47% id in 302 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY6"
FT                   /protein_id="CAE51583.1"
FT   CDS             57784..58050
FT                   /transl_table=11
FT                   /locus_tag="SMR0057"
FT                   /product="inner membrane protein"
FT                   /note="Similar in part to Salmonella typhi hypothetical
FT                   protein R0184 or Hcm1.133 SWALL:Q9L5G1 (EMBL:AF250878) (114
FT                   aa) fasta scores: E(): 5.2e-27, 73.86% id in 88 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY5"
FT                   /protein_id="CAE51584.1"
FT   misc_feature    57844..57912
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 21-43"
FT   CDS             complement(58072..59232)
FT                   /transl_table=11
FT                   /locus_tag="SMR0058"
FT                   /product="recombinase"
FT                   /note="Similar to Bacteriophage P1 recombinase Cre,
FT                   responsible for maintaining the copy number of phage P1
FT                   plasmid in the lysogenic state, SWALL:RECR_BPP1
FT                   (SWALL:P06956) (343 aa) fasta scores: E(): 1.6e-05, 27.44%
FT                   id in 368 aa. Also similar to Salmonella typhi hypothetical
FT                   protein R0183 or Hcm1.134C SWALL:Q9L5G2 (EMBL:AF250878)
FT                   (393 aa) fasta scores: E(): 1.7e-101, 64.76% id in 386 aa"
FT                   /db_xref="GOA:Q6MXY4"
FT                   /db_xref="InterPro:IPR002104"
FT                   /db_xref="InterPro:IPR010998"
FT                   /db_xref="InterPro:IPR011010"
FT                   /db_xref="InterPro:IPR013762"
FT                   /db_xref="InterPro:IPR023109"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY4"
FT                   /protein_id="CAE51585.1"
FT   misc_feature    complement(58108..58806)
FT                   /note="Pfam match to entry PF00589 Phage_integrase, Phage
FT                   integrase family , score 20.7, E-value 4.6e-06"
FT   misc_feature    complement(58915..59160)
FT                   /note="Pfam match to entry PF02899 Phage_integr_N, Phage
FT                   integrase, N-terminal SAM-like domain , score 2.0, E-value
FT                   0.025"
FT   CDS             59236..59367
FT                   /transl_table=11
FT                   /locus_tag="SMR0059"
FT                   /product="membrane protein"
FT                   /note="no significant database hits, doubtful CDS."
FT                   /db_xref="GOA:Q6MXY3"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY3"
FT                   /protein_id="CAE51586.1"
FT   misc_feature    59263..59319
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 10-28"
FT   CDS             59417..59629
FT                   /transl_table=11
FT                   /gene="hha"
FT                   /locus_tag="SMR0060"
FT                   /product="putative regulatory protein"
FT                   /note="Similar to many regulatory proteins including:
FT                   Escherichia coli K12 and Escherichia coli O157:H7
FT                   haemolysin expression modulating protein Hha or B0460 or
FT                   Z0573 or ecs0513 SWALL:HHA_ECOLI (SWALL:P23870) (72 aa)
FT                   fasta scores: E(): 1.2e-09, 50% id in 66 aa and Yersinia
FT                   pestis and Yersinia enterocolitica virulence and toxin
FT                   modulating protein YmoA or Ypo3138 SWALL:YMOA_YERPE
FT                   (SWALL:P27720) (67 aa) fasta scores: E(): 1.3e-08, 48.48%
FT                   id in 66 aa. Also similar to Salmonella typhi putative
FT                   regulatory protein Hcm1.135 SWALL:Q935M6 (EMBL:AL513383)
FT                   (70 aa) fasta scores: E(): 3e-25, 90% id in 70 aa"
FT                   /db_xref="InterPro:IPR007985"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY2"
FT                   /protein_id="CAE51587.1"
FT   CDS             59990..61072
FT                   /transl_table=11
FT                   /locus_tag="SMR0061"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0175 or Hcm1.141 SWALL:Q9L5G8 (EMBL:AF250878) (357 aa)
FT                   fasta scores: E(): 1.7e-110, 73.88% id in 360 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY1"
FT                   /protein_id="CAE51588.1"
FT   CDS             complement(61238..62737)
FT                   /transl_table=11
FT                   /locus_tag="SMR0062"
FT                   /product="putative protein kinase"
FT                   /note="Highly similar to Yersinia pestis putative kinase
FT                   protein Ypo0592 SWALL:Q8ZIB5 (EMBL:AJ414143) (499 aa) fasta
FT                   scores: E(): 6.4e-190, 86.97% id in 499 aa. Also similar to
FT                   the conserved kinase domains of many Eukaryotic protein
FT                   kinases e.g. Saccharomyces cerevisiae cAMP-dependent
FT                   protein kinase type 1 tpk1 or sra3 or pka1 or yjl164c or
FT                   j0541 SWALL:KAPA_YEAST (SWALL:P06244) (397 aa) fasta
FT                   scores: E(): 0.012, 25.9% id in 193 aa"
FT                   /db_xref="GOA:Q6MXY0"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008266"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXY0"
FT                   /protein_id="CAE51589.1"
FT   misc_feature    complement(62066..62254)
FT                   /note="Pfam match to entry PF00069 pkinase, Protein kinase
FT                   domain , score 13.5, E-value 0.00076"
FT   misc_feature    complement(62201..62239)
FT                   /note="PS00109 Tyrosine protein kinases specific
FT                   active-site signature."
FT   CDS             complement(62763..64403)
FT                   /transl_table=11
FT                   /locus_tag="SMR0063"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Yersinia pestis hypothetical protein
FT                   Ypo0593 SWALL:Q8ZIB4 (EMBL:AJ414143) (577 aa) fasta scores:
FT                   E(): 7.4e-93, 47.4% id in 559 aa, and in part to
FT                   Pseudorabies virus glycoprotein Gp63 precursor
FT                   SWALL:VGLI_PRVRI (SWALL:P07646) (350 aa) fasta scores: E():
FT                   4.7, 25.88% id in 170 aa"
FT                   /db_xref="GOA:Q6MXX9"
FT                   /db_xref="InterPro:IPR001932"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX9"
FT                   /protein_id="CAE51590.1"
FT   CDS             complement(64400..65440)
FT                   /transl_table=11
FT                   /gene="terY3"
FT                   /locus_tag="SMR0064"
FT                   /product="putative tellurium resistance protein"
FT                   /note="Similar to Yersinia pestis putative tellurium
FT                   resistance protein TerY or Ypo0597 SWALL:Q8ZIB0
FT                   (EMBL:AJ414143) (212 aa) fasta scores: E(): 8.5e-24, 40.3%
FT                   id in 196 aa and to Serratia marcescens TerY SWALL:P75011
FT                   (EMBL:U49054) (197 aa) fasta scores: E(): 1.1e-19, 39.22%
FT                   id in 181 aa"
FT                   /db_xref="InterPro:IPR002035"
FT                   /db_xref="InterPro:IPR028274"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX8"
FT                   /protein_id="CAE51591.1"
FT                   VNRGRG"
FT   misc_feature    complement(64904..65428)
FT                   /note="Pfam match to entry PF00092 vwa, von Willebrand
FT                   factor type A domain , score -0.4, E-value 7.6e-05"
FT   CDS             complement(65525..66163)
FT                   /transl_table=11
FT                   /gene="terY2"
FT                   /locus_tag="SMR0065"
FT                   /product="putative tellurium resistance protein"
FT                   /note="Similar to Yersinia pestis putative tellurium
FT                   resistance protein TerY or Ypo0597 SWALL:Q8ZIB0
FT                   (EMBL:AJ414143) (212 aa) fasta scores: E(): 9.7e-36, 48.84%
FT                   id in 217 aa and to Serratia marcescens TerY SWALL:P75011
FT                   (EMBL:U49054) (197 aa) fasta scores: E(): 5.7e-30, 46.04%
FT                   id in 202 aa"
FT                   /db_xref="InterPro:IPR002035"
FT                   /db_xref="InterPro:IPR011392"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX7"
FT                   /protein_id="CAE51592.1"
FT   misc_feature    complement(65621..66151)
FT                   /note="Pfam match to entry PF00092 vwa, von Willebrand
FT                   factor type A domain , score -18.5, E-value 0.0013"
FT   CDS             complement(66163..66804)
FT                   /transl_table=11
FT                   /gene="terX"
FT                   /locus_tag="SMR0066"
FT                   /product="tellurium resistance protein"
FT                   /note="Previously published: Serratia marcescens tellurium
FT                   resistance protein TerX SWALL:TERX_SERMA (SWALL:P75012)
FT                   (213 aa) fasta scores: E(): 2.1e-84, 100% id in 213 aa, and
FT                   to Yersinia pestis putative tellurium resistance protein
FT                   TerX or ypo0596 SWALL:Q8ZIB1 (EMBL:AJ414143) (213 aa) fasta
FT                   scores: E(): 3.2e-75, 86.85% id in 213 aa"
FT                   /db_xref="GOA:Q6MXX6"
FT                   /db_xref="InterPro:IPR003325"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX6"
FT                   /protein_id="CAE51593.1"
FT   misc_feature    complement(66166..66558)
FT                   /note="Pfam match to entry PF02342 TerD, Bacterial stress
FT                   protein , score 209.2, E-value 4e-60"
FT   CDS             complement(66827..67420)
FT                   /transl_table=11
FT                   /gene="terY1"
FT                   /locus_tag="SMR0067"
FT                   /product="putative tellurium resistance protein"
FT                   /note="Previously sequenced; Serratia marcescens TerY
FT                   SWALL:P75011 (EMBL:U49054) (197 aa) fasta scores: E():
FT                   2.7e-72, 100% id in 197 aa. Also highly similar to Yersinia
FT                   pestis putative tellurium resistance protein TerY or
FT                   ypo0597 SWALL:Q8ZIB0 (EMBL:AJ414143) (212 aa) fasta scores:
FT                   E(): 1.3e-62, 85.27% id in 197 aa"
FT                   /db_xref="InterPro:IPR002035"
FT                   /db_xref="InterPro:IPR011392"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX5"
FT                   /protein_id="CAE51594.1"
FT   misc_feature    complement(66935..67453)
FT                   /note="Pfam match to entry PF00092 vwa, von Willebrand
FT                   factor type A domain , score -13.7, E-value 0.0006"
FT   CDS             complement(67928..68395)
FT                   /transl_table=11
FT                   /gene="terW"
FT                   /locus_tag="SMR0068"
FT                   /product="putative tellurium resistance protein"
FT                   /note="Previously sequenced Serratia marcescens tellurium
FT                   resistance protein TerW SWALL:P75010 (EMBL:U49054) (155 aa)
FT                   fasta scores: E(): 5.7e-52, 100% id in 155 aa. Also similar
FT                   to several others including: Escherichia coli O157:H7
FT                   hypothetical 17.2 kDa protein terw_2 or terw or z1164 or
FT                   z1603 or ecs1343 SWALL:Q8X9R7 (EMBL:AE005309) (155 aa)
FT                   fasta scores: E(): 2.1e-51, 99.35% id in 155 aa and to
FT                   Yersinia pestis putative exported protein ypo0288
FT                   SWALL:Q8ZJ40 (EMBL:AJ414142) (162 aa) fasta scores: E():
FT                   1.8e-21, 52.34% id in 149 aa"
FT                   /db_xref="InterPro:IPR011233"
FT                   /db_xref="InterPro:IPR011991"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX4"
FT                   /protein_id="CAE51595.1"
FT   misc_feature    complement(67961..68086)
FT                   /note="Pfam match to entry PF01402 HTH_4,
FT                   Ribbon-helix-helix protein, copG family , score 14.3,
FT                   E-value 0.0012"
FT   misc_feature    complement(68264..68329)
FT                   /note="Predicted helix-turn-helix motif with score 979.000,
FT                   SD 2.52 at aa 23-44, sequence VSAADIITSLECSEPTLTRALK"
FT   CDS             complement(68413..69621)
FT                   /transl_table=11
FT                   /locus_tag="SMR0069"
FT                   /product="conserved hypothetical protein"
FT                   /note="Highly similar to Escherichia coli O157:H7
FT                   hypothetical protein Z1165 or Z1604 or Ecs1344 SWALL:Q8X9R6
FT                   (EMBL:AE005309) (402 aa) fasta scores: E(): 1.8e-149,
FT                   98.01% id in 402 aa. Also similar to Ralstonia solanacearum
FT                   probable TolA-related transport transmembrane protein
FT                   rsc0734 or rs05119 SWALL:Q8Y1F6 (EMBL:AL646060) (345 aa)
FT                   fasta scores: E(): 0.015, 31.97% id in 172 aa"
FT                   /db_xref="InterPro:IPR025330"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX3"
FT                   /protein_id="CAE51596.1"
FT                   LTL"
FT   CDS             complement(69632..70588)
FT                   /transl_table=11
FT                   /locus_tag="SMR0070"
FT                   /product="putative ATP/GTP-binding protein protein"
FT                   /note="Similar to Escherichia coli O157:H7 hypothetical
FT                   protein Z1166 or Z1605 or Ecs1345 SWALL:Q8X9R2
FT                   (EMBL:AE005309) (318 aa) fasta scores: E(): 3.5e-128,
FT                   98.42% id in 318 aa, and to Yersinia pestis putative
FT                   ATP/GTP-binding protein Ypo0289 SWALL:Q8ZJ39
FT                   (EMBL:AJ414142) (319 aa) fasta scores: E(): 1.4e-81, 65.8%
FT                   id in 310 aa"
FT                   /db_xref="GOA:Q6MXX2"
FT                   /db_xref="InterPro:IPR011206"
FT                   /db_xref="InterPro:IPR015813"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX2"
FT                   /protein_id="CAE51597.1"
FT   misc_feature    complement(69878..69901)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS             complement(70588..71667)
FT                   /transl_table=11
FT                   /locus_tag="SMR0071"
FT                   /product="putative ATP/GTP-binding protein protein"
FT                   /note="Highly similar to Escherichia coli O157:H7
FT                   hypothetical protein Z1167 or Z1606 SWALL:Q8X9R1
FT                   (EMBL:AE005309) (371 aa) fasta scores: E(): 1e-139, 98.6%
FT                   id in 359 aa. Note the differing N-termini. Also similar to
FT                   Yersinia pestis hypothetical protein Ypo0290 SWALL:Q8ZJ38
FT                   (EMBL:AJ414142) (359 aa) fasta scores: E(): 1.3e-99, 70.39%
FT                   id in 358 aa"
FT                   /db_xref="InterPro:IPR011215"
FT                   /db_xref="InterPro:IPR028157"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX1"
FT                   /protein_id="CAE51598.1"
FT   misc_feature    complement(71311..71334)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS             complement(71669..72442)
FT                   /transl_table=11
FT                   /locus_tag="SMR0072"
FT                   /product="conserved hypothetical protein"
FT                   /note="Highly similar to Escherichia coli O157:H7
FT                   hypothetical protein Ecs1348 SWALL:Q8X2L0 (EMBL:AP002554)
FT                   (257 aa) fasta scores: E(): 1.8e-103, 98.83% id in 257 aa.
FT                   Also similar to Yersinia pestis hypothetical protein
FT                   Ypo0291 SWALL:Q8ZJ37 (EMBL:AJ414142) (270 aa) fasta scores:
FT                   E(): 2.6e-71, 66.92% id in 254 aa"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR024197"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXX0"
FT                   /protein_id="CAE51599.1"
FT   CDS             complement(72435..73577)
FT                   /transl_table=11
FT                   /locus_tag="SMR0073"
FT                   /product="conserved hypothetical protein"
FT                   /note="Highly similar to Escherichia coli O157:H7
FT                   hypothetical protein Z1169 or Z1608 or Ecs1349 SWALL:Q8X9Q9
FT                   (EMBL:AE005309) (380 aa) fasta scores: E(): 2.2e-148,
FT                   98.15% id in 380 aa and to Yersinia pestis hypothetical
FT                   protein Ypo0292 SWALL:Q8ZJ36 (EMBL:AJ414142) (378 aa) fasta
FT                   scores: E(): 8e-100, 68.01% id in 372 aa. Also identical to
FT                   the N-terminal portion of the previously sequenced Serratia
FT                   marcescens hypothetical 22.2 kDa protein SWALL:P95796
FT                   (EMBL:U59239) (197 aa) fasta scores: E(): 4.1e-74, 100% id
FT                   in 197 aa. The differing sequence is the likely result of a
FT                   frameshift or sequencing error. The sequence for this
FT                   region has been checked and is believed to be correct."
FT                   /db_xref="GOA:Q6MXW9"
FT                   /db_xref="InterPro:IPR000836"
FT                   /db_xref="InterPro:IPR011214"
FT                   /db_xref="InterPro:IPR022537"
FT                   /db_xref="InterPro:IPR029057"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW9"
FT                   /protein_id="CAE51600.1"
FT   CDS             complement(73587..74576)
FT                   /transl_table=11
FT                   /locus_tag="SMR0074"
FT                   /product="conserved hypothetical protein"
FT                   /note="Highly similar to Escherichia coli O157:H7
FT                   hypothetical protein Z1170 or Z1609 or Ecs1350 SWALL:Q8X9Q8
FT                   (EMBL:AE005309) (352 aa) fasta scores: E(): 6.7e-129,
FT                   98.47% id in 327 aa and to Yersinia pestis hypothetical
FT                   protein Ypo0293 SWALL:Q8ZJ35 (EMBL:AJ414142) (353 aa) fasta
FT                   scores: E(): 1.1e-66, 54.37% id in 320 aa. Note the
FT                   differing N-termini, the differing sequence occurs within a
FT                   homopolymeric tract of 10 'A' nucleotides and is the likely
FT                   result of a frameshift or sequencing error. The sequence
FT                   for this region has been checked and is believed to be
FT                   correct. The predicted C-terminus of this CDS is also
FT                   similar to Serratia marcescens hypothetical 18.7 kDa
FT                   protein SWALL:P95797 (EMBL:U59239) (173 aa) fasta scores:
FT                   E(): 1.2e-64, 100% id in 173 aa"
FT                   /db_xref="GOA:Q6MXW8"
FT                   /db_xref="InterPro:IPR011226"
FT                   /db_xref="InterPro:IPR011761"
FT                   /db_xref="InterPro:IPR013816"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW8"
FT                   /protein_id="CAE51601.1"
FT   CDS             74967..75548
FT                   /transl_table=11
FT                   /gene="terZ"
FT                   /locus_tag="SMR0075"
FT                   /product="tellurium resistance protein"
FT                   /note="Previously sequenced: Serratia marcescens tellurium
FT                   resistance protein TerZ SWALL:TERZ_SERMA (SWALL:Q52353)
FT                   (193 aa) fasta scores: E(): 1.5e-77, 100% id in 193 aa.
FT                   Also highly similar to many others including: Escherichia
FT                   coli O157:H7 putative phage inhibition, colicin resistance
FT                   and tellurite resistance protein terz_2 or terz or z1171 or
FT                   z1610 or ecs1351 SWALL:Q8X9Q6 (EMBL:AE005310) (193 aa)
FT                   fasta scores: E(): 9.6e-77, 98.96% id in 193 aa and
FT                   Yersinia pestis tellurium resistance protein TerZ or
FT                   ypo0294 SWALL:Q8ZJ34 (EMBL:AJ414142) (197 aa) fasta scores:
FT                   E(): 1.7e-59, 76.65% id in 197 aa"
FT                   /db_xref="GOA:Q6MXW7"
FT                   /db_xref="InterPro:IPR003325"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW7"
FT                   /protein_id="CAE51602.1"
FT   misc_feature    75159..75530
FT                   /note="Pfam match to entry PF02342 TerD, Bacterial stress
FT                   protein , score 206.3, E-value 3.1e-59"
FT   CDS             75548..76705
FT                   /transl_table=11
FT                   /gene="terA"
FT                   /locus_tag="SMR0076"
FT                   /product="tellurite resistance protein"
FT                   /note="Previously sequenced: Serratia marcescens putative
FT                   TerA SWALL:Q52354 (EMBL:U59239) (341 aa) fasta scores: E():
FT                   2.6e-127, 100% id in 341 aa. Note the differing N-termini.
FT                   Also highly similar to many other proposed resistance
FT                   proteins including: Escherichia coli O157:H7 putative phage
FT                   inhibition, colicin resistance and tellurite resistance
FT                   protein tera_2 or tera or z1172 or z1611 or ecs1352
FT                   SWALL:Q8X9Q4 (EMBL:AE005310) (385 aa) fasta scores: E():
FT                   8.6e-144, 99.74% id in 385 aa and to Alcaligenes sp
FT                   tellurium resistance protein TerA SWALL:TERA_ALCSP
FT                   (SWALL:P18778) (339 aa) fasta scores: E(): 5.6e-101, 78.13%
FT                   id in 343 aa and to Proteus mirabilis TerA SWALL:Q9S405
FT                   (EMBL:AF168355) (380 aa) fasta scores: E(): 5e-97, 67.94%
FT                   id in 390 aa"
FT                   /db_xref="GOA:Q6MXW6"
FT                   /db_xref="InterPro:IPR003325"
FT                   /db_xref="InterPro:IPR017115"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW6"
FT                   /protein_id="CAE51603.1"
FT   misc_feature    75680..76027
FT                   /note="Pfam match to entry PF02342 TerD, Bacterial stress
FT                   protein , score 142.1, E-value 6.6e-40"
FT   misc_feature    76313..76672
FT                   /note="Pfam match to entry PF02342 TerD, Bacterial stress
FT                   protein , score 128.4, E-value 8.7e-36"
FT   CDS             76728..77183
FT                   /transl_table=11
FT                   /gene="terB"
FT                   /locus_tag="SMR0077"
FT                   /product="tellurite resistance protein"
FT                   /note="Highly similar to many including: Escherichia coli
FT                   tellurite resistance TerB SWALL:Q9X733 (EMBL:AJ238043) (151
FT                   aa) fasta scores: E(): 6.4e-54, 99.33% id in 151 aa,
FT                   Yersinia pestis tellurite resistance protein TerB or
FT                   ypo0296 SWALL:Q8ZJ32 (EMBL:AJ414142) (151 aa) fasta scores:
FT                   E(): 2.1e-38, 71.52% id in 151 aa and Alcaligenes sp
FT                   tellurium resistance protein TerB SWALL:TERB_ALCSP
FT                   (SWALL:P18779) (122 aa) fasta scores: E(): 4.2e-38, 92.37%
FT                   id in 118 aa"
FT                   /db_xref="InterPro:IPR007791"
FT                   /db_xref="InterPro:IPR029024"
FT                   /db_xref="UniProtKB/TrEMBL:Q79C16"
FT                   /protein_id="CAE51604.1"
FT   CDS             77206..78246
FT                   /transl_table=11
FT                   /gene="terC"
FT                   /locus_tag="SMR0078"
FT                   /product="inner membrane tellurium resistance protein"
FT                   /note="Previously sequenced: Serratia marcescens tellurium
FT                   resistance protein TerC SWALL:TERC_SERMA (SWALL:Q52356)
FT                   (346 aa) fasta scores: E(): 2.1e-135, 100% id in 346 aa.
FT                   Also identical to other tellurium resistance proteins from
FT                   e.g. Escherichia coli O157:H7 putative phage inhibition,
FT                   colicin resistance and tellurite resistance protein terc_2
FT                   or terc or z1174 or z1613 or ecs1354 SWALL:Q8X9Q1
FT                   (EMBL:AE005310) (346 aa) fasta scores: E(): 2.1e-135, 100%
FT                   id in 346 aa and Alcaligenes sp tellurium resistance
FT                   protein TerC SWALL:TERC_ALCSP (SWALL:P18780) (346 aa) fasta
FT                   scores: E(): 2.5e-123, 90.46% id in 346 aa"
FT                   /db_xref="GOA:Q6MXW4"
FT                   /db_xref="InterPro:IPR005496"
FT                   /db_xref="InterPro:IPR022369"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW4"
FT                   /protein_id="CAE51605.1"
FT                   SEEKGS"
FT   misc_feature    join(77233..77301,77335..77403,77446..77505,77524..77592,
FT                   77602..77661,77851..77919,77962..78021,78058..78111,
FT                   78139..78207)
FT                   /note="9 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 10-32, 44-66, 81-100,
FT                   107-129, 133-152, 216-238, 253-272, 285-302 and 312-334"
FT   misc_feature    77392..78198
FT                   /note="Pfam match to entry PF03741 TerC, Integral membrane
FT                   protein TerC family , score 158.4, E-value 8.2e-45"
FT   CDS             78295..78873
FT                   /transl_table=11
FT                   /gene="terD"
FT                   /locus_tag="SMR0079"
FT                   /product="tellurium resistance protein"
FT                   /note="Previously sequenced: Serratia marcescens tellurium
FT                   resistance protein TerD SWALL:TERD_SERMA (SWALL:Q52357)
FT                   (192 aa) fasta scores: E(): 2.8e-74, 100% id in 192 aa.
FT                   Also identical to tellurium resistance proteins from
FT                   Escherichia coli O157:H7 putative phage inhibition, colicin
FT                   resistance and tellurite resistance protein terd_2 or terd
FT                   or z1175 or z1614 or ecs1355 SWALL:Q8X9P9 (EMBL:AE005310)
FT                   (192 aa) fasta scores: E(): 2.8e-74, 100% id in 192 aa, and
FT                   highly similar to Alcaligenes sp tellurium resistance
FT                   protein TerD terD SWALL:TERD_ALCSP (SWALL:P18781) (192 aa)
FT                   fasta scores: E(): 3.7e-71, 95.31% id in 192 aa"
FT                   /db_xref="GOA:Q6MXW3"
FT                   /db_xref="InterPro:IPR003325"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW3"
FT                   /protein_id="CAE51606.1"
FT   misc_feature    78472..78858
FT                   /note="Pfam match to entry PF02342 TerD, Bacterial stress
FT                   protein , score 261.9, E-value 5.6e-76"
FT   CDS             78942..79517
FT                   /transl_table=11
FT                   /gene="terE"
FT                   /locus_tag="SMR0080"
FT                   /product="tellurium resistance protein"
FT                   /note="Previously sequenced: Serratia marcescens tellurium
FT                   resistance protein TerE SWALL:TERE_SERMA (SWALL:Q52358)
FT                   (191 aa) fasta scores: E(): 1.2e-74, 100% id in 191 aa.
FT                   Also identical to Escherichia coli tellurite resistance
FT                   TerE SWALL:Q9X735 (EMBL:AJ238043) (191 aa) fasta scores:
FT                   E(): 4.8e-74, 98.95% id in 191 aa, and highyl similar to
FT                   Alcaligenes sp tellurium resistance protein TerE
FT                   SWALL:TERE_ALCSP (SWALL:P18782) (191 aa) fasta scores: E():
FT                   2e-68, 88.48% id in 191 aa"
FT                   /db_xref="GOA:Q6MXW2"
FT                   /db_xref="InterPro:IPR003325"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW2"
FT                   /protein_id="CAE51607.1"
FT   misc_feature    79119..79505
FT                   /note="Pfam match to entry PF02342 TerD, Bacterial stress
FT                   protein , score 263.7, E-value 1.6e-76"
FT   CDS             79946..81187
FT                   /transl_table=11
FT                   /gene="terF"
FT                   /locus_tag="SMR0081"
FT                   /product="tellurium resistance protein"
FT                   /note="highly similar to the incompletely sequenced
FT                   Serratia marcescens putative TerF fragment SWALL:Q52359
FT                   (EMBL:U59239) (408 aa) fasta scores: E(): 7.8e-152, 100% id
FT                   in 408 aa. Also highly similar to Escherichia coli O157:H7
FT                   putative tellurium resistance protein A TlrA or terf_2 or
FT                   terf or z1177 or z1616 or ecs1358 SWALL:Q9LAP0
FT                   (EMBL:AF126104) (102 aa) fasta scores: E(): 1.1e-30, 94.11%
FT                   id in 102 aa and to Alcaligenes sp tellurium resistance
FT                   protein TerA SWALL:TERA_ALCSP (SWALL:P18778) (339 aa) fasta
FT                   scores: E(): 5.3e-16, 32.64% id in 242 aa"
FT                   /db_xref="GOA:Q6MXW1"
FT                   /db_xref="InterPro:IPR002035"
FT                   /db_xref="InterPro:IPR003325"
FT                   /db_xref="InterPro:IPR019303"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW1"
FT                   /protein_id="CAE51608.1"
FT                   FRPWIDETKRLGIL"
FT   misc_feature    80096..80431
FT                   /note="Pfam match to entry PF02342 TerD, Bacterial stress
FT                   protein , score 143.4, E-value 2.5e-40"
FT   misc_feature    80636..81055
FT                   /note="Pfam match to entry PF02342 TerD, Bacterial stress
FT                   protein , score 143.4, E-value 2.7e-40"
FT   CDS             81278..81733
FT                   /transl_table=11
FT                   /locus_tag="SMR0082"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXW0"
FT                   /protein_id="CAE51609.1"
FT   CDS             complement(81974..82165)
FT                   /transl_table=11
FT                   /locus_tag="SMR0083"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV9"
FT                   /protein_id="CAE51610.1"
FT                   SAIEKLQQALREEGYAPR"
FT   CDS             complement(82257..82598)
FT                   /transl_table=11
FT                   /locus_tag="SMR0084"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV8"
FT                   /protein_id="CAE51611.1"
FT                   HHHFLIPFL"
FT   CDS             83212..83397
FT                   /transl_table=11
FT                   /locus_tag="SMR0086"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV7"
FT                   /protein_id="CAE51612.1"
FT                   ASIGVRTGVYTGSIAR"
FT   CDS             83584..83838
FT                   /transl_table=11
FT                   /locus_tag="SMR0087"
FT                   /product="conserved hypothetical protein"
FT                   /note="Highly similar to Salmonella typhi hypothetical
FT                   protein Hcm1.104C SWALL:Q935N5 (EMBL:AL513383) (84 aa)
FT                   fasta scores: E(): 2.4e-30, 100% id in 84 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV6"
FT                   /protein_id="CAE51613.1"
FT   CDS             complement(83841..85880)
FT                   /transl_table=11
FT                   /locus_tag="SMR0088"
FT                   /product="putative DNA helicase"
FT                   /note="Similar to many DNA helicases including: Salmonella
FT                   typhi putative DNA helicase Hcm1.103 SWALL:Q935N6
FT                   (EMBL:AL513383) (679 aa) fasta scores: E(): 0, 99.26% id in
FT                   679 aa, Deinococcus radiodurans DNA helicase II Dr1775
FT                   SWALL:Q9RTI9 (EMBL:AE002019) (745 aa) fasta scores: E():
FT                   1.2e-21, 27.35% id in 647 aa and Rickettsia prowazekii
FT                   probable DNA helicase II homolog UvrD or rp447
FT                   SWALL:UVRD_RICPR (SWALL:Q9ZD95) (658 aa) fasta scores: E():
FT                   3.4e-19, 26.01% id in 642 aa"
FT                   /db_xref="GOA:Q6MXV5"
FT                   /db_xref="InterPro:IPR000212"
FT                   /db_xref="InterPro:IPR014016"
FT                   /db_xref="InterPro:IPR014017"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV5"
FT                   /protein_id="CAE51614.1"
FT   misc_feature    complement(84474..85868)
FT                   /note="Pfam match to entry PF00580 UvrD-helicase, UvrD/REP
FT                   helicase , score 86.9, E-value 2.6e-23"
FT   misc_feature    complement(85788..85811)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS             complement(85877..86917)
FT                   /transl_table=11
FT                   /locus_tag="SMR0089"
FT                   /product="putative exported protein"
FT                   /note="Highly similar to Salmonella typhi hypothetical
FT                   protein Hcm1.102 SWALL:Q935N7 (EMBL:AL513383) (328 aa)
FT                   fasta scores: E(): 1.1e-138, 99.08% id in 328 aa. Note the
FT                   differing N-terminus encompassing a possible N-terminal
FT                   signal sequence. Note the alternative possible
FT                   translational start site at codon 19."
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV4"
FT                   /protein_id="CAE51615.1"
FT                   NYKVKA"
FT   misc_feature    complement(86825..86917)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.727) with cleavage
FT                   site probability 0.561 between residues 31 and 32"
FT   CDS             87745..88176
FT                   /transl_table=11
FT                   /locus_tag="SMR0090"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi orf, hypothetical
FT                   protein R0172 SWALL:Q9L5H1 (EMBL:AF250878) (130 aa) fasta
FT                   scores: E(): 2e-52, 95.38% id in 130 aa, and to Salmonella
FT                   typhi hypothetical protein Hcm1.145 SWALL:Q935L8
FT                   (EMBL:AL513383) (130 aa) fasta scores: E(): 3.7e-52, 94.61%
FT                   id in 130 aa. Note the alternative possible translational
FT                   start site at codon 14"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV3"
FT                   /protein_id="CAE51616.1"
FT   CDS             88185..88466
FT                   /transl_table=11
FT                   /locus_tag="SMR0091"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0171 SWALL:Q9L5H2 (EMBL:AF250878) (132 aa) fasta scores:
FT                   E(): 4.3e-25, 72.22% id in 90 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV2"
FT                   /protein_id="CAE51617.1"
FT   CDS             88835..89491
FT                   /transl_table=11
FT                   /locus_tag="SMR0092"
FT                   /product="hypothetical protein"
FT                   /note="Displays a weak level of similarity to Hypoderma
FT                   lineatum (common cattle grub) collagenase precursor
FT                   SWALL:COGS_HYPLI (SWALL:P08897) (260 aa) fasta scores: E():
FT                   0.69, 25.4% id in 185 aa"
FT                   /db_xref="GOA:Q6MXV1"
FT                   /db_xref="InterPro:IPR001254"
FT                   /db_xref="InterPro:IPR009003"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV1"
FT                   /protein_id="CAE51618.1"
FT   CDS             89694..90191
FT                   /transl_table=11
FT                   /locus_tag="SMR0093"
FT                   /product="putative inner membrane protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXV0"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXV0"
FT                   /protein_id="CAE51619.1"
FT                   VR"
FT   misc_feature    join(89829..89897,89940..90008)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 46-68 and 83-105"
FT   CDS             90196..91584
FT                   /transl_table=11
FT                   /locus_tag="SMR0094"
FT                   /product="hypothetical protein"
FT                   /note="Weakly similar to Campylobacter jejuni hypothetical
FT                   protein Cj0569 SWALL:Q9PHU7 (EMBL:AL139075) (289 aa) fasta
FT                   scores: E(): 2.8e-11, 26.18% id in 275 aa and Clostridium
FT                   perfringens hypothetical protein Cpe1289 SWALL:Q8XKV3
FT                   (EMBL:AP003190) (522 aa) fasta scores: E(): 0.0011, 24.31%
FT                   id in 473 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU9"
FT                   /protein_id="CAE51620.1"
FT                   LPVK"
FT   CDS             91753..92469
FT                   /transl_table=11
FT                   /gene="tnIS26"
FT                   /locus_tag="SMR0095"
FT                   /product="transposase for IS26"
FT                   /note="Highly similar to many transposases including:
FT                   Salmonella enterica subsp. enterica serovar Typhimurium
FT                   transposase IS26 SWALL:Q9L4E4 (EMBL:AJ245670) (238 aa)
FT                   fasta scores: E(): 2.3e-102, 99.58% id in 238 aa and
FT                   Providencia rettgeri transposase TnpIS15 TpnA
FT                   SWALL:AAM08032 (EMBL:AY090559) (238 aa) fasta scores: E():
FT                   2.3e-102, 99.58% id in 238 aa"
FT                   /db_xref="GOA:Q6MXU8"
FT                   /db_xref="InterPro:IPR001584"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR032874"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU8"
FT                   /protein_id="CAE51621.1"
FT                   GDPLGEMRLVSRVFEM"
FT   misc_feature    91963..92421
FT                   /note="Pfam match to entry PF00665 rve, Integrase core
FT                   domain , score 54.9, E-value 1.1e-13"
FT   misc_feature    92509..92793
FT                   /note="Pfam match to entry PF00589 Phage_integrase, Phage
FT                   integrase family , score -3.7, E-value 0.00031"
FT   CDS             92524..92841
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="SMR0096"
FT                   /product="integrase (pseudogene)"
FT                   /note="Similar to the C-terminus of several integrases
FT                   including: Escherichia coli integrase IntI1 SWALL:AAK60185
FT                   (EMBL:AF174129) (337 aa) fasta scores: E(): 2.5e-40, 99.05%
FT                   id in 106 aa, and to Pseudomonas aeruginosa integrase Int
FT                   SWALL:O50324 (EMBL:D78374) (337 aa) fasta scores: E():
FT                   2.5e-40, 99.05% id in 106 aa. This CDS has been disrutpted
FT                   by the insertion of an IS26 element. The N-terminus of this
FT                   CDS is not apparent."
FT   CDS             92810..>93049
FT                   /transl_table=11
FT                   /locus_tag="SMR0096A"
FT                   /product="transposase (fragment)"
FT                   /note="Similar to Shigella flexneri 2A TnpM SWALL:Q93F30
FT                   (EMBL:AF326777) (194 aa) fasta scores: E(): 1.4e-26, 98.73%
FT                   id in 79 aa. This CDS appears to be a gene remnant."
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU7"
FT                   /protein_id="CAE51623.1"
FT   CDS             <93194..>93340
FT                   /transl_table=11
FT                   /locus_tag="SMR0096B"
FT                   /product="resolvase/recombinase (pseudogene)"
FT                   /note="Similar to the N-terminus of many members of the
FT                   site-specific recombinase family including: Escherichia
FT                   coli Uvp1 protein SWALL:UVP1_ECOLI (SWALL:P18957) (198 aa)
FT                   fasta scores: E(): 3.2e-13, 79.59% id in 49 aa and to
FT                   Escherichia coli and Salmonella typhimurium resolvase ResP
FT                   SWALL:Q9AC91 (EMBL:M95287) (198 aa) fasta scores: E():
FT                   3.2e-13, 79.59% id in 49 aa. This CDS has been disrupted by
FT                   the insertion of an IS26 element."
FT                   /protein_id="CAE51624.1"
FT                   GALE"
FT   CDS             93392..94108
FT                   /transl_table=11
FT                   /gene="tnIS26"
FT                   /locus_tag="SMR0097"
FT                   /product="transposase for IS26"
FT                   /note="Highly similar to many transposases including:
FT                   Salmonella enterica subsp. enterica serovar Typhimurium
FT                   transposase IS26 SWALL:Q9L4E4 (EMBL:AJ245670) (238 aa)
FT                   fasta scores: E(): 2.3e-102, 99.58% id in 238 aa and
FT                   Providencia rettgeri transposase TnpIS15 TpnA
FT                   SWALL:AAM08032 (EMBL:AY090559) (238 aa) fasta scores: E():
FT                   2.3e-102, 99.58% id in 238 aa"
FT                   /db_xref="GOA:Q6MXU8"
FT                   /db_xref="InterPro:IPR001584"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR032874"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU8"
FT                   /protein_id="CAE51625.1"
FT                   GDPLGEMRLVSRVFEM"
FT   misc_feature    93602..94060
FT                   /note="Pfam match to entry PF00665 rve, Integrase core
FT                   domain , score 54.9, E-value 1.1e-13"
FT   CDS             94161..95099
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="SMR0098"
FT                   /product="probable aminotransferase protein (pseudogene)"
FT                   /EC_number="2.6.1.-"
FT                   /note="Similar to many Prokaryotic and Eukaryotic
FT                   aminotransferases including: Rhizobium meliloti probable
FT                   aminotransferase protein Rb0267 or Smb20277 SWALL:Q92WR2
FT                   (EMBL:AL603642) (447 aa) fasta scores: E(): 1.4e-68, 60.84%
FT                   id in 309 aa and to Ralstonia solanacearum putative
FT                   aminotransferase protein Rsc0082 or Rs02256 SWALL:Q8Y398
FT                   (EMBL:AL646057) (450 aa) fasta scores: E(): 1.6e-62, 56.25%
FT                   id in 304 aa and to Schizosaccharomyces pombe putative
FT                   aminotransferase C1773.03c Spbc1773.03C SWALL:O94562
FT                   (EMBL:AL033389) (459 aa) fasta scores: E(): 5.6e-51, 48.18%
FT                   id in 303 aa. Note this CDS has been disrupted by the
FT                   insertion of an IS26 element."
FT   misc_feature    94233..95072
FT                   /note="Pfam match to entry PF00202 aminotran_3,
FT                   Aminotransferase class-III , score 28.5, E-value 7.1e-17"
FT   misc_feature    94464..94577
FT                   /note="PS00600 Aminotransferases class-III
FT                   pyridoxal-phosphate attachment site."
FT   CDS             95096..95647
FT                   /transl_table=11
FT                   /locus_tag="SMR0099"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="InterPro:IPR029032"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU5"
FT                   /protein_id="CAE51627.1"
FT   CDS             95780..96532
FT                   /transl_table=11
FT                   /locus_tag="SMR0100"
FT                   /product="exported solute-binding protein"
FT                   /note="Similar to many including: Escherichia coli and
FT                   Escherichia coli O157:H7 glutamine-binding periplasmic
FT                   protein precursor GlnH or b0811 or z1033 or ecs0889
FT                   SWALL:GLNH_ECOLI (SWALL:P10344) (248 aa) fasta scores: E():
FT                   1.2e-46, 52.38% id in 252 aa and to Yersinia pestis
FT                   putative glutamine-binding periplasmic protein GlnH or
FT                   ypo2512 SWALL:Q8ZDP4 (EMBL:AJ414152) (247 aa) fasta scores:
FT                   E(): 4e-48, 54% id in 250 aa"
FT                   /db_xref="GOA:Q6MXU4"
FT                   /db_xref="InterPro:IPR001320"
FT                   /db_xref="InterPro:IPR001638"
FT                   /db_xref="InterPro:IPR018313"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU4"
FT                   /protein_id="CAE51628.1"
FT   misc_feature    95780..95854
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.998 between residues 25 and 26"
FT   misc_feature    95864..96520
FT                   /note="Pfam match to entry PF00497 SBP_bac_3, Bacterial
FT                   extracellular solute-binding proteins, family 3 , score
FT                   253.6, E-value 1.7e-73"
FT   misc_feature    95927..95968
FT                   /note="PS01039 Bacterial extracellular solute-binding
FT                   proteins, family 3 signature."
FT   CDS             96585..97241
FT                   /transl_table=11
FT                   /locus_tag="SMR0101"
FT                   /product="membrane transport system permease protein"
FT                   /note="Similar to many including: Escherichia coli and
FT                   Escherichia coli O157:H7 glutamine transport system
FT                   permease protein GlnP or b0810 or z1032 or ecs0888
FT                   SWALL:GLNP_ECOLI (SWALL:P10345) (219 aa) fasta scores: E():
FT                   7.6e-57, 68.95% id in 219 aa and to Yersinia pestis
FT                   putative glutamine transport system permease GlnP or
FT                   ypo2513 SWALL:Q8ZDP3 (EMBL:AJ414152) (218 aa) fasta scores:
FT                   E(): 6e-59, 70.18% id in 218 aa"
FT                   /db_xref="GOA:Q6MXU3"
FT                   /db_xref="InterPro:IPR000515"
FT                   /db_xref="InterPro:IPR010065"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU3"
FT                   /protein_id="CAE51629.1"
FT   misc_feature    join(96642..96710,96744..96812,96855..96923,96984..97052,
FT                   97140..97208)
FT                   /note="5 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 20-42, 54-76, 91-113, 134-156
FT                   and 186-208"
FT   misc_feature    96915..97127
FT                   /note="Pfam match to entry PF00528 BPD_transp,
FT                   Binding-protein-dependent transport systems inner membrane
FT                   component , score 71.6, E-value 1.1e-18"
FT   misc_feature    96918..97004
FT                   /note="PS00402 Binding-protein-dependent transport systems
FT                   inner membrane comp. sign."
FT   CDS             <97244..>97330
FT                   /transl_table=11
FT                   /locus_tag="SMR0102"
FT                   /product="glutamine transport ATP-binding protein
FT                   (fragment)"
FT                   /note="Similar to the very N-terminus of: Escherichia coli
FT                   glutamine transport ATP-binding protein GlnQ or b0809
FT                   SWALL:GLNQ_ECOLI (SWALL:P10346) (240 aa) fasta scores: E():
FT                   2.8e-05, 64.28% id in 28 aa, and to Salmonella typhimurium
FT                   and Salmonella typhi glutamine transport ATP-binding
FT                   protein GlnQ or stm0828 or sty0866 SWALL:P74888
FT                   (EMBL:U73111) (240 aa) fasta scores: E(): 2.8e-05, 64.28%
FT                   id in 28 aa. This CDS is a gene remnant which may have been
FT                   generated, in part at least, by the adjacent IS26 element."
FT                   /db_xref="GOA:Q6MXU2"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU2"
FT                   /protein_id="CAE51630.1"
FT                   /translation="MVEFSAVAKHFGTTQVLHDINLKIDAGEY"
FT   CDS             complement(97628..98344)
FT                   /transl_table=11
FT                   /gene="tnIS26"
FT                   /locus_tag="SMR0103"
FT                   /product="transposase for IS26"
FT                   /note="Highly similar to many transposases including:
FT                   Salmonella enterica subsp. enterica serovar Typhimurium
FT                   transposase IS26 SWALL:Q9L4E4 (EMBL:AJ245670) (238 aa)
FT                   fasta scores: E(): 2.2e-102, 99.58% id in 238 aa and
FT                   Providencia rettgeri transposase TnpIS15 TpnA
FT                   SWALL:AAM08031 (EMBL:AY090559) (238 aa) fasta scores: E():
FT                   2.2e-102, 99.58% id in 238 aa"
FT                   /db_xref="GOA:Q6MXU8"
FT                   /db_xref="InterPro:IPR001584"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR032874"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU8"
FT                   /protein_id="CAE51631.1"
FT                   GDPLGEMRLVSRVFEM"
FT   misc_feature    complement(97676..98134)
FT                   /note="Pfam match to entry PF00665 rve, Integrase core
FT                   domain , score 54.9, E-value 1.1e-13"
FT   CDS             complement(98486..99604)
FT                   /transl_table=11
FT                   /gene="adhC"
FT                   /locus_tag="SMR0104"
FT                   /product="alcohol dehydrogenase class III"
FT                   /note="Similar to Escherichia coli alcohol dehydrogenase
FT                   class III AdhC or b0356 SWALL:ADH3_ECOLI (SWALL:P25437)
FT                   (369 aa) fasta scores: E(): 3.4e-118, 81.84% id in 369 aa
FT                   and to Salmonella typhimurium alcohol dehydrogenase class
FT                   III Stm1627 SWALL:Q8ZPA8 (EMBL:AE008771) (372 aa) fasta
FT                   scores: E(): 4.5e-138, 94.87% id in 371 aa"
FT                   /db_xref="GOA:Q6MXU0"
FT                   /db_xref="InterPro:IPR002328"
FT                   /db_xref="InterPro:IPR011032"
FT                   /db_xref="InterPro:IPR013149"
FT                   /db_xref="InterPro:IPR013154"
FT                   /db_xref="InterPro:IPR014183"
FT                   /db_xref="InterPro:IPR016040"
FT                   /db_xref="InterPro:IPR020843"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU0"
FT                   /protein_id="CAE51632.1"
FT   misc_feature    complement(98498..99580)
FT                   /note="Pfam match to entry PF00107 adh_zinc, Zinc-binding
FT                   dehydrogenase , score 504.1, E-value 7e-149"
FT   misc_feature    complement(99380..99424)
FT                   /note="PS00059 Zinc-containing alcohol dehydrogenases
FT                   signature."
FT   CDS             complement(99650..99925)
FT                   /transl_table=11
FT                   /locus_tag="SMR0105"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to many including: Salmonella typhimurium
FT                   putative cytoplasmic protein Stm1628 SWALL:Q8ZPA7
FT                   (EMBL:AE008771) (91 aa) fasta scores: E(): 2.5e-28, 87.91%
FT                   id in 91 aa and to Escherichia coli hypothetical protein
FT                   YaiN or b0357 SWALL:YAIN_ECOLI (SWALL:P55756) (91 aa) fasta
FT                   scores: E(): 7.7e-16, 57.14% id in 91 aa"
FT                   /db_xref="GOA:Q6MXT9"
FT                   /db_xref="InterPro:IPR003735"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXT9"
FT                   /protein_id="CAE51633.1"
FT   misc_feature    complement(99656..99844)
FT                   /note="Pfam match to entry PF02583 DUF156, Uncharacterized
FT                   BCR, COG1937 , score 52.4, E-value 6.5e-13"
FT   CDS             complement(100130..100459)
FT                   /transl_table=11
FT                   /locus_tag="SMR0106"
FT                   /product="lipoprotein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXT8"
FT                   /protein_id="CAE51634.1"
FT                   PIIIL"
FT   misc_feature    complement(100403..100459)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.944) with cleavage
FT                   site probability 0.880 between residues 19 and 20"
FT   misc_feature    complement(100412..100444)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS             100620..101114
FT                   /transl_table=11
FT                   /locus_tag="SMR0107"
FT                   /product="hypothetical protein"
FT                   /note="Weakly similar to many acetyltransferases including:
FT                   Pseudomonas aeruginosa probable N-acetyltransferase Pa0478
FT                   SWALL:Q9I640 (EMBL:AE004485) (158 aa) fasta scores: E():
FT                   1.2e-05, 25% id in 160 aa and to Anabaena sp. putative
FT                   acetyltransferase Alr4250 SWALL:Q9KHE3 (EMBL:AF262218) (164
FT                   aa) fasta scores: E(): 3.4e-05, 23.75% id in 160 aa"
FT                   /db_xref="GOA:Q6MXT7"
FT                   /db_xref="InterPro:IPR000182"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXT7"
FT                   /protein_id="CAE51635.1"
FT                   I"
FT   misc_feature    100791..101045
FT                   /note="Pfam match to entry PF00583 Acetyltransf,
FT                   Acetyltransferase (GNAT) family , score 36.7, E-value
FT                   3.4e-08"
FT   CDS             complement(101315..101974)
FT                   /transl_table=11
FT                   /gene="cat"
FT                   /locus_tag="SMR0108"
FT                   /product="chloramphenicol acetyltransferase"
FT                   /note="Highly similar to many chloramphenicol
FT                   acetyltransferases including: Escherichia coli, Salmonella
FT                   typh, and Acinetobacter baumannii Cat or Hcm1.206
FT                   SWALL:CAT_ECOLI (SWALL:P00483) (219 aa) fasta scores: E():
FT                   3e-94, 99.08% id in 219 aa and to Proteus mirabilis Cat
FT                   SWALL:CAT_PROMI (SWALL:P07641) (217 aa) fasta scores: E():
FT                   3.8e-70, 76.16% id in 214 aa"
FT                   /db_xref="GOA:Q6MXT6"
FT                   /db_xref="InterPro:IPR001707"
FT                   /db_xref="InterPro:IPR018372"
FT                   /db_xref="InterPro:IPR023213"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXT6"
FT                   /protein_id="CAE51636.1"
FT   misc_feature    complement(101348..101959)
FT                   /note="Pfam match to entry PF00302 CAT, Chloramphenicol
FT                   acetyltransferase , score 525.6, E-value 2.3e-155"
FT   misc_feature    complement(101375..101407)
FT                   /note="PS00100 Chloramphenicol acetyltransferase active
FT                   site."
FT   CDS             complement(102196..102912)
FT                   /transl_table=11
FT                   /gene="tnIS26"
FT                   /locus_tag="SMR0109"
FT                   /product="transposase for IS26"
FT                   /note="Highly similar to many transposases including:
FT                   Salmonella enterica subsp. enterica serovar Typhimurium
FT                   transposase IS26 SWALL:Q9L4E4 (EMBL:AJ245670) (238 aa)
FT                   fasta scores: E(): 2.3e-102, 99.58% id in 238 aa and
FT                   Providencia rettgeri transposase TnpIS15 TpnA
FT                   SWALL:AAM08032 (EMBL:AY090559) (238 aa) fasta scores: E():
FT                   2.3e-102, 99.58% id in 238 aa"
FT                   /db_xref="GOA:Q6MXU8"
FT                   /db_xref="InterPro:IPR001584"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR032874"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU8"
FT                   /protein_id="CAE51637.1"
FT                   GDPLGEMRLVSRVFEM"
FT   misc_feature    complement(102244..102702)
FT                   /note="Pfam match to entry PF00665 rve, Integrase core
FT                   domain , score 54.9, E-value 1.1e-13"
FT   CDS             complement(103018..103833)
FT                   /transl_table=11
FT                   /gene="aphA"
FT                   /locus_tag="SMR0110"
FT                   /product="aminoglycoside 3'-phosphotransferase"
FT                   /note="Similar to many encoding kanamycin resistance
FT                   including: Escherichia coli aminoglycoside
FT                   3'-phosphotransferase SWALL:KKA1_ECOLI (SWALL:P00551) (271
FT                   aa) fasta scores: E(): 1.5e-114, 98.52% id in 271 aa and to
FT                   Klebsiella pneumoniae aminoglycoside 3'-phosphotransferase
FT                   Apha7.2 or pp-kan or apha1-iab or aphaI SWALL:Q05786
FT                   (EMBL:D16172) (271 aa) fasta scores: E(): 1.1e-115, 100% id
FT                   in 271 aa"
FT                   /db_xref="GOA:Q6MXT4"
FT                   /db_xref="InterPro:IPR002575"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR024165"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXT4"
FT                   /protein_id="CAE51638.1"
FT   misc_feature    complement(103021..103767)
FT                   /note="Pfam match to entry PF01636 APH, Phosphotransferase
FT                   enzyme family , score 280.6, E-value 1.3e-81"
FT   misc_feature    complement(103216..103254)
FT                   /note="PS00109 Tyrosine protein kinases specific
FT                   active-site signature."
FT   CDS             103972..104688
FT                   /transl_table=11
FT                   /gene="tnIS26"
FT                   /locus_tag="SMR0112"
FT                   /product="transposase for IS26"
FT                   /note="Highly similar to many transposases including:
FT                   Salmonella enterica subsp. enterica serovar Typhimurium
FT                   transposase IS26 SWALL:Q9L4E4 (EMBL:AJ245670) (238 aa)
FT                   fasta scores: E(): 2.3e-102, 99.58% id in 238 aa and
FT                   Providencia rettgeri transposase TnpIS15 TpnA
FT                   SWALL:AAM08032 (EMBL:AY090559) (238 aa) fasta scores: E():
FT                   2.3e-102, 99.58% id in 238 aa"
FT                   /db_xref="GOA:Q6MXU8"
FT                   /db_xref="InterPro:IPR001584"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR032874"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXU8"
FT                   /protein_id="CAE51639.1"
FT                   GDPLGEMRLVSRVFEM"
FT   misc_feature    104182..104640
FT                   /note="Pfam match to entry PF00665 rve, Integrase core
FT                   domain , score 54.9, E-value 1.1e-13"
FT   misc_feature    104740..105048
FT                   /note="Pfam match to entry PF00665 rve, Integrase core
FT                   domain , score 36.1, E-value 2.1e-10"
FT   CDS             104743..105249
FT                   /pseudo
FT                   /transl_table=11
FT                   /gene="tnpA"
FT                   /locus_tag="SMR0113"
FT                   /product="transposase (pseudogene)"
FT                   /note="Similar to the C-terminus of many tansposases
FT                   including: Salmonella enterica subsp. enterica serovar
FT                   Typhimurium transposase TnpA SWALL:Q9FDH9 (EMBL:AF261825)
FT                   (264 aa) fasta scores: E(): 3.7e-66, 100% id in 168 aa and
FT                   to Escherichia coli, and Providencia rettgeri p22 protein
FT                   or TpnA SWALL:Q56369 (EMBL:M12900) (234 aa) fasta scores:
FT                   E(): 9.5e-31, 61.64% id in 146 aa. This CDS has been
FT                   disrupted by the insertion of an IS26 element"
FT   CDS             <105304..>105567
FT                   /transl_table=11
FT                   /gene="tnpA"
FT                   /locus_tag="SMR0114"
FT                   /product="transposase (fragment)"
FT                   /note="Similar to the C-terminus of many transposases
FT                   including: Corynebacterium glutamicum protein TnpA or
FT                   Hcm1.162C SWALL:Q49185 (EMBL:AJ420072) (254 aa) fasta
FT                   scores: E(): 2.7e-34, 100% id in 88 aa, and to Salmonella
FT                   enterica subsp. enterica serovar Typhimurium transposase
FT                   TnpA SWALL:Q9FDH9 (EMBL:AF261825) (264 aa) fasta scores:
FT                   E(): 2.8e-34, 100% id in 88 aa. This CDS is a discrete gene
FT                   remnant and does not form part of the upstream transposase
FT                   pseudogene SMR0113."
FT                   /db_xref="InterPro:IPR032874"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXT2"
FT                   /protein_id="CAE51641.1"
FT   CDS             complement(<105627..105671)
FT                   /transl_table=11
FT                   /locus_tag="SMR0115"
FT                   /product="transposase (remnant)"
FT                   /note="This is a gene fragment which is highly similar to
FT                   Shigella flexneri, Pseudomonas aeruginosa, and Escherichia
FT                   coli TniA transposase from IS21 SWALL:Q56381 (EMBL:U42226)
FT                   (571 aa) fasta scores: E(): 3.4e-06, 100% id in 15 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXT1"
FT                   /protein_id="CAE51642.1"
FT                   /translation="MLNTRVHQSEVSMAT"
FT   CDS             complement(105710..>105775)
FT                   /transl_table=11
FT                   /locus_tag="SMR0115A"
FT                   /product="conserved hypothetical protein (remnant)"
FT                   /note="This is a gene remnant that is highly similar to
FT                   part of Escherichia coli, and Salmonella typhi hypothetical
FT                   protein YaeA protein or Hcm1.227C SWALL:Q9WTI2
FT                   (EMBL:AP000342) (235 aa) fasta scores: E(): 2.7e-07, 100%
FT                   id in 21 aa and to Escherichia coli hypothetical 25.8 kDa
FT                   protein urf2 SWALL:O85669 (EMBL:AF071413) (235 aa) fasta
FT                   scores: E(): 2.7e-07, 100% id in 21 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXT0"
FT                   /protein_id="CAE51643.1"
FT                   /translation="VIFRRRLHQLIGRNGCCAASS"
FT   CDS             complement(105808..106020)
FT                   /transl_table=11
FT                   /gene="tnpM"
FT                   /locus_tag="SMR0116"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar in part to several including: the C-terminus
FT                   of a transposon Tn21 modulator protein from Escherichia
FT                   coli transposon TnpM SWALL:TNPM_ECOLI (SWALL:P04162) (116
FT                   aa) fasta scores: E(): 8.1e-18, 71.01% id in 69 aa. Similar
FT                   over the entire protein to hypothetical proteins from:
FT                   Acinetobacter calcoaceticus, Pantoea agglomerans,
FT                   Alcaligenes sp., Enterobacter cloacae, Escherichia coli,
FT                   Salmonella typhi, and Acinetobacter sp. Urf2Y or Hcm1.161
FT                   or Urf-2Y SWALL:Q52113 (EMBL:AF213017) (70 aa) fasta
FT                   scores: E(): 5.9e-29, 100% id in 70 aa. Note this CDS lacks
FT                   sequence identity to the N-terminal portion of the
FT                   modulator protein TnpM and so it remains possible that this
FT                   CDS is a pseudogene."
FT                   /db_xref="InterPro:IPR021767"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS9"
FT                   /protein_id="CAE51644.1"
FT   CDS             complement(106086..106322)
FT                   /transl_table=11
FT                   /gene="merE"
FT                   /locus_tag="SMR0117"
FT                   /product="putative mercury resistance protein"
FT                   /note="Similar to Pseudomonas aeruginosa hypothetical
FT                   mercuric resistance protein MerE SWALL:MERE_PSEAE
FT                   (SWALL:P06690) (78 aa) fasta scores: E(): 3e-25, 83.11% id
FT                   in 77 aa, and to Acinetobacter calcoaceticus, Pantoea
FT                   agglomerans, Alcaligenes sp., Enterobacter cloacae,
FT                   Escherichia coli, mercury resistant bacterium '96 SE13,
FT                   Pseudomonas aeruginosa, and Acinetobacter sp MerE protein
FT                   or Urf1 or Urf-1 SWALL:Q52111 (EMBL:AF213017) (78 aa) fasta
FT                   scores: E(): 6.5e-31, 100% id in 78 aa"
FT                   /db_xref="GOA:Q6MXS8"
FT                   /db_xref="InterPro:IPR007746"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS8"
FT                   /protein_id="CAE51645.1"
FT   CDS             complement(106319..106705)
FT                   /transl_table=11
FT                   /gene="merD"
FT                   /locus_tag="SMR0118"
FT                   /product="mercuric resistance protein"
FT                   /note="Identical to Salmonella typhi, and Enterobacter
FT                   agglomerans mercuric resistance protein MerD or Hcm1.159
FT                   SWALL:MERD_SALTI (SWALL:P94703) (121 aa) fasta scores: E():
FT                   6.5e-44, 100% id in 121 aa, and to Escherichia coli, and
FT                   Enterobacter cloacae DNA, mosaic mercury resistance protein
FT                   MerD SWALL:O07935 (EMBL:Y10102) (121 aa) fasta scores: E():
FT                   1.2e-43, 99.17% id in 121 aa"
FT                   /db_xref="GOA:Q6MXS7"
FT                   /db_xref="InterPro:IPR000551"
FT                   /db_xref="InterPro:IPR009061"
FT                   /db_xref="InterPro:IPR011797"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS7"
FT                   /protein_id="CAE51646.1"
FT   misc_feature    complement(106655..106705)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.767) with cleavage
FT                   site probability 0.629 between residues 17 and 18"
FT   CDS             complement(106702..108387)
FT                   /transl_table=11
FT                   /gene="merA"
FT                   /locus_tag="SMR0119"
FT                   /product="mercuric reductase"
FT                   /note="Highly similar to Enterobacter agglomerans mercuric
FT                   reductase MerA SWALL:MERA_ENTAG (SWALL:P94702) (561 aa)
FT                   fasta scores: E(): 3.8e-200, 99.64% id in 561 aa and to
FT                   Salmonella typhi putative mercuric reductase MerA
FT                   SWALL:Q935L3 (EMBL:AL513383) (561 aa) fasta scores: E():
FT                   4.5e-201, 100% id in 561 aa"
FT                   /db_xref="GOA:Q6MXS6"
FT                   /db_xref="InterPro:IPR004099"
FT                   /db_xref="InterPro:IPR006121"
FT                   /db_xref="InterPro:IPR012999"
FT                   /db_xref="InterPro:IPR016156"
FT                   /db_xref="InterPro:IPR017969"
FT                   /db_xref="InterPro:IPR021179"
FT                   /db_xref="InterPro:IPR023753"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS6"
FT                   /protein_id="CAE51647.1"
FT   misc_feature    complement(106750..107079)
FT                   /note="Pfam match to entry PF02852 pyr_redox_dim, Pyridine
FT                   nucleotide-disulphide oxidoreductase, dimerisation domain ,
FT                   score 153.5, E-value 2.4e-43"
FT   misc_feature    complement(107149..108090)
FT                   /note="Pfam match to entry PF00070 pyr_redox, Pyridine
FT                   nucleotide-disulphide oxidoreductase , score 287.0, E-value
FT                   1.5e-83"
FT   misc_feature    complement(107959..107991)
FT                   /note="PS00076 Pyridine nucleotide-disulphide
FT                   oxidoreductases class-I active site."
FT   misc_feature    complement(108190..108384)
FT                   /note="Pfam match to entry PF00403 HMA,
FT                   Heavy-metal-associated domain , score 87.1, E-value
FT                   2.3e-23"
FT   misc_feature    complement(108283..108372)
FT                   /note="PS01047 Heavy-metal-associated domain."
FT   CDS             complement(108426..108851)
FT                   /transl_table=11
FT                   /gene="merC"
FT                   /locus_tag="SMR0120"
FT                   /product="mercury resistance inner membrane protein"
FT                   /note="Similar to Thiobacillus ferrooxidans Mercuric
FT                   resistance protein MerC SWALL:MERC_THIFE (SWALL:P22905)
FT                   (143 aa) fasta scores: E(): 3.4e-25, 51.04% id in 143 aa
FT                   and to Acinetobacter calcoaceticus, Pantoea agglomerans,
FT                   Enterobacter cloacae, Leclercia adecarboxylata, and
FT                   Salmonella typhi protein MerC SWALL:Q52108 (EMBL:AF213017)
FT                   (141 aa) fasta scores: E(): 1.9e-53, 100% id in 141 aa"
FT                   /db_xref="GOA:Q6MXS5"
FT                   /db_xref="InterPro:IPR004891"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS5"
FT                   /protein_id="CAE51648.1"
FT   misc_feature    complement(108459..108842)
FT                   /note="Pfam match to entry PF03203 MerC, MerC mercury
FT                   resistance protein , score 339.5, E-value 2.5e-99"
FT   misc_feature    complement(join(108483..108542,108552..108620,
FT                   108639..108707,108750..108818))
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34, 49-71, 78-100 and
FT                   104-123"
FT   CDS             complement(108879..109154)
FT                   /transl_table=11
FT                   /gene="merP"
FT                   /locus_tag="SMR0121"
FT                   /product="mercuric transport protein periplasmic component"
FT                   /note="Identical to Salmonella typhi, Enterobacter
FT                   agglomerans mercuric transport protein periplasmic
FT                   component precursor MerP or Hcm1.153 SWALL:MERP_SALTI
FT                   (SWALL:P94701) (91 aa) fasta scores: E(): 4.3e-32, 100% id
FT                   in 91 aa and to Acinetobacter calcoaceticus mercuric
FT                   transport protein periplasmic component precursor MerP
FT                   SWALL:MERP_ACICA (SWALL:Q52107) (91 aa) fasta scores: E():
FT                   1.8e-30, 96.7% id in 91 aa"
FT                   /db_xref="GOA:Q6MXS4"
FT                   /db_xref="InterPro:IPR001802"
FT                   /db_xref="InterPro:IPR006121"
FT                   /db_xref="InterPro:IPR011795"
FT                   /db_xref="InterPro:IPR017969"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS4"
FT                   /protein_id="CAE51649.1"
FT   CDS             complement(109170..109535)
FT                   /transl_table=11
FT                   /gene="merT"
FT                   /locus_tag="SMR0122"
FT                   /product="mercuric transport protein"
FT                   /note="Highly similar to many mercuric transport proteins
FT                   including: Enterobacter agglomerans MerT SWALL:MERT_ENTAG
FT                   (SWALL:P94700) (126 aa) fasta scores: E(): 6.7e-48, 100% id
FT                   in 120 aa and to Serratia marcescens MerT SWALL:MERT_SERMA
FT                   (SWALL:P13112) (116 aa) fasta scores: E(): 1e-44, 96.52% id
FT                   in 115 aa"
FT                   /db_xref="GOA:Q6MXS3"
FT                   /db_xref="InterPro:IPR003457"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS3"
FT                   /protein_id="CAE51650.1"
FT                   ALVLVSLGFPYVMPFFY"
FT   misc_feature    complement(109173..109517)
FT                   /note="Pfam match to entry PF02411 MerT, MerT mercuric
FT                   transport protein , score 295.7, E-value 3.7e-86"
FT   misc_feature    complement(join(109176..109244,109323..109376,
FT                   109419..109487))
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 17-39, 54-71 and 98-120"
FT   misc_feature    complement(109449..109481)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS             109607..110062
FT                   /transl_table=11
FT                   /gene="merR"
FT                   /locus_tag="SMR0123"
FT                   /product="mercuric resistance operon regulatory protein"
FT                   /note="Similar to many mercuric resistance regulatory
FT                   proteins including: Pseudomonas aeruginosa and Pseudomonas
FT                   fluorescens mercuric resistance operon regulatory protein
FT                   MerR SWALL:MERR_PSEAE (SWALL:P06688) (144 aa) fasta scores:
FT                   E(): 1.4e-47, 92.95% id in 142 aa and to Acinetobacter
FT                   calcoaceticus, Escherichia coli, Alcaligenes sp., Pantoea
FT                   agglomerans, Enterobacter cloacae, Acinetobacter sp., and
FT                   Acinetobacter sp. LS56-7 regulatory protein MerR
FT                   SWALL:Q57106 (EMBL:Y09026) (151 aa) fasta scores: E():
FT                   4.4e-56, 100% id in 151 aa"
FT                   /db_xref="GOA:Q6MXS2"
FT                   /db_xref="InterPro:IPR000551"
FT                   /db_xref="InterPro:IPR009061"
FT                   /db_xref="InterPro:IPR011794"
FT                   /db_xref="InterPro:IPR015358"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS2"
FT                   /protein_id="CAE51651.1"
FT   misc_feature    109628..109693
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1571.000, SD 4.54 at aa 8-29, sequence
FT   misc_feature    109637..109705
FT                   /note="PS00552 Bacterial regulatory proteins, merR family
FT                   signature."
FT   misc_feature    109637..109744
FT                   /note="Pfam match to entry PF00376 merR, Bacterial
FT                   regulatory proteins, merR family , score 68.5, E-value
FT                   9.5e-18"
FT   CDS             110128..110736
FT                   /transl_table=11
FT                   /locus_tag="SMR0124"
FT                   /product="hypothetical protein"
FT                   /note="Similar in part to Salmonella typhi hypothetical
FT                   protein Hcm1.177 SWALL:Q935K6 (EMBL:AL513383) (236 aa)
FT                   fasta scores: E(): 2.5e-38, 53.09% id in 194 aa"
FT                   /db_xref="InterPro:IPR003615"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS1"
FT                   /protein_id="CAE51652.1"
FT   CDS             110798..111001
FT                   /transl_table=11
FT                   /locus_tag="SMR0125"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXS0"
FT                   /protein_id="CAE51653.1"
FT   CDS             complement(111343..111747)
FT                   /transl_table=11
FT                   /gene="h-ns"
FT                   /locus_tag="SMR0126"
FT                   /product="hn-s family DNA-binding protein"
FT                   /note="Similar to many hn-s family DNA_binding proteins
FT                   including:Escherichia coli, and Escherichia coli O157:H7
FT                   DNA-binding protein h-ns SWALL:HNS_ECOLI (SWALL:P08936)
FT                   (136 aa) fasta scores: E(): 7e-24, 64.23% id in 137 aa and
FT                   Salmonella typhi putative DNA-binding protein Hcm1.178aC
FT                   SWALL:Q935K4 (EMBL:AL513383) (134 aa) fasta scores: E():
FT                   4.3e-34, 81.34% id in 134 aa"
FT                   /db_xref="GOA:Q6MXR9"
FT                   /db_xref="InterPro:IPR001801"
FT                   /db_xref="InterPro:IPR027444"
FT                   /db_xref="InterPro:IPR027454"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR9"
FT                   /protein_id="CAE51654.1"
FT   misc_feature    complement(111361..111747)
FT                   /note="Pfam match to entry PF00816 Histone_HNS, H-NS
FT                   histone family , score 245.6, E-value 4.4e-71"
FT   CDS             complement(111925..112284)
FT                   /transl_table=11
FT                   /locus_tag="SMR0127"
FT                   /product="putative inner membrane protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXR8"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR8"
FT                   /protein_id="CAE51655.1"
FT                   LRFLLDDLQHEYPKQ"
FT   misc_feature    complement(join(111970..112038,112081..112140,
FT                   112159..112227))
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 20-42, 49-68 and 83-105"
FT   CDS             complement(112521..112976)
FT                   /transl_table=11
FT                   /locus_tag="SMR0128"
FT                   /product="lipoprotein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR7"
FT                   /protein_id="CAE51656.1"
FT   misc_feature    complement(112911..112943)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   misc_feature    complement(112914..112976)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.988 between residues 21 and 22"
FT   CDS             complement(113036..113701)
FT                   /transl_table=11
FT                   /locus_tag="SMR0129"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0161 or Hcm1.180C SWALL:Q9L5I1 (EMBL:AF250878) (222 aa)
FT                   fasta scores: E(): 1.3e-49, 57.91% id in 221 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR6"
FT                   /protein_id="CAE51657.1"
FT   CDS             complement(113759..114139)
FT                   /transl_table=11
FT                   /locus_tag="SMR0130"
FT                   /product="hypothetical protein"
FT                   /note="Weakly similar in part to Shigella sonnei
FT                   hypothetical protein protein YaeB SWALL:Q9Z4G0
FT                   (EMBL:AB021078) (89 aa) fasta scores: E(): 1.9e-13, 56.52%
FT                   id in 69 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR5"
FT                   /protein_id="CAE51658.1"
FT   CDS             114891..115733
FT                   /transl_table=11
FT                   /gene="tnsA"
FT                   /locus_tag="SMR0132"
FT                   /product="Tn7-like transposase"
FT                   /note="Similar to Escherichia coli transposase for
FT                   transposon Tn7 TnsA SWALL:TNSA_ECOLI (SWALL:P13988) (273
FT                   aa) fasta scores: E(): 6e-12, 33.71% id in 261 aa and to
FT                   Thiobacillus ferrooxidans transposition complex TnsA
FT                   SWALL:Q56276 (EMBL:AF032884) (278 aa) fasta scores: E():
FT                   3.3e-20, 34.38% id in 253 aa"
FT                   /db_xref="GOA:Q6MXR4"
FT                   /db_xref="InterPro:IPR011335"
FT                   /db_xref="InterPro:IPR011856"
FT                   /db_xref="InterPro:IPR014833"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR4"
FT                   /protein_id="CAE51659.1"
FT   CDS             115765..117843
FT                   /transl_table=11
FT                   /gene="tnsB"
FT                   /locus_tag="SMR0133"
FT                   /product="Tn7-like transposition protein"
FT                   /note="Similar to Escherichia coli transposon Tn7
FT                   transposition protein TnsB SWALL:TNSB_ECOLI (SWALL:P13989)
FT                   (702 aa) fasta scores: E(): 1.7e-26, 26.46% id in 684 aa
FT                   and to Thiobacillus ferrooxidans TnsB SWALL:O50220
FT                   (EMBL:AF032884) (721 aa) fasta scores: E(): 1.3e-34, 28.46%
FT                   id in 513 aa"
FT                   /db_xref="GOA:Q6MXR3"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR3"
FT                   /protein_id="CAE51660.1"
FT   CDS             117843..119291
FT                   /transl_table=11
FT                   /gene="tnsC"
FT                   /locus_tag="SMR0134"
FT                   /product="Tn7-like transposition protein"
FT                   /note="Similar to Escherichia coli transposon Tn7
FT                   transposition protein TnsC SWALL:TNSC_ECOLI (SWALL:P05846)
FT                   (555 aa) fasta scores: E(): 1.9e-23, 31.07% id in 383 aa
FT                   and to Thiobacillus ferrooxidans TnsC SWALL:O50221
FT                   (EMBL:AF032884) (552 aa) fasta scores: E(): 9.5e-26, 30.96%
FT                   id in 352 aa"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR2"
FT                   /protein_id="CAE51661.1"
FT   misc_feature    118242..118265
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS             119323..120888
FT                   /transl_table=11
FT                   /gene="tnsD"
FT                   /locus_tag="SMR0135"
FT                   /product="Tn7-like transposition protein"
FT                   /note="Similar to Escherichia coli transposon Tn7
FT                   transposition protein TnsD SWALL:TNSD_ECOLI (SWALL:P13991)
FT                   (508 aa) fasta scores: E(): 8.8, 20.82% id in 533 aa, and
FT                   to Thiobacillus ferrooxidans TnsD SWALL:O50222
FT                   (EMBL:AF032884) (609 aa) fasta scores: E(): 0.0046, 21.86%
FT                   id in 494 aa"
FT                   /db_xref="InterPro:IPR009492"
FT                   /db_xref="InterPro:IPR032750"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR1"
FT                   /protein_id="CAE51662.1"
FT                   ELIK"
FT   misc_feature    120412..120477
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1369.000, SD 3.85 at aa 364-385, sequence
FT   CDS             120900..121826
FT                   /transl_table=11
FT                   /locus_tag="SMR0136"
FT                   /product="hypothetical protein"
FT                   /note="Weakly similar to Mamestra configurata
FT                   nucleopolyhedrovirus Ie0 SWALL:AAM09276 (EMBL:U59461) (234
FT                   aa) fasta scores: E(): 2.7, 22.33% id in 206 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXR0"
FT                   /protein_id="CAE51663.1"
FT   CDS             122179..122478
FT                   /transl_table=11
FT                   /locus_tag="SMR0138"
FT                   /product="putative transcriptional regulator"
FT                   /note="Similar to the Escherichia coli transcriptional
FT                   repressor protein HipB or b1508 SWALL:HIPB_ECOLI
FT                   (SWALL:P23873) (88 aa) fasta scores: E(): 0.091, 27.27% id
FT                   in 77 aa and to Ralstonia solanacearum putative
FT                   transcription regulator protein HipB or rsp1252 or rs03197
FT                   SWALL:Q8XQH3 (EMBL:AL646083) (88 aa) fasta scores: E():
FT                   2e-07, 45.23% id in 84 aa"
FT                   /db_xref="GOA:Q6MXQ9"
FT                   /db_xref="InterPro:IPR001387"
FT                   /db_xref="InterPro:IPR010982"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ9"
FT                   /protein_id="CAE51664.1"
FT   misc_feature    122227..122391
FT                   /note="Pfam match to entry PF01381 HTH_3, Helix-turn-helix
FT                   , score 47.1, E-value 2.5e-11"
FT   misc_feature    122254..122319
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1941.000, SD 5.80 at aa 26-47, sequence
FT   CDS             123042..124868
FT                   /transl_table=11
FT                   /locus_tag="SMR0139"
FT                   /product="ATP/GTP-binding protein"
FT                   /note="Similar to several including: Pediococcus
FT                   pentosaceus hypothetical 68.4 kDa protein SWALL:Q9XDL7
FT                   (EMBL:AF033858) (607 aa) fasta scores: E(): 6.1e-60, 36.95%
FT                   id in 552 aa, and to Salmonella enterica subsp. enterica
FT                   serovar Typhimurium putative exonuclease S024 SWALL:Q9ADT9
FT                   (EMBL:AF261825) (641 aa) fasta scores: E(): 0.00015, 21.52%
FT                   id in 525 aa"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ8"
FT                   /protein_id="CAE51665.1"
FT   misc_feature    123042..123173
FT                   /note="Pfam match to entry PF02463 SMC_N, RecF/RecN/SMC N
FT                   terminal domain , score 25.3, E-value 2.2e-07"
FT   misc_feature    123108..123146
FT                   /note="PS00018 EF-hand calcium-binding domain."
FT   misc_feature    123132..123155
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS             complement(125037..125387)
FT                   /transl_table=11
FT                   /locus_tag="SMR0140"
FT                   /product="putative exported protein"
FT                   /note="Similar to several proteins of undefined function
FT                   including: Rhizobium loti hypothetical protein Mlr5326
FT                   SWALL:Q98C23 (EMBL:AP003006) (130 aa) fasta scores: E():
FT                   2.4e-13, 45.61% id in 114 aa, and to Rhizobium meliloti
FT                   hypothetical signal peptide protein Smc00921, R00784 or
FT                   Smc00921 SWALL:Q92KL7 (EMBL:AL591784) (128 aa) fasta
FT                   scores: E(): 1e-08, 38.59% id in 114 aa"
FT                   /db_xref="InterPro:IPR005183"
FT                   /db_xref="InterPro:IPR012347"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ7"
FT                   /protein_id="CAE51666.1"
FT                   IEQMNKWLDSQK"
FT   misc_feature    complement(125052..125210)
FT                   /note="Pfam match to entry PF03713 DUF305, Domain of
FT                   unknown function , score 88.5, E-value 8.9e-24"
FT   misc_feature    complement(125331..125387)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.998) with cleavage
FT                   site probability 0.625 between residues 19 and 20"
FT   CDS             complement(125535..125966)
FT                   /transl_table=11
FT                   /gene="silE"
FT                   /locus_tag="SMR0141"
FT                   /product="silver-binding protein"
FT                   /note="Identical to Salmonella typhimurium silver-binding
FT                   protein SilE precursor SWALL:SILE_SALTY (SWALL:Q9Z4N3) (143
FT                   aa) fasta scores: E(): 5.1e-52, 100% id in 143 aa, and to
FT                   Escherichia coli probable copper-binding protein PcoE
FT                   precursor SWALL:PCOE_ECOLI (SWALL:Q47459) (144 aa) fasta
FT                   scores: E(): 6.2e-21, 47.18% id in 142 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ6"
FT                   /protein_id="CAE51667.1"
FT   CDS             complement(126211..127692)
FT                   /transl_table=11
FT                   /gene="silS"
FT                   /locus_tag="SMR0142"
FT                   /product="probable sensor kinase (silver resistance)"
FT                   /note="Identical to Salmonella typhimurium probable sensor
FT                   kinase involved in the modulation of Silver cation
FT                   resistance, SilS SWALL:SILS_SALTY (SWALL:Q9ZHD4) (497 aa)
FT                   fasta scores: E(): 1.8e-174, 93.15% id in 497 aa, and to
FT                   Escherichia coli sensor kinase cuss cuss or b0570
FT                   SWALL:CUSS_ECOLI (SWALL:P77485) (480 aa) fasta scores: E():
FT                   3.2e-100, 56.66% id in 480 aa"
FT                   /db_xref="GOA:Q6MXQ5"
FT                   /db_xref="InterPro:IPR003594"
FT                   /db_xref="InterPro:IPR003660"
FT                   /db_xref="InterPro:IPR003661"
FT                   /db_xref="InterPro:IPR004358"
FT                   /db_xref="InterPro:IPR005467"
FT                   /db_xref="InterPro:IPR006290"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ5"
FT                   /protein_id="CAE51668.1"
FT   misc_feature    complement(126247..126579)
FT                   /note="Pfam match to entry PF02518 HATPase_c, Histidine
FT                   kinase-, DNA gyrase B-, and HSP90-like ATPase , score
FT                   135.8, E-value 5.1e-38"
FT   misc_feature    complement(126709..126909)
FT                   /note="Pfam match to entry PF00512 HisKA, His Kinase A
FT                   (phosphoacceptor) domain , score 61.2, E-value 1.4e-15"
FT   misc_feature    complement(126919..127128)
FT                   /note="Pfam match to entry PF00672 HAMP, HAMP domain ,
FT                   score 50.1, E-value 3.2e-12"
FT   misc_feature    complement(127072..127131)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34 and 188-207"
FT   misc_feature    complement(127579..127692)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.974) with cleavage
FT                   site probability 0.761 between residues 38 and 39"
FT   CDS             complement(127685..128365)
FT                   /transl_table=11
FT                   /gene="silR"
FT                   /locus_tag="SMR0143"
FT                   /product="probable transcriptional regulatory
FT                   protein(silver resistance)"
FT                   /note="Identical to Salmonella typhimurium probable
FT                   transcriptional regulatory protein SilR involved in the
FT                   modulation of Silver cation resistance SWALL:SILR_SALTY
FT                   (SWALL:Q9ZHD3) (228 aa) fasta scores: E(): 2.9e-77, 92.98%
FT                   id in 228 aa and to Escherichia coli, and Escherichia coli
FT                   O157:H7 transcriptional regulatory protein CusR or b0571 or
FT                   z0709 or ecs0609 SWALL:CUSR_ECOLI (SWALL:P77380) (227 aa)
FT                   fasta scores: E(): 1.1e-75, 87.55% id in 225 aa"
FT                   /db_xref="GOA:Q6MXQ4"
FT                   /db_xref="InterPro:IPR001789"
FT                   /db_xref="InterPro:IPR001867"
FT                   /db_xref="InterPro:IPR006291"
FT                   /db_xref="InterPro:IPR011006"
FT                   /db_xref="InterPro:IPR011991"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ4"
FT                   /protein_id="CAE51669.1"
FT                   VPDA"
FT   misc_feature    complement(127712..127927)
FT                   /note="Pfam match to entry PF00486 trans_reg_C,
FT                   Transcriptional regulatory protein, C terminal , score
FT                   100.4, E-value 2.2e-27"
FT   misc_feature    complement(128006..128365)
FT                   /note="Pfam match to entry PF00072 response_reg, Response
FT                   regulator receiver domain , score 138.7, E-value 6.8e-39"
FT   CDS             128555..129940
FT                   /transl_table=11
FT                   /gene="silC"
FT                   /locus_tag="SMR0144"
FT                   /product="outer-membrane efflux lipoprotein (silver
FT                   resistance)"
FT                   /note="Highly similar to Salmonella typhimurium probable
FT                   outer membrane lipoprotein SilC involved in resistance to
FT                   Silver SWALL:SILC_SALTY (SWALL:Q9ZHD2) (461 aa) fasta
FT                   scores: E(): 2.5e-163, 97.39% id in 461 aa, and to
FT                   Escherichia coli probable outer membrane lipoprotein CusC
FT                   precursor or IbeB or b0572 SWALL:CUSC_ECOLI (SWALL:P77211)
FT                   (457 aa) fasta scores: E(): 2.3e-119, 71.83% id in 458 aa"
FT                   /db_xref="GOA:Q6MXQ3"
FT                   /db_xref="InterPro:IPR003423"
FT                   /db_xref="InterPro:IPR010131"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ3"
FT                   /protein_id="CAE51670.1"
FT                   WVE"
FT   misc_feature    128576..128608
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   misc_feature    128744..129331
FT                   /note="Pfam match to entry PF02321 OEP, Outer membrane
FT                   efflux protein , score 157.7, E-value 1.3e-44"
FT   misc_feature    129077..129142
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1016.000, SD 2.65 at aa 227-248, sequence
FT   misc_feature    129362..129928
FT                   /note="Pfam match to entry PF02321 OEP, Outer membrane
FT                   efflux protein , score 191.6, E-value 7.9e-55"
FT   CDS             129968..130321
FT                   /transl_table=11
FT                   /locus_tag="SMR0145"
FT                   /product="exported protein"
FT                   /note="Similar to Escherichia coli hypothetical protein
FT                   CusX precursor or b0573 SWALL:CUSX_ECOLI (SWALL:P77214)
FT                   (110 aa) fasta scores: E(): 1.1e-15, 47% id in 117 aa, and
FT                   to Salmonella typhimurium hypothetical 10.4 kDa protein
FT                   SWALL:Q9ZHD1 (EMBL:AF067954) (96 aa) fasta scores: E():
FT                   6.2e-32, 96.66% id in 90 aa. Note this CDS is situated
FT                   within the Silver resistance cluster."
FT                   /db_xref="InterPro:IPR021647"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ2"
FT                   /protein_id="CAE51671.1"
FT                   NISLLKSINVTQS"
FT   misc_feature    129968..130036
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.995 between residues 23 and 24"
FT   CDS             130435..131727
FT                   /transl_table=11
FT                   /gene="silB"
FT                   /locus_tag="SMR0146"
FT                   /product="exported protein (silver resistance)"
FT                   /note="Highly similar to Salmonella typhimurium putative
FT                   membrane fusion protein SilB precursor thought to be
FT                   involved in the resistance to silver SWALL:SILB_SALTY
FT                   (SWALL:Q9ZHD0) (430 aa) fasta scores: E(): 7.2e-158, 96.27%
FT                   id in 430 aa and to Escherichia coli putative copper efflux
FT                   system protein Cusb precursor cusb or b0574
FT                   SWALL:CUSB_ECOLI (SWALL:P77239) (407 aa) fasta scores: E():
FT                   7.1e-106, 67.56% id in 410 aa"
FT                   /db_xref="GOA:Q6MXQ1"
FT                   /db_xref="InterPro:IPR006143"
FT                   /db_xref="InterPro:IPR032317"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ1"
FT                   /protein_id="CAE51672.1"
FT   misc_feature    130435..130518
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.990) with cleavage
FT                   site probability 0.495 between residues 28 and 29"
FT   CDS             131738..134884
FT                   /transl_table=11
FT                   /gene="silA"
FT                   /locus_tag="SMR0147"
FT                   /product="putative cation efflux system protein (silver
FT                   resistance)"
FT                   /note="Similar to Salmonella typhimurium putative cation
FT                   efflux system protein SilA SWALL:SILA_SALTY (SWALL:Q9ZHC9)
FT                   (1048 aa) fasta scores: E(): 0, 98.66% id in 1048 aa, and
FT                   to Escherichia coli putative cation efflux system protein
FT                   CusA or b0575 SWALL:CUSA_ECOLI (SWALL:P38054) (1047 aa)
FT                   fasta scores: E(): 0, 87.26% id in 1044 aa"
FT                   /db_xref="GOA:Q6MXQ0"
FT                   /db_xref="InterPro:IPR001036"
FT                   /db_xref="InterPro:IPR004763"
FT                   /db_xref="InterPro:IPR027463"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXQ0"
FT                   /protein_id="CAE51673.1"
FT                   "
FT   misc_feature    131738..131851
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.698) with cleavage
FT                   site probability 0.565 between residues 38 and 39"
FT   misc_feature    131750..134854
FT                   /note="Pfam match to entry PF00873 ACR_tran, AcrB/AcrD/AcrF
FT                   family , score 1521.7, E-value 0"
FT   misc_feature    join(132761..132814,132827..132895,132905..132973,
FT                   133073..133141,133184..133252,133331..133399,
FT                   134357..134410,134429..134497,134525..134593,
FT                   134690..134743,134786..134854)
FT                   /note="12 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-32, 342-359, 364-386,
FT                   390-412, 446-468, 483-505, 532-554, 874-891, 898-920,
FT                   930-952, 985-1002 and 1017-1039"
FT   CDS             134971..135411
FT                   /transl_table=11
FT                   /locus_tag="SMR0148"
FT                   /product="putative exported protein"
FT                   /note="Similar to several proteins of undefined function
FT                   inclusding: Salmonella typhimurium hypothetical 11.1 kDa
FT                   protein SWALL:Q9ZHC8 (EMBL:AF067954) (105 aa) fasta scores:
FT                   E(): 3.2e-36, 96.19% id in 105 aa, and to Pseudomonas
FT                   aeruginosa hypothetical protein Pa4714 SWALL:Q9HV84
FT                   (EMBL:AE004885) (149 aa) fasta scores: E(): 6.3e-18, 43.47%
FT                   id in 138 aa"
FT                   /db_xref="InterPro:IPR007332"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP9"
FT                   /protein_id="CAE51674.1"
FT   misc_feature    134971..135027
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 1.000 between residues 19 and 20"
FT   CDS             135538..137985
FT                   /transl_table=11
FT                   /gene="silP"
FT                   /locus_tag="SMR0149"
FT                   /product="putative cation transporting P-type ATPase
FT                   (silver resistance)"
FT                   /note="Similar to Salmonella typhimurium putative cation
FT                   transporting P-type ATPase SilP SWALL:SILP_SALTY
FT                   (SWALL:Q9ZHC7) (824 aa) fasta scores: E(): 0, 95.09% id in
FT                   816 aa, and to Rhizobium leguminosarum copper-transporting
FT                   P-type ATPase ActP SWALL:ATCU_RHILV (SWALL:Q9X5V3) (841 aa)
FT                   fasta scores: E(): 2.1e-138, 54.2% id in 808 aa"
FT                   /db_xref="GOA:Q6MXP8"
FT                   /db_xref="InterPro:IPR001757"
FT                   /db_xref="InterPro:IPR007029"
FT                   /db_xref="InterPro:IPR008250"
FT                   /db_xref="InterPro:IPR009078"
FT                   /db_xref="InterPro:IPR011017"
FT                   /db_xref="InterPro:IPR018303"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR023299"
FT                   /db_xref="InterPro:IPR027256"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP8"
FT                   /protein_id="CAE51675.1"
FT                   LGK"
FT   misc_feature    join(136009..136068,136111..136170,136204..136272,
FT                   136315..136383,136780..136848,136876..136935,
FT                   137809..137877,137887..137955)
FT                   /note="8 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 158-177, 192-211, 223-245,
FT                   260-282, 415-437, 447-466, 758-780 and 784-806"
FT   misc_feature    136342..137013
FT                   /note="Pfam match to entry PF00122 E1-E2_ATPase, E1-E2
FT                   ATPase , score 346.8, E-value 1.6e-101"
FT   misc_feature    136549..136572
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    137023..137703
FT                   /note="Pfam match to entry PF00702 Hydrolase, haloacid
FT                   dehalogenase-like hydrolase , score 126.9, E-value 2.5e-35"
FT   misc_feature    137041..137061
FT                   /note="PS00154 E1-E2 ATPases phosphorylation site."
FT   CDS             138026..138223
FT                   /transl_table=11
FT                   /locus_tag="SMR0150"
FT                   /product="putative exported protein"
FT                   /note="Similar to proteins of undefined function from:
FT                   Rhizobium meliloti hypothetical protein Ra0590 or sma1089
FT                   SWALL:Q92ZA1 (EMBL:AE007248) (67 aa) fasta scores: E():
FT                   6.7e-12, 59.01% id in 61 aa, and to Anabaena sp.
FT                   hypothetical protein Asl7591 SWALL:Q8ZSC0 (EMBL:AP003602)
FT                   (76 aa) fasta scores: E(): 3.2e-10, 57.62% id in 59 aa"
FT                   /db_xref="GOA:Q6MXP7"
FT                   /db_xref="InterPro:IPR021682"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP7"
FT                   /protein_id="CAE51676.1"
FT   misc_feature    138026..138079
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.984) with cleavage
FT                   site probability 0.851 between residues 18 and 19"
FT   misc_feature    138104..138163
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-20 and 27-46"
FT   CDS             complement(138257..138994)
FT                   /transl_table=11
FT                   /locus_tag="SMR0151"
FT                   /product="putative peptidase"
FT                   /note="Similar to many proteins of undefined function
FT                   including: Salmonella typhimurium putative peptidase YebA
FT                   or Stm1890 SWALL:Q8ZNV9 (EMBL:AE008784) (439 aa) fasta
FT                   scores: E(): 7.8e-28, 40.95% id in 210 aa, and to
FT                   Escherichia coli hypothetical protein YebA precursor or
FT                   b1856 SWALL:YEBA_ECOLI (SWALL:P24204) (440 aa) fasta
FT                   scores: E(): 1.2e-27, 41.42% id in 210 aa"
FT                   /db_xref="GOA:Q6MXP6"
FT                   /db_xref="InterPro:IPR011055"
FT                   /db_xref="InterPro:IPR016047"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP6"
FT                   /protein_id="CAE51677.1"
FT   misc_feature    complement(138338..138586)
FT                   /note="Pfam match to entry PF01551 Peptidase_M37, Peptidase
FT                   family M23/M37 , score 88.4, E-value 9.3e-24"
FT   CDS             complement(139283..139732)
FT                   /transl_table=11
FT                   /gene="copE2"
FT                   /locus_tag="SMR0152"
FT                   /product="probable copper-binding protein"
FT                   /note="Similar to several; involved in resistance to
FT                   cations including: Escherichia coli probable copper-binding
FT                   protein PcoE precursor SWALL:PCOE_ECOLI (SWALL:Q47459) (144
FT                   aa) fasta scores: E(): 4.2e-11, 35.91% id in 142 aa, and to
FT                   Salmonella typhimurium silver-binding protein SilE
FT                   precursor SWALL:SILE_SALTY (SWALL:Q9Z4N3) (143 aa) fasta
FT                   scores: E(): 2.2e-09, 32.19% id in 146 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP5"
FT                   /protein_id="CAE51678.1"
FT   misc_feature    complement(139673..139732)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.985 between residues 20 and 21"
FT   CDS             139967..141784
FT                   /transl_table=11
FT                   /gene="copA"
FT                   /locus_tag="SMR0153"
FT                   /product="copper resistance protein oxidase"
FT                   /note="Similar to several proteins involved in copper
FT                   resistance: Escherichia coli copper resistance protein a
FT                   precursor PcoA SWALL:PCOA_ECOLI (SWALL:Q47452) (605 aa)
FT                   fasta scores: E(): 0, 99.66% id in 605 aa, and to
FT                   Pseudomonas syringae copper resistance protein A precursor
FT                   CopA SWALL:COPA_PSESM (SWALL:P12374) (609 aa) fasta scores:
FT                   E(): 9.3e-177, 75.57% id in 610 aa"
FT                   /db_xref="GOA:Q6MXP4"
FT                   /db_xref="InterPro:IPR001117"
FT                   /db_xref="InterPro:IPR002355"
FT                   /db_xref="InterPro:IPR006311"
FT                   /db_xref="InterPro:IPR006376"
FT                   /db_xref="InterPro:IPR008972"
FT                   /db_xref="InterPro:IPR011706"
FT                   /db_xref="InterPro:IPR011707"
FT                   /db_xref="InterPro:IPR019546"
FT                   /db_xref="InterPro:IPR033138"
FT                   /db_xref="InterPro:IPR034279"
FT                   /db_xref="InterPro:IPR034282"
FT                   /db_xref="InterPro:IPR034284"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP4"
FT                   /protein_id="CAE51679.1"
FT   misc_feature    139967..140086
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.998) with cleavage
FT                   site probability 0.597 between residues 40 and 41"
FT   misc_feature    140081..140455
FT                   /note="Pfam match to entry PF00394 Cu-oxidase, Multicopper
FT                   oxidase , score 19.8, E-value 9.2e-05"
FT   misc_feature    140462..141016
FT                   /note="Pfam match to entry PF00394 Cu-oxidase, Multicopper
FT                   oxidase , score 90.2, E-value 2.6e-24"
FT   misc_feature    140759..140788
FT                   /note="PS00215 Mitochondrial energy transfer proteins
FT                   signature."
FT   misc_feature    141707..141769
FT                   /note="PS00079 Multicopper oxidases signature 1."
FT   misc_feature    141722..141757
FT                   /note="PS00080 Multicopper oxidases signature 2."
FT   CDS             141784..142680
FT                   /transl_table=11
FT                   /gene="copB"
FT                   /locus_tag="SMR0154"
FT                   /product="exported copper resistance protein"
FT                   /note="Similar to several proteins involved in copper
FT                   resistance: Escherichia coli copper resistance protein B
FT                   precursor PcoB SWALL:PCOB_ECOLI (SWALL:Q47453) (296 aa)
FT                   fasta scores: E(): 7e-126, 100% id in 296 aa, and to
FT                   Pseudomonas syringae copper resistance protein B precursor
FT                   CopB SWALL:COPB_PSESM (SWALL:P12375) (328 aa) fasta scores:
FT                   E(): 5.7e-70, 60.22% id in 264 aa. Note the alternate
FT                   possible translational start site at codon 3."
FT                   /db_xref="GOA:Q6MXP3"
FT                   /db_xref="InterPro:IPR007939"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP3"
FT                   /protein_id="CAE51680.1"
FT                   GEKDHQVVFLAGARIWF"
FT   misc_feature    141784..141858
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.459 between residues 26 and 27"
FT   CDS             142720..143100
FT                   /transl_table=11
FT                   /gene="copC"
FT                   /locus_tag="SMR0155"
FT                   /product="exported copper resistance protein"
FT                   /note="Similar to several proteins involved in copper
FT                   resistance: Escherichia coli copper resistance protein C
FT                   precursor PcoC SWALL:PCOC_ECOLI (SWALL:Q47454) (126 aa)
FT                   fasta scores: E(): 5.4e-44, 100% id in 126 aa, and to
FT                   Ralstonia metallidurans CopC protein SWALL:Q9F3R9
FT                   (EMBL:AJ278983) (127 aa) fasta scores: E(): 1.2e-22, 64.03%
FT                   id in 114 aa"
FT                   /db_xref="GOA:Q6MXP2"
FT                   /db_xref="InterPro:IPR007348"
FT                   /db_xref="InterPro:IPR014755"
FT                   /db_xref="InterPro:IPR014756"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP2"
FT                   /protein_id="CAE51681.1"
FT   misc_feature    142720..142788
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.995 between residues 23 and 24"
FT   repeat_region   142956..142970
FT                   /note="hmmsearch hit to HMM parS major repeat (1 - 15),
FT                   score: 0.2, E-value: 0.47"
FT   CDS             143105..144034
FT                   /transl_table=11
FT                   /gene="copD"
FT                   /locus_tag="SMR0156"
FT                   /product="copper resistance protein"
FT                   /note="Highly similar to several proteins involved in
FT                   copper resistance: Escherichia coli copper resistance
FT                   protein D PcoD SWALL:PCOD_ECOLI (SWALL:Q47455) (309 aa)
FT                   fasta scores: E(): 1.9e-117, 100% id in 309 aa, and to
FT                   Pseudomonas syringae copper resistance protein D CopD
FT                   SWALL:COPD_PSESF (SWALL:Q9KWM8) (311 aa) fasta scores: E():
FT                   5.2e-43, 41.31% id in 305 aa"
FT                   /db_xref="GOA:Q6MXP1"
FT                   /db_xref="InterPro:IPR008457"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP1"
FT                   /protein_id="CAE51682.1"
FT   misc_feature    join(143114..143182,143243..143302,143381..143449,
FT                   143462..143530,143573..143641,143702..143770,
FT                   143813..143881,143948..144016)
FT                   /note="8 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-26, 47-66, 93-115, 120-142,
FT                   157-179, 200-222, 237-259 and 282-304"
FT   CDS             144089..144769
FT                   /transl_table=11
FT                   /gene="copR"
FT                   /locus_tag="SMR0157"
FT                   /product="probable two-component-system response regulator
FT                   involved in copper resistance"
FT                   /note="Similar to several proteins involved in copper
FT                   resistance: Escherichia coli transcriptional regulatory
FT                   protein PcoR SWALL:PCOR_ECOLI (SWALL:Q47456) (226 aa) fasta
FT                   scores: E(): 1.3e-87, 100% id in 226 aa, and to Pseudomonas
FT                   syringae transcriptional activator protein CopR
FT                   SWALL:COPR_PSESM (SWALL:Q02540) (227 aa) fasta scores: E():
FT                   5.6e-52, 61.33% id in 225 aa"
FT                   /db_xref="GOA:Q6MXP0"
FT                   /db_xref="InterPro:IPR001789"
FT                   /db_xref="InterPro:IPR001867"
FT                   /db_xref="InterPro:IPR006291"
FT                   /db_xref="InterPro:IPR011006"
FT                   /db_xref="InterPro:IPR011991"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXP0"
FT                   /protein_id="CAE51683.1"
FT                   IREE"
FT   misc_feature    144092..144451
FT                   /note="Pfam match to entry PF00072 response_reg, Response
FT                   regulator receiver domain , score 133.2, E-value 3e-37"
FT   misc_feature    144527..144742
FT                   /note="Pfam match to entry PF00486 trans_reg_C,
FT                   Transcriptional regulatory protein, C terminal , score
FT                   102.4, E-value 5.7e-28"
FT   CDS             144766..146166
FT                   /transl_table=11
FT                   /gene="copS"
FT                   /locus_tag="SMR0158"
FT                   /product="probable two component-system sensor kinase
FT                   involved in copper resistance"
FT                   /note="Similar to several proteins involved in copper
FT                   resistance: Escherichia coli probable sensor kinase
FT                   involved in copper resistance PcoS SWALL:PCOS_ECOLI
FT                   (SWALL:Q47457) (466 aa) fasta scores: E(): 1.3e-172, 99.35%
FT                   id in 466 aa, and to Escherichia coli sensor kinase CusS or
FT                   b0570 SWALL:CUSS_ECOLI (SWALL:P77485) (480 aa) fasta
FT                   scores: E(): 9.7e-37, 30.04% id in 476 aa"
FT                   /db_xref="GOA:Q6MXN9"
FT                   /db_xref="InterPro:IPR003594"
FT                   /db_xref="InterPro:IPR003660"
FT                   /db_xref="InterPro:IPR003661"
FT                   /db_xref="InterPro:IPR004358"
FT                   /db_xref="InterPro:IPR005467"
FT                   /db_xref="InterPro:IPR006290"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN9"
FT                   /protein_id="CAE51684.1"
FT                   FKVRLLMD"
FT   misc_feature    144766..144873
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.951) with cleavage
FT                   site probability 0.296 between residues 36 and 37"
FT   misc_feature    145276..145335
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34 and 171-190"
FT   misc_feature    145282..145494
FT                   /note="Pfam match to entry PF00672 HAMP, HAMP domain ,
FT                   score 46.6, E-value 3.6e-11"
FT   misc_feature    145504..145704
FT                   /note="Pfam match to entry PF00512 HisKA, His Kinase A
FT                   (phosphoacceptor) domain , score 63.1, E-value 4e-16"
FT   misc_feature    145831..146163
FT                   /note="Pfam match to entry PF02518 HATPase_c, Histidine
FT                   kinase-, DNA gyrase B-, and HSP90-like ATPase , score
FT                   107.0, E-value 2.3e-29"
FT   CDS             146384..146818
FT                   /transl_table=11
FT                   /gene="copE1"
FT                   /locus_tag="SMR0159"
FT                   /product="probable copper-binding protein"
FT                   /note="Similar to several proteins involved in copper
FT                   resistance: Escherichia coli probable copper-binding
FT                   protein PcoE precursor SWALL:PCOE_ECOLI (SWALL:Q47459) (144
FT                   aa) fasta scores: E(): 2.7e-44, 92.36% id in 144 aa, and to
FT                   Salmonella typhimurium silver-binding protein SilE
FT                   precursor SWALL:SILE_SALTY (SWALL:Q9Z4N3) (143 aa) fasta
FT                   scores: E(): 2e-17, 45.07% id in 142 aa. Note the product
FT                   of this CDS is also highly similar to the upstream CDS
FT                   SMRO152 35.294% identity (36.641% ungapped) in 136 aa
FT                   overlap."
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN8"
FT                   /protein_id="CAE51685.1"
FT   misc_feature    146384..146443
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.999 between residues 20 and 21"
FT   CDS             147196..148014
FT                   /transl_table=11
FT                   /locus_tag="SMR0160"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar in part to Salmonella typhi hypothetical
FT                   protein R0160 or Hcm1.181 SWALL:Q9L5I2 (EMBL:AF250878) (151
FT                   aa) fasta scores: E(): 9.5e-34, 60.92% id in 151 aa, and
FT                   over the entire range to Pseudomonas putida hypothetical
FT                   29.6 kDa protein SWALL:Q8VMN6 (EMBL:AJ344068) (259 aa)
FT                   fasta scores: E(): 2.5e-09, 23.16% id in 259 aa"
FT                   /db_xref="InterPro:IPR031339"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN7"
FT                   /protein_id="CAE51686.1"
FT   CDS             148011..149216
FT                   /transl_table=11
FT                   /locus_tag="SMR0161"
FT                   /product="ATP/GTP-binding protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   TlpA or Hcm1.183 SWALL:Q9L5I4 (EMBL:AF250878) (406 aa)
FT                   fasta scores: E(): 2.6e-40, 41.17% id in 408 aa. Note rich
FT                   in the amino acids serine and glutamic acid."
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN6"
FT                   /protein_id="CAE51687.1"
FT                   TS"
FT   misc_feature    149163..149186
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS             complement(149280..149483)
FT                   /transl_table=11
FT                   /locus_tag="SMR0162"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.184C SWALL:Q935K1 (EMBL:AL513383) (67 aa) fasta
FT                   scores: E(): 2.1e-12, 59.7% id in 67 aa, and to Pseudomonas
FT                   sp. SLT2001 hypothetical 8.7 kDa protein SWALL:Q8VLP0
FT                   (EMBL:AJ421512) (77 aa) fasta scores: E(): 0.027, 33.33% id
FT                   in 60 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN5"
FT                   /protein_id="CAE51688.1"
FT   CDS             complement(149496..150815)
FT                   /transl_table=11
FT                   /locus_tag="SMR0163"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.185C SWALL:Q935K0 (EMBL:AL513383) (431 aa) fasta
FT                   scores: E(): 6.1e-152, 81.43% id in 431 aa, and to
FT                   Pseudomonas putida hypothetical 47.2 kDa protein
FT                   SWALL:Q8VMP8 (EMBL:AJ344068) (424 aa) fasta scores: E():
FT                   1.3e-59, 36.63% id in 434 aa"
FT                   /db_xref="InterPro:IPR009553"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN4"
FT                   /protein_id="CAE51689.1"
FT   CDS             complement(150838..151005)
FT                   /transl_table=11
FT                   /locus_tag="SMR0164"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0155 SWALL:Q9L5I7 (EMBL:AF250878) (55 aa) fasta scores:
FT                   E(): 2.7e-12, 61.81% id in 55 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN3"
FT                   /protein_id="CAE51690.1"
FT                   AQEVLLWLGY"
FT   CDS             complement(151066..152493)
FT                   /transl_table=11
FT                   /gene="dcm"
FT                   /locus_tag="SMR0165"
FT                   /product="DNA-cytosine methyltransferase"
FT                   /note="Similar to Escherichia coli, and Escherichia coli
FT                   O157:H7 DNA-cytosine methyltransferase DCM or Mec or B1961
FT                   or Z3054 or Ecs2699 SWALL:DCM_ECOLI (SWALL:P11876) (472 aa)
FT                   fasta scores: E(): 7.4e-119, 64.84% id in 438 aa, and to
FT                   Salmonella typhi modification methylase Hcm1.187C
FT                   SWALL:Q935J8 (EMBL:AL513383) (475 aa) fasta scores: E():
FT                   5.9e-145, 72.39% id in 460 aa"
FT                   /db_xref="GOA:Q6MXN2"
FT                   /db_xref="InterPro:IPR001525"
FT                   /db_xref="InterPro:IPR018117"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="InterPro:IPR031303"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN2"
FT                   /protein_id="CAE51691.1"
FT                   IEFAASQRLRQFYDEVS"
FT   misc_feature    complement(151123..152220)
FT                   /note="Pfam match to entry PF00145 DNA_methylase, C-5
FT                   cytosine-specific DNA methylase , score 292.5, E-value
FT                   3.4e-85"
FT   misc_feature    complement(151129..151185)
FT                   /note="PS00095 C-5 cytosine-specific DNA methylases
FT                   C-terminal signature."
FT   misc_feature    complement(151936..151974)
FT                   /note="PS00094 C-5 cytosine-specific DNA methylases active
FT                   site."
FT   CDS             152708..153223
FT                   /transl_table=11
FT                   /locus_tag="SMR0166"
FT                   /product="putative exported nuclease"
FT                   /note="Similar to many including: Salmonella typhi putative
FT                   partition protein parB SWALL:Q9L5I9 (EMBL:AF250878) (171
FT                   aa) fasta scores: E(): 5.8e-51, 74.11% id in 170 aa, and to
FT                   Campylobacter jejuni putative secreted nuclease Cj0979C
FT                   SWALL:Q9PNW0 (EMBL:AL139076) (175 aa) fasta scores: E():
FT                   2.4e-20, 39.74% id in 156 aa"
FT                   /db_xref="InterPro:IPR016071"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN1"
FT                   /protein_id="CAE51692.1"
FT                   PRKVKEKK"
FT   misc_feature    152708..152773
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.996) with cleavage
FT                   site probability 0.979 between residues 23 and 24"
FT   misc_feature    152780..153151
FT                   /note="Pfam match to entry PF00565 SNase, Staphylococcal
FT                   nuclease homologue , score 131.7, E-value 9e-37"
FT   CDS             153226..154122
FT                   /transl_table=11
FT                   /locus_tag="SMR0167"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0152 SWALL:Q9L5J0 (EMBL:AF250878) (307 aa) fasta scores:
FT                   E(): 1.8e-62, 51.51% id in 297 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXN0"
FT                   /protein_id="CAE51693.1"
FT                   ACINGVRDFVRQNPWVV"
FT   CDS             complement(154148..154378)
FT                   /transl_table=11
FT                   /locus_tag="SMR0168"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXM9"
FT                   /protein_id="CAE51694.1"
FT   CDS             154874..155107
FT                   /transl_table=11
FT                   /locus_tag="SMR0170"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.191 SWALL:Q935J4 (EMBL:AL513383) (95 aa) fasta scores:
FT                   E(): 5.1e-13, 50.72% id in 69 aa. Note the Salmonella
FT                   protein possesses a significant N-terminal extension."
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXM8"
FT                   /protein_id="CAE51695.1"
FT   CDS             155445..155732
FT                   /transl_table=11
FT                   /locus_tag="SMR0171"
FT                   /product="putative inner membrane protein"
FT                   /note="Similar to Salmonella typhi putative membrane
FT                   protein Hcm1.192 SWALL:Q935J3 (EMBL:AL513383) (99 aa) fasta
FT                   scores: E(): 1.9e-07, 33% id in 100 aa"
FT                   /db_xref="GOA:Q6MXM7"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXM7"
FT                   /protein_id="CAE51696.1"
FT   misc_feature    join(155466..155534,155658..155726)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 26-48 and 90-112"
FT   CDS             155769..155999
FT                   /transl_table=11
FT                   /locus_tag="SMR0172"
FT                   /product="putative inner membrane protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXM6"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXM6"
FT                   /protein_id="CAE51697.1"
FT   misc_feature    155862..155930
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 32-54"
FT   CDS             156140..156415
FT                   /transl_table=11
FT                   /locus_tag="SMR0173"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXM5"
FT                   /protein_id="CAE51698.1"
FT   CDS             156907..158385
FT                   /transl_table=11
FT                   /gene="sfpA"
FT                   /locus_tag="SMR0174"
FT                   /product="sulfate permease protein"
FT                   /note="Similar to many proposed sulfate permeases
FT                   including: Serratia marcescens putative sulfate permease
FT                   protein SfpA SWALL:Q9L333 (EMBL:AJ288984) (492 aa) fasta
FT                   scores: E(): 1.5e-184, 100% id in 492 aa, and to Yersinia
FT                   enterocolitica sulfate permease SWALL:O07488 (EMBL:Y13308)
FT                   (492 aa) fasta scores: E(): 3e-184, 99.79% id in 492 aa"
FT                   /db_xref="GOA:Q9L333"
FT                   /db_xref="InterPro:IPR002645"
FT                   /db_xref="InterPro:IPR011547"
FT                   /db_xref="UniProtKB/TrEMBL:Q9L333"
FT                   /protein_id="CAE51699.1"
FT   misc_feature    join(156958..157026,157039..157107,157165..157233,
FT                   157252..157320,157333..157389,157408..157467,
FT                   157537..157605,157687..157755,157783..157845,
FT                   157864..157923,157981..158049)
FT                   /note="11 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 18-40, 45-67, 87-109,
FT                   116-138, 143-161, 168-187, 211-233, 261-283, 293-313,
FT                   320-339 and 359-381"
FT   misc_feature    157216..158058
FT                   /note="Pfam match to entry PF00916 Sulfate_transp, Sulfate
FT                   transporter family , score 396.1, E-value 2.2e-116"
FT   misc_feature    158077..158370
FT                   /note="Pfam match to entry PF01740 STAS, STAS domain ,
FT                   score 50.6, E-value 2.3e-12"
FT   CDS             158404..159231
FT                   /transl_table=11
FT                   /gene="sfpB"
FT                   /locus_tag="SMR0175"
FT                   /product="conserved hypothetical protein"
FT                   /note="Identical to Serratia marcescens hypothetical 30.4
FT                   kDa protein SfpB SWALL:Q9L332 (EMBL:AJ288984) (275 aa)
FT                   fasta scores: E(): 1.2e-101, 100% id in 275 aa and to
FT                   Yersinia enterocolitica hypothetical 31.7 kDa protein
FT                   SWALL:O07487 (EMBL:Y13308) (288 aa) fasta scores: E():
FT                   4.3e-99, 97.09% id in 275 aa. Also similar to several
FT                   universal stress proteins e.g. Methanosarcina acetivorans
FT                   Ma0162 SWALL:AAM03615 (EMBL:AE010673) (150 aa) fasta
FT                   scores: E(): 0.019, 25.97% id in 77 aa"
FT                   /db_xref="GOA:Q9L332"
FT                   /db_xref="InterPro:IPR006015"
FT                   /db_xref="InterPro:IPR006016"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="UniProtKB/TrEMBL:Q9L332"
FT                   /protein_id="CAE51700.1"
FT   CDS             complement(159291..159716)
FT                   /transl_table=11
FT                   /gene="arsC"
FT                   /locus_tag="SMR0176"
FT                   /product="arsenate reductase"
FT                   /note="Similar to many proteins involved in resistance to
FT                   arsenic including: Escherichia coli arsenate reductase ArsC
FT                   SWALL:ARC1_ECOLI (SWALL:P08692) (141 aa) fasta scores: E():
FT                   5.5e-48, 90% id in 140 aa, and to Serratia marcescens ArsC
FT                   arsenate reductase arsC SWALL:Q9L337 (EMBL:AJ288983) (141
FT                   aa) fasta scores: E(): 1.9e-53, 100% id in 141 aa"
FT                   /db_xref="GOA:Q9L337"
FT                   /db_xref="InterPro:IPR006659"
FT                   /db_xref="InterPro:IPR006660"
FT                   /db_xref="InterPro:IPR012336"
FT                   /db_xref="UniProtKB/TrEMBL:Q9L337"
FT                   /protein_id="CAE51701.1"
FT   misc_feature    complement(159378..159662)
FT                   /note="Pfam match to entry PF03960 ArsC, ArsC family ,
FT                   score 127.1, E-value 2.1e-35"
FT   CDS             complement(159729..161018)
FT                   /transl_table=11
FT                   /gene="arsB"
FT                   /locus_tag="SMR0177"
FT                   /product="arsenical pump membrane protein"
FT                   /note="Similar to many proteins involved in resistance to
FT                   arsenic including: Escherichia coli, and Escherichia coli
FT                   O157:H7 arsenical pump membrane protein ArsB or ArsF or
FT                   B3502 or Z4904 or Ecs4374 SWALL:ARSB_ECOLI (SWALL:P37310)
FT                   (429 aa) fasta scores: E(): 9.4e-140, 86.48% id in 429 aa.
FT                   Identical to Serratia marcescens ArsB transmembrane efflux
FT                   channel SWALL:Q9L336 (EMBL:AJ288983) (429 aa) fasta scores:
FT                   E(): 1.3e-156, 99.76% id in 429 aa"
FT                   /db_xref="GOA:Q6MXM1"
FT                   /db_xref="InterPro:IPR000802"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXM1"
FT                   /protein_id="CAE51702.1"
FT   misc_feature    complement(159744..161012)
FT                   /note="Pfam match to entry PF02040 ArsB, Arsenical pump
FT                   membrane protein , score 1064.6, E-value 0"
FT   misc_feature    complement(join(159750..159815,160014..160073,
FT                   160131..160199,160233..160286,160296..160349,
FT                   160428..160496,160539..160607,160626..160679,
FT                   160689..160748,160809..160875,160887..160955,
FT                   160968..161018))
FT                   /note="12 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-21, 26-48, 52-74, 95-114,
FT                   118-135, 142-164, 179-201, 228-245, 249-266, 278-300,
FT                   320-339 and 405-427"
FT   CDS             complement(161064..161384)
FT                   /transl_table=11
FT                   /gene="arsR"
FT                   /locus_tag="SMR0178"
FT                   /product="arsenical resistance operon repressor"
FT                   /note="Similar to many proteins involved in resistance to
FT                   arsenic including: Escherichia coli arsenical resistance
FT                   operon repressor ArsR or b3501 SWALL:ARSR_ECOLI
FT                   (SWALL:P37309) (117 aa) fasta scores: E(): 1.6e-28, 63.81%
FT                   id in 105 aa. Identical to Serratia marcescens ArsR
FT                   regulatory protein arsR SWALL:Q9L335 (EMBL:AJ288983) (106
FT                   aa) fasta scores: E(): 1e-43, 99.05% id in 106 aa"
FT                   /db_xref="GOA:Q6MXM0"
FT                   /db_xref="InterPro:IPR001845"
FT                   /db_xref="InterPro:IPR011991"
FT                   /db_xref="InterPro:IPR018334"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXM0"
FT                   /protein_id="CAE51703.1"
FT                   SC"
FT   misc_feature    complement(161127..161363)
FT                   /note="Pfam match to entry PF01022 HTH_5, Bacterial
FT                   regulatory protein, arsR family , score 108.7, E-value
FT                   7.5e-30"
FT   misc_feature    complement(161241..161297)
FT                   /note="PS00846 Bacterial regulatory proteins, arsR family
FT                   signature."
FT   CDS             161471..162175
FT                   /transl_table=11
FT                   /gene="arsH"
FT                   /locus_tag="SMR0179"
FT                   /product="putative reductase"
FT                   /note="Similar to Yersinia enterocolitica ArsH SWALL:P74987
FT                   (EMBL:U58366) (232 aa) fasta scores: E(): 2e-77, 83.76% id
FT                   in 234 aa, and to Pseudomonas putida ArsH protein
FT                   SWALL:Q9EUU2 (EMBL:AJ271973) (228 aa) fasta scores: E():
FT                   5.8e-56, 64.53% id in 234 aa"
FT                   /db_xref="GOA:Q6MXL9"
FT                   /db_xref="InterPro:IPR005025"
FT                   /db_xref="InterPro:IPR014063"
FT                   /db_xref="InterPro:IPR029039"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL9"
FT                   /protein_id="CAE51704.1"
FT                   QELAARVNQAKI"
FT   misc_feature    161552..162079
FT                   /note="Pfam match to entry PF03358 FMN_red, NADPH-dependent
FT                   FMN reductase , score 216.3, E-value 2.9e-62"
FT   CDS             complement(162208..163611)
FT                   /transl_table=11
FT                   /locus_tag="SMR0180"
FT                   /product="putative transposase"
FT                   /note="Similar to Salmonella typhi putative transposase
FT                   R0148 SWALL:Q9L5J4 (EMBL:AF250878) (468 aa) fasta scores:
FT                   E(): 1.2e-177, 96.12% id in 465 aa and to Ralstonia
FT                   solanacearum probable transposase protein Rsc1843 or
FT                   Rs05589 SWALL:Q8XYB5 (EMBL:AL646067) (491 aa) fasta scores:
FT                   E(): 3.5e-99, 58.07% id in 446 aa"
FT                   /db_xref="GOA:Q6MXL8"
FT                   /db_xref="InterPro:IPR001584"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL8"
FT                   /protein_id="CAE51705.1"
FT                   EEIFGKKPI"
FT   misc_feature    complement(162697..163197)
FT                   /note="Pfam match to entry PF00665 rve, Integrase core
FT                   domain , score 65.2, E-value 9.3e-17"
FT   misc_feature    complement(163465..163530)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1639.000, SD 4.77 at aa 39-60, sequence
FT   CDS             163803..164120
FT                   /transl_table=11
FT                   /locus_tag="SMR0181"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL7"
FT                   /protein_id="CAE51706.1"
FT                   K"
FT   CDS             164143..164448
FT                   /transl_table=11
FT                   /locus_tag="SMR0182"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL6"
FT                   /protein_id="CAE51707.1"
FT   CDS             164493..165164
FT                   /transl_table=11
FT                   /locus_tag="SMR0183"
FT                   /product="putative lipoprotein"
FT                   /note="Weakly similar to Mycobacterium leprae HtrA or
FT                   Ml1078 SWALL:Q49972 (EMBL:U15180) (533 aa) fasta scores:
FT                   E(): 0.029, 27.5% id in 160 aa and to Mycobacterium
FT                   tuberculosis HtrA or Rv1223 or Mtci61.06 SWALL:O06291
FT                   (EMBL:Z98260) (549 aa) fasta scores: E(): 0.082, 26.13% id
FT                   in 176 aa"
FT                   /db_xref="GOA:Q6MXL5"
FT                   /db_xref="InterPro:IPR001254"
FT                   /db_xref="InterPro:IPR009003"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL5"
FT                   /protein_id="CAE51708.1"
FT                   N"
FT   misc_feature    164493..164546
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.986) with cleavage
FT                   site probability 0.496 between residues 18 and 19"
FT   misc_feature    164508..164540
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   misc_feature    164616..165146
FT                   /note="Pfam match to entry PF00089 trypsin, Trypsin , score
FT                   -10.8, E-value 5.4e-05"
FT   CDS             165165..165422
FT                   /transl_table=11
FT                   /locus_tag="SMR0184"
FT                   /product="membrane protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXL4"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL4"
FT                   /protein_id="CAE51709.1"
FT   misc_feature    join(165243..165311,165339..165407)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 27-49 and 59-81"
FT   CDS             165622..166029
FT                   /transl_table=11
FT                   /locus_tag="SMR0185"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0143 or Hcm1.197C SWALL:Q9L5J9 (EMBL:AF250878) (141 aa)
FT                   fasta scores: E(): 2.2e-28, 55.11% id in 127 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL3"
FT                   /protein_id="CAE51710.1"
FT   CDS             complement(166080..166607)
FT                   /transl_table=11
FT                   /locus_tag="SMR0186"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL2"
FT                   /protein_id="CAE51711.1"
FT                   NVDRQRHPEWFR"
FT   CDS             complement(166774..167154)
FT                   /transl_table=11
FT                   /locus_tag="SMR0187"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXL1"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL1"
FT                   /protein_id="CAE51712.1"
FT   misc_feature    complement(join(166993..167040,167068..167136))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29 and 39-54"
FT   CDS             complement(167227..170562)
FT                   /transl_table=11
FT                   /locus_tag="SMR0188"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.195 SWALL:Q935J1 (EMBL:AL513383) (1111 aa) fasta
FT                   scores: E(): 3.5e-203, 46.54% id in 1115 aa, and to
FT                   Salmonella typhi hypothetical protein R0140 SWALL:Q9L5K2
FT                   (EMBL:AF250878) (948 aa) fasta scores: E(): 4e-168, 45.43%
FT                   id in 942 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXL0"
FT                   /protein_id="CAE51713.1"
FT                   LRSW"
FT   CDS             complement(170785..171138)
FT                   /transl_table=11
FT                   /locus_tag="SMR0189"
FT                   /product="putative exported protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0139 SWALL:Q9L5K3 (EMBL:AF250878) (117 aa) fasta scores:
FT                   E(): 9.4e-07, 30.08% id in 113 aa and to Salmonella typhi
FT                   putative periplasmic protein Hcm1.250C SWALL:Q935H7
FT                   (EMBL:AL513383) (116 aa) fasta scores: E(): 0.00049, 28.43%
FT                   id in 102 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK9"
FT                   /protein_id="CAE51714.1"
FT                   RNKYWEMYPSEDK"
FT   misc_feature    complement(171079..171138)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.904 between residues 20 and 21"
FT   CDS             complement(171292..171900)
FT                   /transl_table=11
FT                   /locus_tag="SMR0190"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.251C SWALL:Q935H6 (EMBL:AL513383) (204 aa) fasta
FT                   scores: E(): 6.2e-37, 50.49% id in 202 aa, and in part to
FT                   Salmonella typhi hypothetical protein R0138 SWALL:Q9L5K4
FT                   (EMBL:AF250878) (132 aa) fasta scores: E(): 2e-22, 52.3% id
FT                   in 130 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK8"
FT                   /protein_id="CAE51715.1"
FT   CDS             complement(172114..173601)
FT                   /transl_table=11
FT                   /gene="retA"
FT                   /locus_tag="SMR0191"
FT                   /product="putative reverse transcriptase/maturase"
FT                   /note="Identical to Serratia marcescens reverse
FT                   transcriptase RetA SWALL:O52209 (EMBL:AF027768) (495 aa)
FT                   fasta scores: E(): 1.2e-206, 100% id in 495 aa. Also highly
FT                   similar to many others e.g. Bradyrhizobium japonicum Id459
FT                   id459 SWALL:Q9AN84 (EMBL:AF322013) (491 aa) fasta scores:
FT                   E(): 6.4e-121, 59.06% id in 491 aa, and to an uncultured
FT                   marine bacterium maturase SWALL:AAL78688 (EMBL:AY075117)
FT                   (386 aa) fasta scores: E(): 2.1e-30, 31.65% id in 398 aa"
FT                   /db_xref="GOA:Q6MXK7"
FT                   /db_xref="InterPro:IPR000477"
FT                   /db_xref="InterPro:IPR030931"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK7"
FT                   /protein_id="CAE51716.1"
FT   misc_feature    complement(172504..173226)
FT                   /note="Pfam match to entry PF00078 rvt, Reverse
FT                   transcriptase (RNA-dependent DNA polymerase) , score 217.1,
FT                   E-value 1.7e-62"
FT   CDS             174003..174437
FT                   /transl_table=11
FT                   /gene="mucA"
FT                   /locus_tag="SMR0192"
FT                   /product="putative UV protection and repair protein"
FT                   /note="Similar to Salmonella typhimurium protein UV
FT                   protection and repair protein UmuD or Stm1998
FT                   SWALL:UMUD_SALTY (SWALL:P22493) (139 aa) fasta scores: E():
FT                   1.4e-19, 50.8% id in 124 aa, and to Salmonella typhi
FT                   putative DNA-repair modulator MucA SWALL:Q935H5
FT                   (EMBL:AL513383) (144 aa) fasta scores: E(): 3.4e-48, 81.25%
FT                   id in 144 aa, and to Serratia marcescens MucA SWALL:O52210
FT                   (EMBL:AF027768) (144 aa) fasta scores: E(): 9.6e-24, 56.3%
FT                   id in 119 aa"
FT                   /db_xref="GOA:Q6MXK6"
FT                   /db_xref="InterPro:IPR006197"
FT                   /db_xref="InterPro:IPR015927"
FT                   /db_xref="InterPro:IPR019759"
FT                   /db_xref="InterPro:IPR028360"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK6"
FT                   /protein_id="CAE51717.1"
FT   misc_feature    174045..174374
FT                   /note="Pfam match to entry PF00717 Peptidase_S24, Peptidase
FT                   family S24 , score 135.8, E-value 5.2e-38"
FT   CDS             174427..175680
FT                   /transl_table=11
FT                   /gene="mucB"
FT                   /locus_tag="SMR0193"
FT                   /product="putative UV protection and repair protein"
FT                   /note="Similar to Escherichia coli UV protection and repair
FT                   protein MucB protein SWALL:MUCB_ECOLI (SWALL:P07375) (420
FT                   aa) fasta scores: E(): 5.9e-73, 46.81% id in 408 aa and to
FT                   Salmonella typhi putative DNA-repair modulator MucB
FT                   SWALL:Q935H4 (EMBL:AL513383) (419 aa) fasta scores: E():
FT                   2.8e-142, 83.69% id in 417 aa"
FT                   /db_xref="GOA:Q6MXK5"
FT                   /db_xref="InterPro:IPR001126"
FT                   /db_xref="InterPro:IPR017961"
FT                   /db_xref="InterPro:IPR025188"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK5"
FT                   /protein_id="CAE51718.1"
FT                   MLSPRYTTRWDELLVVKA"
FT   misc_feature    174433..175470
FT                   /note="Pfam match to entry PF00817 IMS, impB/mucB/samB
FT                   family , score 334.1, E-value 1e-97"
FT   CDS             complement(175726..176535)
FT                   /transl_table=11
FT                   /locus_tag="SMR0194"
FT                   /product="putative exported protein"
FT                   /note="Similar to many proteins of unconfirmed function
FT                   including: Salmonella typhi putative outer membrane protein
FT                   R0135 or Hcm1.254C SWALL:Q9L5K7 (EMBL:AF250878) (269 aa)
FT                   fasta scores: E(): 1.6e-80, 75.74% id in 268 aa and to
FT                   Coxiella burnetii 27kda outer membrane protein Com1
FT                   SWALL:O07647 (EMBL:AB004701) (252 aa) fasta scores: E():
FT                   4.7e-10, 29.88% id in 261 aa"
FT                   /db_xref="GOA:Q6MXK4"
FT                   /db_xref="InterPro:IPR001853"
FT                   /db_xref="InterPro:IPR012336"
FT                   /db_xref="InterPro:IPR013766"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK4"
FT                   /protein_id="CAE51719.1"
FT   misc_feature    complement(176461..176535)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.999) with cleavage
FT                   site probability 0.836 between residues 25 and 26"
FT   CDS             176642..177253
FT                   /transl_table=11
FT                   /locus_tag="SMR0195"
FT                   /product="lipoprotein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0134 or Hcm1.255 SWALL:Q9L5K8 (EMBL:AF250878) (203 aa)
FT                   fasta scores: E(): 6.1e-58, 69.45% id in 203 aa. Also
FT                   similar in parts to Yersinia pestis
FT                   ribonucleoside-diphosphate reductase 2 alpha chain NrdE or
FT                   Ypo2649 SWALL:Q8ZDC7 (EMBL:AJ414153) (693 aa) fasta scores:
FT                   E(): 8.4, 24.4% id in 168 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK3"
FT                   /protein_id="CAE51720.1"
FT   misc_feature    176642..176722
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.921) with cleavage
FT                   site probability 0.573 between residues 27 and 28"
FT   misc_feature    176660..176692
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS             complement(177313..177735)
FT                   /transl_table=11
FT                   /locus_tag="SMR0196"
FT                   /product="putative exported protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0133 or Hcm1.256C SWALL:Q9L5K9 (EMBL:AF250878) (140 aa)
FT                   fasta scores: E(): 4.9e-23, 46.42% id in 140 aa"
FT                   /db_xref="GOA:Q6MXK2"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK2"
FT                   /protein_id="CAE51721.1"
FT   misc_feature    complement(join(177481..177549,177562..177630))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 36-58 and 63-85"
FT   misc_feature    complement(177571..177735)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.609) with cleavage
FT                   site probability 0.399 between residues 55 and 56"
FT   CDS             complement(177769..178161)
FT                   /transl_table=11
FT                   /locus_tag="SMR0197"
FT                   /product="putative exported protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0132 SWALL:Q9L5L0 (EMBL:AF250878) (130 aa) fasta scores:
FT                   E(): 2.2e-25, 58.46% id in 130 aa, and to Salmonella typhi
FT                   putative periplasmic protein Hcm1.257C SWALL:Q935H3
FT                   (EMBL:AL513383) (130 aa) fasta scores: E(): 3.5e-25, 58.46%
FT                   id in 130 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK1"
FT                   /protein_id="CAE51722.1"
FT   misc_feature    complement(178099..178161)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.998 between residues 21 and 22"
FT   CDS             complement(178186..178935)
FT                   /transl_table=11
FT                   /gene="dsbC"
FT                   /locus_tag="SMR0198"
FT                   /product="thiol:disulfide interchange protein"
FT                   /note="Similar to many proteins involved in disulphide-bond
FT                   formation including: Erwinia chrysanthemi thiol:disulfide
FT                   interchange protein DsbC precursor SWALL:DSBC_ERWCH
FT                   (SWALL:P39691) (238 aa) fasta scores: E(): 1.9e-25, 35.77%
FT                   id in 246 aa, Salmonella typhi thiol:disulphide interchange
FT                   protein DsbC or Hcm1.258C SWALL:Q9L5L1 (EMBL:AF250878) (249
FT                   aa) fasta scores: E(): 2.5e-82, 84.33% id in 249 aa, and to
FT                   Escherichia coli, and Escherichia coli O157:H7
FT                   thiol:disulfide interchange protein DsbC precursor or XprA
FT                   or B2893 or Z4231 or Ecs3765 SWALL:DSBC_ECOLI
FT                   (SWALL:P21892) (236 aa) fasta scores: E(): 9.1e-23, 33.33%
FT                   id in 246 aa"
FT                   /db_xref="InterPro:IPR009094"
FT                   /db_xref="InterPro:IPR012336"
FT                   /db_xref="InterPro:IPR018950"
FT                   /db_xref="InterPro:IPR033954"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXK0"
FT                   /protein_id="CAE51723.1"
FT   misc_feature    complement(178519..178575)
FT                   /note="PS00194 Thioredoxin family active site."
FT   misc_feature    complement(178873..178935)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.922 between residues 21 and 22"
FT   CDS             179083..179622
FT                   /transl_table=11
FT                   /locus_tag="SMR0199"
FT                   /product="putative pilin biogenesis protein"
FT                   /note="Similar to Salmonella typhi putative bfph/trbn-like
FT                   protein BfpH or Hcm1.259 SWALL:Q9L5L2 (EMBL:AF250878) (171
FT                   aa) fasta scores: E(): 4.3e-67, 89.47% id in 171 aa, and to
FT                   Escherichia coli bundle-forming pilus biogenesis protein
FT                   BfpH SWALL:Q47073 (EMBL:Z68186) (148 aa) fasta scores: E():
FT                   7.5e-11, 35.55% id in 135 aa, and to Salmonella typhi
FT                   invasion protein IagB or Sty3000 SWALL:IAGB_SALTI
FT                   (SWALL:P43018) (160 aa) fasta scores: E(): 0.00012, 29% id
FT                   in 131 aa"
FT                   /db_xref="InterPro:IPR008258"
FT                   /db_xref="InterPro:IPR023346"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ9"
FT                   /protein_id="CAE51724.1"
FT                   HIAKNVPEQNPTPVVK"
FT   misc_feature    179143..179508
FT                   /note="Pfam match to entry PF01464 SLT, Transglycosylase
FT                   SLT domain , score 20.3, E-value 0.00012"
FT   CDS             179705..180262
FT                   /transl_table=11
FT                   /locus_tag="SMR0200"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar in the C_terminus to Salmonella typhi
FT                   hypothetical protein R0129 SWALL:Q9L5L3 (EMBL:AF250878)
FT                   (203 aa) fasta scores: E(): 2.1e-33, 68.33% id in 120 aa
FT                   and to Salmonella typhi hypothetical protein Hcm1.261
FT                   SWALL:Q935H2 (EMBL:AL513383) (187 aa) fasta scores: E():
FT                   1.6e-23, 70.93% id in 86 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ8"
FT                   /protein_id="CAE51725.1"
FT   CDS             180386..181447
FT                   /transl_table=11
FT                   /locus_tag="SMR0201"
FT                   /product="hypothetical protein"
FT                   /note="Similar in the C-terminus to Yersinia pestis
FT                   hypothetical protein Ypo1258 SWALL:Q8ZGM9 (EMBL:AJ414147)
FT                   (382 aa) fasta scores: E(): 2.1e-36, 47.69% id in 239 aa,
FT                   and to Escherichia coli hypothetical protein YhhY or B3442
FT                   SWALL:YHHZ_ECOLI (SWALL:P46855) (392 aa) fasta scores: E():
FT                   7.8e-36, 46.58% id in 234 aa."
FT                   /db_xref="GOA:Q6MXJ7"
FT                   /db_xref="InterPro:IPR002711"
FT                   /db_xref="InterPro:IPR016583"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ7"
FT                   /protein_id="CAE51726.1"
FT                   WPSPNGVIYPVGK"
FT   misc_feature    181199..181357
FT                   /note="Pfam match to entry PF01844 HNH, HNH endonuclease ,
FT                   score 28.6, E-value 9.5e-06"
FT   CDS             181457..181963
FT                   /transl_table=11
FT                   /locus_tag="SMR0202"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to several proteins of undefined function
FT                   including: Escherichia coli hypothetical protein YrhA or
FT                   b3443 SWALL:YRHA_ECOLI (SWALL:P46856) (138 aa) fasta
FT                   scores: E(): 2.9e-05, 26.47% id in 136 aa, and to Yersinia
FT                   pestis hypothetical protein Ypo0640 SWALL:Q8ZI75
FT                   (EMBL:AJ414143) (156 aa) fasta scores: E(): 0.08, 22.48% id
FT                   in 169 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ6"
FT                   /protein_id="CAE51727.1"
FT                   IQTVS"
FT   CDS             complement(182086..186036)
FT                   /transl_table=11
FT                   /gene="trhG"
FT                   /locus_tag="SMR0203"
FT                   /product="putative inner membrane protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0128 SWALL:Q9L5L4 (EMBL:AF250878) (1329 aa) fasta scores:
FT                   E(): 1e-189, 76.37% id in 1329 aa and to Salmonella typhi
FT                   putative membrane protein Hcm1.262 SWALL:Q935H1
FT                   (EMBL:AL513383) (1329 aa) fasta scores: E(): 1.1e-189,
FT                   76.37% id in 1329 aa"
FT                   /db_xref="GOA:Q6MXJ5"
FT                   /db_xref="InterPro:IPR012931"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ5"
FT                   /protein_id="CAE51728.1"
FT   misc_feature    complement(join(184609..184677,184774..184839,
FT                   184867..184935,185683..185751,185794..185847,
FT                   185866..185934,185944..186000))
FT                   /note="7 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-31, 35-57, 64-81, 96-118,
FT                   368-390, 400-421 and 454-476"
FT   CDS             complement(186045..187460)
FT                   /transl_table=11
FT                   /gene="trhH"
FT                   /locus_tag="SMR0204"
FT                   /product="putative pilus assembly protein"
FT                   /note="Similar to Escherichia coli TraH protein
FT                   SWALL:TRH1_ECOLI (SWALL:P15069) (458 aa) fasta scores: E():
FT                   7.4e-09, 25.6% id in 453 aa, and to Salmonella typhi
FT                   putative F pilus assembly protein TrhH or Hcm1.263C
FT                   SWALL:Q9L5L5 (EMBL:AF250878) (471 aa) fasta scores: E():
FT                   1.3e-152, 86.62% id in 471 aa"
FT                   /db_xref="InterPro:IPR010927"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ4"
FT                   /protein_id="CAE51729.1"
FT                   RKAFTESIRGTRN"
FT   misc_feature    complement(187374..187460)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.995 between residues 29 and 30"
FT   CDS             complement(187450..188496)
FT                   /transl_table=11
FT                   /gene="trhF"
FT                   /locus_tag="SMR0205"
FT                   /product="putative exported protein"
FT                   /note="Similar to Salmonella typhi putative pilus assembly
FT                   and synthesis protein R0126 or Hcm1.264C SWALL:Q9L5L6
FT                   (EMBL:AF250878) (348 aa) fasta scores: E(): 1.7e-113,
FT                   84.19% id in 348 aa, and to Escherichia coli hypothetical
FT                   protein within a pilus assembly and synthesis operon, TrbB
FT                   protein SWALL:Q9WTB7 (EMBL:AP000342) (181 aa) fasta scores:
FT                   E(): 2.5, 19.76% id in 167 aa"
FT                   /db_xref="InterPro:IPR012336"
FT                   /db_xref="InterPro:IPR014111"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ3"
FT                   /protein_id="CAE51730.1"
FT                   SFGGTYAQ"
FT   misc_feature    complement(188425..188496)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.999) with cleavage
FT                   site probability 0.997 between residues 24 and 25"
FT   misc_feature    complement(188981..189001)
FT                   /note="attagttacaacttaaatatc"
FT   CDS             complement(189088..189600)
FT                   /transl_table=11
FT                   /gene="trhY"
FT                   /locus_tag="SMR0206"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0124 or Hcm1.266C SWALL:Q9L5L8 (EMBL:AF250878) (170 aa)
FT                   fasta scores: E(): 3e-57, 85.88% id in 170 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ2"
FT                   /protein_id="CAE51731.1"
FT                   YSQEELD"
FT   CDS             complement(189602..190402)
FT                   /transl_table=11
FT                   /gene="trhR"
FT                   /locus_tag="SMR0207"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0123 or Hcm1.268C SWALL:Q9L5L9 (EMBL:AF250878) (266 aa)
FT                   fasta scores: E(): 8.3e-85, 77.81% id in 266 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ1"
FT                   /protein_id="CAE51732.1"
FT   repeat_region   190751..190765
FT                   /note="hmmsearch hit to HMM oriT repeat(1 - 15), score:
FT                   7.2, E-value: 0.0068"
FT   repeat_region   complement(190775..190789)
FT                   /note="hmmsearch hit to HMM oriT repeat (1 - 15), score:
FT                   5.5, E-value: 0.021"
FT   repeat_region   190795..190809
FT                   /note="hmmsearch hit to HMM oriT repeat (1 - 15), score:
FT                   7.2, E-value: 0.0068"
FT   repeat_region   complement(190819..190833)
FT                   /note="hmmsearch hit to HMM oriT repeat (1 - 15), score:
FT                   7.2, E-value: 0.0068"
FT   repeat_region   190837..190851
FT                   /note="hmmsearch hit to HMM oriT repeat (1 - 15), score:
FT                   6.5, E-value: 0.011"
FT   repeat_region   complement(190862..190876)
FT                   /note="hmmsearch hit to HMM oriT repeat (1 - 15), score:
FT                   5.5, E-value: 0.021"
FT   repeat_region   190882..190896
FT                   /note="hmmsearch hit to HMM oriT repeat(1 - 15), score:
FT                   2.7, E-value: 0.13"
FT   CDS             190950..191111
FT                   /transl_table=11
FT                   /locus_tag="SMR0208"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXJ0"
FT                   /protein_id="CAE51733.1"
FT                   EHSKIFCS"
FT   CDS             191162..191647
FT                   /transl_table=11
FT                   /gene="traH"
FT                   /locus_tag="SMR0209"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0122 or Hcm1.269 SWALL:Q9L5M0 (EMBL:AF250878) (161 aa)
FT                   fasta scores: E(): 8.5e-49, 76.39% id in 161 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI9"
FT                   /protein_id="CAE51734.1"
FT   CDS             191644..192381
FT                   /transl_table=11
FT                   /locus_tag="SMR0210"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0121 or Hcm1.270 SWALL:Q9L5M1 (EMBL:AF250878) (240 aa)
FT                   fasta scores: E(): 5.9e-57, 68.16% id in 245 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI8"
FT                   /protein_id="CAE51735.1"
FT   CDS             192385..195537
FT                   /transl_table=11
FT                   /gene="traI"
FT                   /locus_tag="SMR0211"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to many proteins of undefined function
FT                   including: Salmonella typhi hypothetical protein traI
FT                   SWALL:Q9L5M2 (EMBL:AF250878) (1011 aa) fasta scores: E():
FT                   1.8e-203, 64.4% id in 1059 aa. Also similar in part to
FT                   Providencia rettgeri TraI SWALL:AAM08003 (EMBL:AY090559)
FT                   (716 aa) fasta scores: E(): 1.2e-12, 31.96% id in 244 aa"
FT                   /db_xref="InterPro:IPR011119"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI7"
FT                   /protein_id="CAE51736.1"
FT                   NL"
FT   CDS             195537..197621
FT                   /transl_table=11
FT                   /gene="traG"
FT                   /locus_tag="SMR0212"
FT                   /product="membrane protein"
FT                   /note="Similar to many proteins of undefined function
FT                   including: Salmonella typhi putative membrane protein
FT                   Hcm1.272 SWALL:Q935G9 (EMBL:AL513383) (694 aa) fasta
FT                   scores: E(): 0, 83.14% id in 694 aa. Also similar in part
FT                   to Providencia rettgeri TraD SWALL:AAM08004 (EMBL:AY090559)
FT                   (606 aa) fasta scores: E(): 2e-25, 31.4% id in 535 aa"
FT                   /db_xref="GOA:Q6MXI6"
FT                   /db_xref="InterPro:IPR019476"
FT                   /db_xref="InterPro:IPR022458"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI6"
FT                   /protein_id="CAE51737.1"
FT                   "
FT   misc_feature    join(195594..195662,195675..195728)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 20-42 and 47-64"
FT   misc_feature    196149..196172
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS             197618..198730
FT                   /transl_table=11
FT                   /locus_tag="SMR0213"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.273 SWALL:Q935G8 (EMBL:AL513383) (368 aa) fasta
FT                   scores: E(): 4.2e-104, 65.94% id in 370 aa, and to
FT                   Salmonella typhi hypothetical protein R0118 SWALL:Q9L5M4
FT                   (EMBL:AF250878) (367 aa) fasta scores: E(): 1.2e-103,
FT                   65.85% id in 369 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI5"
FT                   /protein_id="CAE51738.1"
FT   CDS             198717..199379
FT                   /transl_table=11
FT                   /gene="traJ"
FT                   /locus_tag="SMR0214"
FT                   /product="putative inner membrane protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0117 or Hcm1.275 SWALL:Q9L5M5 (EMBL:AF250878) (220 aa)
FT                   fasta scores: E(): 2.8e-70, 81.36% id in 220 aa"
FT                   /db_xref="GOA:Q6MXI4"
FT                   /db_xref="InterPro:IPR022266"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI4"
FT                   /protein_id="CAE51739.1"
FT   misc_feature    join(198741..198809,199077..199145,199203..199271,
FT                   199299..199358)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 9-31, 121-143, 163-185 and
FT                   195-214"
FT   CDS             199390..200571
FT                   /transl_table=11
FT                   /locus_tag="SMR0215"
FT                   /product="putative peptidase"
FT                   /note="Similar to many including: Salmonella typhi
FT                   hypothetical protein R0116 or Hcm1.276 SWALL:Q9L5M6
FT                   (EMBL:AF250878) (393 aa) fasta scores: E(): 4.2e-109, 72.4%
FT                   id in 395 aa, and to the C-terminal domain of many
FT                   peptidases e.g. Bacillus subtilis putative signal peptide
FT                   peptidase SppA SWALL:SPPA_BACSU (SWALL:O34525) (335 aa)
FT                   fasta scores: E(): 7e-08, 29.79% id in 245 aa"
FT                   /db_xref="GOA:Q6MXI3"
FT                   /db_xref="InterPro:IPR002142"
FT                   /db_xref="InterPro:IPR029045"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI3"
FT                   /protein_id="CAE51740.1"
FT   misc_feature    199942..200421
FT                   /note="Pfam match to entry PF01343 Peptidase_U7, Peptidase
FT                   family U7 , score 87.8, E-value 1.4e-23"
FT   CDS             200573..201304
FT                   /transl_table=11
FT                   /locus_tag="SMR0216"
FT                   /product="exported protein"
FT                   /note="Similar to many proteins of undefined function
FT                   including: Salmonella typhi hypothetical protein R0115
FT                   SWALL:Q9L5M7 (EMBL:AF250878) (242 aa) fasta scores: E():
FT                   6.5e-63, 62.81% id in 242 aa, and to Bacillus anthracis
FT                   str. A2012 hypothetical 24.9 kDa protein Bxa0003
FT                   SWALL:AAM25960 (EMBL:AE011190) (212 aa) fasta scores: E():
FT                   7e-10, 28.41% id in 183 aa"
FT                   /db_xref="GOA:Q6MXI2"
FT                   /db_xref="InterPro:IPR011528"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI2"
FT                   /protein_id="CAE51741.1"
FT   misc_feature    200573..200677
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.988) with cleavage
FT                   site probability 0.957 between residues 35 and 36"
FT   misc_feature    201236..201289
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 10-32 and 222-239"
FT   CDS             complement(201591..201944)
FT                   /transl_table=11
FT                   /locus_tag="SMR0217"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi orf, hypothetical
FT                   protein R0114 or Hcm1.278C SWALL:Q9L5M8 (EMBL:AF250878)
FT                   (118 aa) fasta scores: E(): 5.3e-36, 73.27% id in 116 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI1"
FT                   /protein_id="CAE51742.1"
FT                   LQEAWQNIPALNP"
FT   CDS             complement(202010..202294)
FT                   /transl_table=11
FT                   /locus_tag="SMR0218"
FT                   /product="putative inner membrane protein"
FT                   /note="Similar in the N-terminus only to Salmonella typhi
FT                   putative membrane protein Hcm1.279C SWALL:Q935G6
FT                   (EMBL:AL513383) (104 aa) fasta scores: E(): 1.7e-06, 55% id
FT                   in 60 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXI0"
FT                   /protein_id="CAE51743.1"
FT   misc_feature    complement(202226..202285)
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-23"
FT   CDS             202920..204128
FT                   /transl_table=11
FT                   /gene="Tn10R"
FT                   /locus_tag="SMR0219"
FT                   /product="Tn10 transposase for IS10 right"
FT                   /note="Similar to Salmonella typhimurium transposase TnpR
FT                   SWALL:BAB91573 (EMBL:AP005147) (402 aa) fasta scores: E():
FT                   6.7e-170, 100% id in 402 aa, and to Escherichia coli, and
FT                   Salmonella typhi transposase R0085 SWALL:Q53371
FT                   (EMBL:S67119) (402 aa) fasta scores: E(): 7.8e-170, 99.75%
FT                   id in 402 aa"
FT                   /db_xref="GOA:Q6MXH9"
FT                   /db_xref="InterPro:IPR002559"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR014736"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH9"
FT                   /protein_id="CAE51744.1"
FT                   GKL"
FT   misc_feature    203190..203912
FT                   /note="Pfam match to entry PF01609 Transposase_11,
FT                   Transposase DDE domain , score 139.0, E-value 5.4e-39"
FT   CDS             complement(204138..204554)
FT                   /transl_table=11
FT                   /gene="tetD"
FT                   /locus_tag="SMR0220"
FT                   /product="araC-family regulatory protein located on Tn10"
FT                   /note="Similar to Escherichia coli transposon Tn10 TetD
FT                   protein SWALL:TETD_ECOLI (SWALL:P28816) (138 aa) fasta
FT                   scores: E(): 5.6e-53, 98.55% id in 138 aa, and to
FT                   Salmonella typhimurium TetD protein SWALL:BAB91574
FT                   (EMBL:AP005147) (138 aa) fasta scores: E(): 1.2e-53, 100%
FT                   id in 138 aa"
FT                   /db_xref="GOA:Q6MXH8"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR018060"
FT                   /db_xref="InterPro:IPR018062"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH8"
FT                   /protein_id="CAE51745.1"
FT   misc_feature    complement(204171..204302)
FT                   /note="Pfam match to entry PF00165 HTH_AraC, Bacterial
FT                   regulatory helix-turn-helix proteins, araC family , score
FT                   43.1, E-value 4.1e-10"
FT   misc_feature    complement(204186..204323)
FT                   /note="PS00041 Bacterial regulatory proteins, araC family
FT                   signature."
FT   misc_feature    complement(204321..204458)
FT                   /note="Pfam match to entry PF00165 HTH_AraC, Bacterial
FT                   regulatory helix-turn-helix proteins, araC family , score
FT                   57.1, E-value 2.5e-14"
FT   CDS             204642..205235
FT                   /transl_table=11
FT                   /gene="tetC"
FT                   /locus_tag="SMR0221"
FT                   /product="transposon tn10 TetC protein"
FT                   /note="Similar to Escherichia coli transposon tn10 TetC
FT                   protein SWALL:TETC_ECOLI (SWALL:P28815) (197 aa) fasta
FT                   scores: E(): 2.6e-72, 99.49% id in 197 aa, and to
FT                   Salmonella typhimurium TetC protein SWALL:BAB91575
FT                   (EMBL:AP005147) (197 aa) fasta scores: E(): 8.2e-73, 100%
FT                   id in 197 aa"
FT                   /db_xref="GOA:Q6MXH7"
FT                   /db_xref="InterPro:IPR001647"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR015893"
FT                   /db_xref="InterPro:IPR023772"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH7"
FT                   /protein_id="CAE51746.1"
FT   misc_feature    204693..204833
FT                   /note="Pfam match to entry PF00440 tetR, Bacterial
FT                   regulatory proteins, tetR family , score 69.2, E-value
FT                   5.7e-18"
FT   misc_feature    204729..204821
FT                   /note="PS01081 Bacterial regulatory proteins, tetR family
FT                   signature."
FT   CDS             complement(205348..206553)
FT                   /transl_table=11
FT                   /gene="tetA"
FT                   /locus_tag="SMR0222"
FT                   /product="tetracycline resistance protein"
FT                   /note="Similar to Escherichia coli tetracycline resistance
FT                   protein, class B, TetA SWALL:TCR2_ECOLI (SWALL:P02980) (401
FT                   aa) fasta scores: E(): 1.1e-146, 100% id in 401 aa and to
FT                   Shigella flexneri TetA SWALL:AAD50247 (EMBL:AF162223) (401
FT                   aa) fasta scores: E(): 1.1e-146, 100% id in 401 aa"
FT                   /db_xref="GOA:Q6MXH6"
FT                   /db_xref="InterPro:IPR001958"
FT                   /db_xref="InterPro:IPR005829"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH6"
FT                   /protein_id="CAE51747.1"
FT                   SA"
FT   misc_feature    complement(205375..206538)
FT                   /note="Pfam match to entry PF00083 sugar_tr, Sugar (and
FT                   other) transporter , score -107.2, E-value 0.00045"
FT   misc_feature    complement(join(205390..205458,205486..205554,
FT                   205591..205659,205669..205722,205756..205824,
FT                   205852..205920,206017..206070,206098..206166,
FT                   206200..206259,206269..206337,206371..206439,
FT                   206467..206535))
FT                   /note="12 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29, 39-61, 73-95, 99-118,
FT                   130-152, 162-179, 212-234, 244-266, 278-295, 299-321,
FT                   334-356 and 366-388"
FT   misc_feature    complement(205456..205500)
FT                   /note="PS00678 Trp-Asp (WD) repeats signature."
FT   CDS             206635..207258
FT                   /transl_table=11
FT                   /gene="tetR"
FT                   /locus_tag="SMR0223"
FT                   /product="Tetracycline repressor protein class B from
FT                   transposon tn10"
FT                   /note="Similar to Escherichia coli Tetracycline repressor
FT                   protein class B from transposon Tn10, TetR SWALL:TER2_ECOLI
FT                   (SWALL:P04483) (207 aa) fasta scores: E(): 4.4e-84, 100% id
FT                   in 207 aa, and to Salmonella typhimurium TetR protein
FT                   SWALL:BAB91577 (EMBL:AP005147) (207 aa) fasta scores: E():
FT                   4.4e-84, 100% id in 207 aa"
FT                   /db_xref="GOA:Q6MXH5"
FT                   /db_xref="InterPro:IPR001647"
FT                   /db_xref="InterPro:IPR003012"
FT                   /db_xref="InterPro:IPR004111"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR011075"
FT                   /db_xref="InterPro:IPR015893"
FT                   /db_xref="InterPro:IPR023772"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH5"
FT                   /protein_id="CAE51748.1"
FT   misc_feature    206659..206799
FT                   /note="Pfam match to entry PF00440 tetR, Bacterial
FT                   regulatory proteins, tetR family , score 63.2, E-value
FT                   3.7e-16"
FT   misc_feature    206695..206787
FT                   /note="PS01081 Bacterial regulatory proteins, tetR family
FT                   signature."
FT   misc_feature    206707..206772
FT                   /note="Predicted helix-turn-helix motif with score
FT                   2218.000, SD 6.74 at aa 26-47, sequence
FT   misc_feature    206836..207237
FT                   /note="Pfam match to entry PF02909 tetR_C, Tetracyclin
FT                   repressor, C-terminal all-alpha domain , score 260.8,
FT                   E-value 1.2e-75"
FT   CDS             complement(207236..207922)
FT                   /transl_table=11
FT                   /locus_tag="SMR0224"
FT                   /product="putative arsR-family transcriptional regulatory
FT                   protein"
FT                   /note="Similar to sveral including: Shigella flexneri,
FT                   Escherichia coli, and Salmonella typhi hypothetical protein
FT                   JemC or YeaA or R0080 SWALL:Q9S456 (EMBL:AF162223) (228 aa)
FT                   fasta scores: E(): 2e-93, 100% id in 228 aa and to
FT                   Salmonella typhi putative transcriptional regulator
FT                   hcm1.244C SWALL:Q935I0 (EMBL:AL513383) (228 aa) fasta
FT                   scores: E(): 3.1e-93, 99.56% id in 228 aa"
FT                   /db_xref="GOA:Q6MXH4"
FT                   /db_xref="InterPro:IPR001845"
FT                   /db_xref="InterPro:IPR011991"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH4"
FT                   /protein_id="CAE51749.1"
FT                   KTHFHI"
FT   misc_feature    complement(207632..207868)
FT                   /note="Pfam match to entry PF01022 HTH_5, Bacterial
FT                   regulatory protein, arsR family , score 48.5, E-value
FT                   9.9e-12"
FT   misc_feature    complement(207740..207805)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1172.000, SD 3.18 at aa 40-61, sequence
FT   CDS             complement(207930..208316)
FT                   /transl_table=11
FT                   /locus_tag="SMR0225"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.245C SWALL:Q935H9 (EMBL:AL513383) (128 aa) fasta
FT                   scores: E(): 1.3e-48, 100% id in 128 aa, and, in part, to
FT                   Escherichia coli hypothetical protein YdjB protein
FT                   SWALL:Q9WTF2 (EMBL:AP000342) (162 aa) fasta scores: E():
FT                   1.6e-48, 100% id in 128 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH3"
FT                   /protein_id="CAE51750.1"
FT   CDS             complement(208309..208629)
FT                   /transl_table=11
FT                   /locus_tag="SMR0226"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to many proteins of undefined function
FT                   including: Shigella flexneri, Escherichia coli, and
FT                   Salmonella typhi JemB or YdjA or R0078 or Hcm1.246C
FT                   SWALL:Q9S457 (EMBL:AF162223) (106 aa) fasta scores: E():
FT                   3.6e-42, 100% id in 106 aa, and to Salmonella typhimurium
FT                   YbeB protein SWALL:BAB91580 (EMBL:AP005147) (106 aa) fasta
FT                   scores: E(): 3.6e-42, 100% id in 106 aa, and to Brucella
FT                   melitensis hypothetical cytosolic protein Bmei0152
FT                   SWALL:Q8YJD4 (EMBL:AE009458) (120 aa) fasta scores: E():
FT                   8.5e-18, 53% id in 100 aa"
FT                   /db_xref="InterPro:IPR007138"
FT                   /db_xref="InterPro:IPR011008"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH2"
FT                   /protein_id="CAE51751.1"
FT                   NV"
FT   CDS             209073..210278
FT                   /transl_table=11
FT                   /gene="gltS"
FT                   /locus_tag="SMR0227"
FT                   /product="sodium/glutamate symport carrier protein"
FT                   /note="Similar to Haemophilus influenzae sodium/glutamate
FT                   symport carrier protein GltS or Hi1530 SWALL:GLTS_HAEIN
FT                   (SWALL:P45240) (404 aa) fasta scores: E(): 3.1e-82, 56.99%
FT                   id in 386 aa and to Shigella flexneri, Escherichia coli,
FT                   and Salmonella typhi JemA protein or YdhA or GltS
FT                   SWALL:Q9S458 (EMBL:AF162223) (401 aa) fasta scores: E():
FT                   7.3e-147, 99.75% id in 401 aa"
FT                   /db_xref="GOA:Q6MXH1"
FT                   /db_xref="InterPro:IPR004445"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH1"
FT                   /protein_id="CAE51752.1"
FT                   FT"
FT   misc_feature    209073..210170
FT                   /note="Pfam match to entry PF03616 Glt_symporter,
FT                   Sodium/glutamate symporter , score 880.6, E-value 3.1e-262"
FT   misc_feature    join(209091..209159,209172..209225,209238..209306,
FT                   209349..209417,209436..209504,209532..209600,
FT                   209715..209783,209793..209861,209880..209948,
FT                   209976..210044,210078..210137,210180..210248)
FT                   /note="12 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29, 34-51, 56-78, 93-115,
FT                   122-144, 154-176, 215-237, 241-263, 270-292, 302-324,
FT                   336-355 and 370-392"
FT   misc_feature    210006..210038
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   repeat_region   210012..210066
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (29 - 81), score:
FT                   1.9, E-value: 0.22"
FT   misc_feature    210084..210101
FT                   /note="PS00134 Serine proteases, trypsin family, histidine
FT                   active site."
FT   CDS             complement(210644..211852)
FT                   /transl_table=11
FT                   /gene="Tn10L"
FT                   /locus_tag="SMR0228"
FT                   /product="Tn10 transposase for IS10 left"
FT                   /note="Similar to Salmonella typhimurium TnpL protein
FT                   SWALL:BAB91582 (EMBL:AP005147) (402 aa) fasta scores: E():
FT                   2.3e-169, 100% id in 402 aa, and to Salmonella typhi,
FT                   Shigella flexneri, Escherichia coli, and Shigella flexneri
FT                   2a putative transposase Sty2056 or YdgA or Hcm1.249c or
FT                   Hcm1.194 or cp0091 SWALL:Q9S459 (EMBL:AL627272) (402 aa)
FT                   fasta scores: E(): 2.3e-169, 100% id in 402 aa"
FT                   /db_xref="GOA:Q6MXH0"
FT                   /db_xref="InterPro:IPR002559"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR014736"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXH0"
FT                   /protein_id="CAE51753.1"
FT                   GKL"
FT   misc_feature    complement(210860..211582)
FT                   /note="Pfam match to entry PF01609 Transposase_11,
FT                   Transposase DDE domain , score 138.5, E-value 8e-39"
FT   CDS             complement(212539..212907)
FT                   /transl_table=11
FT                   /locus_tag="SMR0230"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0142 or Hcm1.196 SWALL:Q9L5K0 (EMBL:AF250878) (128 aa)
FT                   fasta scores: E(): 1.4e-13, 45.45% id in 132 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG9"
FT                   /protein_id="CAE51754.1"
FT                   KRLHVENGSVRFVFGFEG"
FT   CDS             complement(213133..213669)
FT                   /transl_table=11
FT                   /locus_tag="SMR0231"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0110 or Hcm1.280C SWALL:Q9L5N2 (EMBL:AF250878) (181 aa)
FT                   fasta scores: E(): 3.4e-43, 63.84% id in 177 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG8"
FT                   /protein_id="CAE51755.1"
FT                   MPLYNNESDFRRLAS"
FT   CDS             complement(213737..214153)
FT                   /transl_table=11
FT                   /locus_tag="SMR0232"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi orf, hypothetical
FT                   protein r0109 or hcm1.281C SWALL:Q9L5N3 (EMBL:AF250878)
FT                   (145 aa) fasta scores: E(): 8.7e-27, 54.41% id in 136 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG7"
FT                   /protein_id="CAE51756.1"
FT   CDS             complement(214219..214515)
FT                   /transl_table=11
FT                   /locus_tag="SMR0233"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG6"
FT                   /protein_id="CAE51757.1"
FT   CDS             complement(214650..215351)
FT                   /transl_table=11
FT                   /locus_tag="SMR0234"
FT                   /product="putative inner membrane protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXG5"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG5"
FT                   /protein_id="CAE51758.1"
FT                   PEKPTSLKASS"
FT   misc_feature    complement(join(214911..214979,215016..215075,
FT                   215118..215186,215247..215315))
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35, 56-78, 93-112 and
FT                   125-147"
FT   CDS             complement(215666..215947)
FT                   /transl_table=11
FT                   /locus_tag="SMR0235"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0105 or Hcm1.284C SWALL:Q9L5N7 (EMBL:AF250878) (93 aa)
FT                   fasta scores: E(): 7.3e-20, 61.29% id in 93 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG4"
FT                   /protein_id="CAE51759.1"
FT   CDS             complement(216013..217197)
FT                   /transl_table=11
FT                   /locus_tag="SMR0236"
FT                   /product="putative DNA-binding protein"
FT                   /note="Similar to Salmonella typhi putative DNA-binding
FT                   protein Hcm1.286C SWALL:Q935G3 (EMBL:AL513383) (401 aa)
FT                   fasta scores: E(): 1.1e-78, 65.5% id in 403 aa"
FT                   /db_xref="GOA:Q6MXG3"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG3"
FT                   /protein_id="CAE51760.1"
FT   misc_feature    complement(216628..216693)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1563.000, SD 4.51 at aa 169-190, sequence
FT   CDS             complement(217614..217844)
FT                   /transl_table=11
FT                   /locus_tag="SMR0237"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG2"
FT                   /protein_id="CAE51761.1"
FT   repeat_region   complement(218232..218246)
FT                   /note="similar to oriT repeat"
FT                   /note="hmmsearch hit to HMM oriT repeat (1 - 15), score:
FT                   0.9, E-value: 0.35"
FT   CDS             218301..219245
FT                   /transl_table=11
FT                   /locus_tag="SMR0238"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG1"
FT                   /protein_id="CAE51762.1"
FT   CDS             219344..219943
FT                   /transl_table=11
FT                   /locus_tag="SMR0239"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXG0"
FT                   /protein_id="CAE51763.1"
FT   CDS             220003..220353
FT                   /transl_table=11
FT                   /locus_tag="SMR0240"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF9"
FT                   /protein_id="CAE51764.1"
FT                   ACRDAILNGDKG"
FT   CDS             complement(220489..220812)
FT                   /transl_table=11
FT                   /locus_tag="SMR0241"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF8"
FT                   /protein_id="CAE51765.1"
FT                   LST"
FT   CDS             220885..221205
FT                   /transl_table=11
FT                   /locus_tag="SMR0242"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF7"
FT                   /protein_id="CAE51766.1"
FT                   KV"
FT   CDS             221857..222969
FT                   /transl_table=11
FT                   /gene="insL"
FT                   /locus_tag="SMR0243"
FT                   /product="putative transposase for insertion sequence
FT                   element is186a/b/c"
FT                   /note="Similar to Escherichia coli putative transposase
FT                   InsL for insertion sequence element IS186a/b/c (insl1 or
FT                   b0016) and (insl2 or b0582) and (insl3 or b2394)
FT                   SWALL:INSL_ECOLI (SWALL:P08409) (370 aa) fasta scores: E():
FT                   2.3e-154, 99.73% id in 370 aa"
FT                   /db_xref="GOA:Q6MXF6"
FT                   /db_xref="InterPro:IPR002559"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR014736"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF6"
FT                   /protein_id="CAE51767.1"
FT   misc_feature    222181..222900
FT                   /note="Pfam match to entry PF01609 Transposase_11,
FT                   Transposase DDE domain , score 157.3, E-value 1.7e-44"
FT   CDS             complement(223163..223321)
FT                   /transl_table=11
FT                   /gene="hok"
FT                   /locus_tag="SMR0243A"
FT                   /product="plasmid inheritance protein"
FT                   /note="Similar to Escherichia coli plasmid inheritance
FT                   protein protein Hok SWALL:HOK_ECOLI (SWALL:P11895) (52 aa)
FT                   fasta scores: E(): 1.2e-14, 69.23% id in 52 aa, and to
FT                   Salmonella typhi putative stable plasmid inheritance
FT                   protein Hcm1.290C SWALL:Q935G2 (EMBL:AL513383) (52 aa)
FT                   fasta scores: E(): 1.1e-20, 86.53% id in 52 aa, and to
FT                   Escherichia coli stable plasmid inheritance protein flma or
FT                   stm or parB SWALL:FLMA_ECOLI (SWALL:P16077) (52 aa) fasta
FT                   scores: E(): 1.2e-14, 69.23% id in 52 aa"
FT                   /db_xref="GOA:Q6MXF5"
FT                   /db_xref="InterPro:IPR000021"
FT                   /db_xref="InterPro:IPR018084"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF5"
FT                   /protein_id="CAE51768.1"
FT                   LAYESGK"
FT   CDS             complement(223420..224271)
FT                   /transl_table=11
FT                   /gene="insK"
FT                   /locus_tag="SMR0245"
FT                   /product="putative transposase for insertion sequence
FT                   element IS150"
FT                   /note="Similar to Escherichia coli putative transposase
FT                   InsK for insertion sequence element IS150 or b3558
FT                   SWALL:INSK_ECOLI (SWALL:P19769) (283 aa) fasta scores: E():
FT                   5e-110, 99.64% id in 283 aa"
FT                   /db_xref="GOA:Q6MXF4"
FT                   /db_xref="InterPro:IPR001584"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR025948"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF4"
FT                   /protein_id="CAE51769.1"
FT                   RV"
FT   misc_feature    complement(223444..223923)
FT                   /note="Pfam match to entry PF00665 rve, Integrase core
FT                   domain , score 169.7, E-value 3.2e-48"
FT   misc_feature    complement(224176..224241)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1091.000, SD 2.90 at aa 11-32, sequence
FT   CDS             complement(224268..224789)
FT                   /transl_table=11
FT                   /gene="insJ"
FT                   /locus_tag="SMR0246"
FT                   /product="insertion element IS150 hypothetical protein"
FT                   /note="Similar to Escherichia coli insertion element IS150
FT                   hypothetical 19.7 kDa protein InsJ or B3557
FT                   SWALL:INSJ_ECOLI (SWALL:P19768) (173 aa) fasta scores: E():
FT                   3.5e-63, 100% id in 173 aa"
FT                   /db_xref="GOA:Q6MXF3"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR010921"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF3"
FT                   /protein_id="CAE51770.1"
FT                   LKALAHPTKK"
FT   misc_feature    complement(224658..224723)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1032.000, SD 2.70 at aa 23-44, sequence
FT   CDS             complement(225122..225727)
FT                   /transl_table=11
FT                   /locus_tag="SMR0247"
FT                   /product="putative inner membrane protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0100 SWALL:Q9L5P2 (EMBL:AF250878) (201 aa) fasta scores:
FT                   E(): 1.5e-31, 42.92% id in 198 aa, and to Salmonella typhi
FT                   putative membrane protein Hcm1.01C SWALL:Q935S6
FT                   (EMBL:AL513383) (176 aa) fasta scores: E(): 7.7e-28, 44% id
FT                   in 175 aa"
FT                   /db_xref="GOA:Q6MXF2"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF2"
FT                   /protein_id="CAE51771.1"
FT   misc_feature    complement(join(225395..225463,225521..225589))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 47-69 and 89-111"
FT   CDS             complement(225944..226225)
FT                   /transl_table=11
FT                   /locus_tag="SMR0248"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0099 SWALL:Q9L5P3 (EMBL:AF250878) (93 aa) fasta scores:
FT                   E(): 2.7e-26, 76.74% id in 86 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF1"
FT                   /protein_id="CAE51772.1"
FT   CDS             complement(226601..226912)
FT                   /transl_table=11
FT                   /locus_tag="SMR0249"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0098 or Hcm1.03C SWALL:Q9L5P4 (EMBL:AF250878) (107 aa)
FT                   fasta scores: E(): 4.8e-21, 59.4% id in 101 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXF0"
FT                   /protein_id="CAE51773.1"
FT   CDS             complement(227135..227335)
FT                   /transl_table=11
FT                   /locus_tag="SMR0250"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0093 or Hcm1.10C SWALL:Q9L5P8 (EMBL:AF250878) (68 aa)
FT                   fasta scores: E(): 8.6e-08, 58.18% id in 55 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE9"
FT                   /protein_id="CAE51774.1"
FT   CDS             complement(227375..227599)
FT                   /transl_table=11
FT                   /locus_tag="SMR0251"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0092 or Hcm1.13C SWALL:Q9L5P9 (EMBL:AF250878) (74 aa)
FT                   fasta scores: E(): 1.9e-22, 79.73% id in 74 aa, and to
FT                   Salmonella typhi orf, hypothetical protein R0072 or
FT                   Hcm1.30C SWALL:Q9L5Q9 (EMBL:AF250878) (74 aa) fasta scores:
FT                   E(): 3.6e-10, 49.25% id in 67 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE8"
FT                   /protein_id="CAE51775.1"
FT   CDS             complement(227654..227857)
FT                   /transl_table=11
FT                   /locus_tag="SMR0251A"
FT                   /product="putative inner membrane protein"
FT                   /note="Similar to Salmonella typhi putative membrane
FT                   protein Hcm1.15C SWALL:Q935S2 (EMBL:AL513383) (68 aa) fasta
FT                   scores: E(): 0.0064, 28.35% id in 67 aa"
FT                   /db_xref="GOA:Q6MXE7"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE7"
FT                   /protein_id="CAE51776.1"
FT   CDS             complement(228410..228901)
FT                   /transl_table=11
FT                   /locus_tag="SMR0252"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.20C SWALL:Q935S1 (EMBL:AL513383) (163 aa) fasta
FT                   scores: E(): 3.7e-32, 51.23% id in 162 aa, and to
FT                   Salmonella typhi hypothetical protein R0089 SWALL:Q9L5Q2
FT                   (EMBL:AF250878) (163 aa) fasta scores: E(): 1.3e-31, 51.23%
FT                   id in 162 aa"
FT                   /db_xref="InterPro:IPR021436"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE6"
FT                   /protein_id="CAE51777.1"
FT                   "
FT   CDS             complement(228906..229217)
FT                   /transl_table=11
FT                   /locus_tag="SMR0253"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0088 or Hcm1.21C SWALL:Q9L5Q3 (EMBL:AF250878) (102 aa)
FT                   fasta scores: E(): 4.5e-25, 72.81% id in 103 aa"
FT                   /db_xref="InterPro:IPR009301"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE5"
FT                   /protein_id="CAE51778.1"
FT   CDS             complement(229734..230054)
FT                   /transl_table=11
FT                   /locus_tag="SMR0254"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE4"
FT                   /protein_id="CAE51779.1"
FT                   EA"
FT   CDS             complement(230233..230463)
FT                   /transl_table=11
FT                   /locus_tag="SMR0255"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.23C SWALL:Q935R9 (EMBL:AL513383) (94 aa) fasta scores:
FT                   E(): 1.8e-11, 57.35% id in 68 aa. Note the differing
FT                   N_terminal regions."
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE3"
FT                   /protein_id="CAE51780.1"
FT   CDS             complement(230635..231528)
FT                   /transl_table=11
FT                   /gene="klaC"
FT                   /locus_tag="SMR0256"
FT                   /product="putative inner membrane protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXE2"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE2"
FT                   /protein_id="CAE51781.1"
FT                   LLGIKIRRRVRFLESN"
FT   misc_feature    complement(join(230674..230742,231103..231171,
FT                   231205..231273,231376..231444))
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 29-51, 86-108, 120-142 and
FT                   263-285"
FT   CDS             complement(231518..232618)
FT                   /transl_table=11
FT                   /gene="klaB"
FT                   /locus_tag="SMR0257"
FT                   /product="putative plasmid maintenance protein"
FT                   /note="Similar to Escherichia coli klaA operon protein KlaB
FT                   or TelA SWALL:KLAB_ECOLI (SWALL:Q52328) (378 aa) fasta
FT                   scores: E(): 1.1e-69, 56.26% id in 359 aa, to Rhodobacter
FT                   sphaeroides tellurite resistance protein TelA SWALL:O30859
FT                   (EMBL:AF019377) (396 aa) fasta scores: E(): 2e-17, 26.48%
FT                   id in 336 aa, and to Clostridium acetobutylicum toxic anion
FT                   resistance protein, TelA family b.subtilis ortholog cac2994
FT                   SWALL:Q97EW2 (EMBL:AE007796) (375 aa) fasta scores: E():
FT                   2.5e-13, 23.63% id in 330 aa"
FT                   /db_xref="InterPro:IPR008863"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE1"
FT                   /protein_id="CAE51782.1"
FT   CDS             complement(232627..233412)
FT                   /transl_table=11
FT                   /gene="klaA"
FT                   /locus_tag="SMR0258"
FT                   /product="putative plasmid maintenance protein"
FT                   /note="Similar to Escherichia coli klaa protein klaA or
FT                   KilA SWALL:KLAA_ECOLI (SWALL:Q57239) (257 aa) fasta scores:
FT                   E(): 2.7e-43, 45.31% id in 256 aa"
FT                   /db_xref="InterPro:IPR008863"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXE0"
FT                   /protein_id="CAE51783.1"
FT   CDS             complement(join(233643..233798,233802..233930))
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="SMR0259"
FT                   /product="conserved hypothetical protein (pseudogene)"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.25C SWALL:Q935R7 (EMBL:AL513383) (117 aa) fasta
FT                   scores: E(): 3.6e-23, 67.36% id in 95 aa. Note this CDS
FT                   contains a stop codon after codon 43."
FT                   /db_xref="PSEUDO:CAE51784.1"
FT   CDS             complement(234007..234615)
FT                   /transl_table=11
FT                   /locus_tag="SMR0261"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.26C SWALL:Q935R6 (EMBL:AL513383) (202 aa) fasta
FT                   scores: E(): 3.2e-48, 62.18% id in 201 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD9"
FT                   /protein_id="CAE51785.1"
FT   CDS             complement(234729..235262)
FT                   /transl_table=11
FT                   /locus_tag="SMR0262"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.27C SWALL:Q935R5 (EMBL:AL513383) (174 aa) fasta
FT                   scores: E(): 1.4e-55, 79.88% id in 174 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD8"
FT                   /protein_id="CAE51786.1"
FT                   VFWFEQYNEQKQNE"
FT   CDS             complement(235317..235511)
FT                   /transl_table=11
FT                   /locus_tag="SMR0263"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD7"
FT                   /protein_id="CAE51787.1"
FT   CDS             complement(235508..235819)
FT                   /transl_table=11
FT                   /locus_tag="SMR0264"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.28C SWALL:Q935R4 (EMBL:AL513383) (103 aa) fasta
FT                   scores: E(): 1.1e-25, 70.4% id in 98 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD6"
FT                   /protein_id="CAE51788.1"
FT   CDS             complement(235882..236121)
FT                   /transl_table=11
FT                   /locus_tag="SMR0265"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0072 or Hcm1.30C SWALL:Q9L5Q9 (EMBL:AF250878) (74 aa)
FT                   fasta scores: E(): 3.4e-16, 67.12% id in 73 aa, and to
FT                   Salmonella typhi hypothetical protein R0092 or Hcm1.13C
FT                   SWALL:Q9L5P9 (EMBL:AF250878) (74 aa) fasta scores: E():
FT                   5.6e-12, 51.42% id in 70 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD5"
FT                   /protein_id="CAE51789.1"
FT   CDS             complement(236371..238755)
FT                   /transl_table=11
FT                   /locus_tag="SMR0266"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.32C SWALL:Q935R1 (EMBL:AL513383) (809 aa) fasta
FT                   scores: E(): 0, 76.16% id in 793 aa (Note the differing
FT                   N-termini), and to Salmonella typhi hypothetical protein
FT                   R0070 SWALL:Q9L5R1 (EMBL:AF250878) (791 aa) fasta scores:
FT                   E(): 0, 76.13% id in 792 aa"
FT                   /db_xref="GOA:Q6MXD4"
FT                   /db_xref="InterPro:IPR002500"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD4"
FT                   /protein_id="CAE51790.1"
FT   misc_feature    complement(238642..238686)
FT                   /note="PS00678 Trp-Asp (WD) repeats signature."
FT   CDS             complement(238921..239370)
FT                   /transl_table=11
FT                   /locus_tag="SMR0267"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0069 SWALL:Q9L5R2 (EMBL:AF250878) (148 aa) fasta scores:
FT                   E(): 5.5e-32, 61.11% id in 144 aa, and to Salmonella typhi
FT                   hypothetical protein Hcm1.33C SWALL:Q935R0 (EMBL:AL513383)
FT                   (170 aa) fasta scores: E(): 6.2e-32, 61.11% id in 144 aa
FT                   (Note the differing N-termini)"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD3"
FT                   /protein_id="CAE51791.1"
FT   CDS             complement(239421..240212)
FT                   /transl_table=11
FT                   /locus_tag="SMR0268"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.34C SWALL:Q935Q9 (EMBL:AL513383) (268 aa) fasta
FT                   scores: E(): 4.2e-62, 59.09% id in 264 aa, and to
FT                   Salmonella typhi hypothetical protein R0068 SWALL:Q9L5R3
FT                   (EMBL:AF250878) (268 aa) fasta scores: E(): 5.7e-62, 59.09%
FT                   id in 264 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD2"
FT                   /protein_id="CAE51792.1"
FT   CDS             complement(240442..240699)
FT                   /transl_table=11
FT                   /locus_tag="SMR0269"
FT                   /product="hypothetical protein"
FT                   /note="The C-terminus of the predicted product of this CDS
FT                   is similar to Salmonella typhi hypothetical protein
FT                   Hcm1.35C SWALL:Q935Q8 (EMBL:AL513383) (63 aa) fasta scores:
FT                   E(): 1.8e-05, 45.45% id in 55 aa, and to Salmonella typhi
FT                   hypothetical protein R0067 SWALL:Q9L5R4 (EMBL:AF250878) (54
FT                   aa) fasta scores: E(): 0.0092, 46.66% id in 45 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD1"
FT                   /protein_id="CAE51793.1"
FT   CDS             complement(240765..241091)
FT                   /transl_table=11
FT                   /locus_tag="SMR0270"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0066 or Hcm1.36C SWALL:Q9L5R5 (EMBL:AF250878) (110 aa)
FT                   fasta scores: E(): 3.5e-25, 61.11% id in 108 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXD0"
FT                   /protein_id="CAE51794.1"
FT                   NPAF"
FT   CDS             complement(241334..241654)
FT                   /transl_table=11
FT                   /locus_tag="SMR0271"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC9"
FT                   /protein_id="CAE51795.1"
FT                   TN"
FT   CDS             complement(241949..243199)
FT                   /transl_table=11
FT                   /locus_tag="SMR0272"
FT                   /product="modification methylase"
FT                   /note="Similar to several DNA methylases including: Proteus
FT                   vulgaris modification methylase PvuIIM SWALL:MTP2_PROVU
FT                   (SWALL:P11409) (336 aa) fasta scores: E(): 2e-24, 29.51% id
FT                   in 288 aa, and to Salmonella paratyphi-A DNA
FT                   methyltransferase SptAIM SWALL:Q9EZ28 (EMBL:AF306456) (331
FT                   aa) fasta scores: E(): 3.8e-26, 30.86% id in 311 aa"
FT                   /db_xref="GOA:Q6MXC8"
FT                   /db_xref="InterPro:IPR001091"
FT                   /db_xref="InterPro:IPR002941"
FT                   /db_xref="InterPro:IPR017985"
FT                   /db_xref="InterPro:IPR025745"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC8"
FT                   /protein_id="CAE51796.1"
FT                   GYKSNPMLDELAELYRA"
FT   misc_feature    complement(242015..242701)
FT                   /note="Pfam match to entry PF01555 N6_N4_Mtase, DNA
FT                   methylase , score 19.5, E-value 0.00014"
FT   misc_feature    complement(242789..242806)
FT                   /note="PS00093 N-4 cytosine-specific DNA methylases
FT                   signature."
FT   repeat_region   243097..243150
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (28 - 81), score:
FT                   1.3, E-value: 0.29"
FT   CDS             complement(243370..243978)
FT                   /transl_table=11
FT                   /locus_tag="SMR0273"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC7"
FT                   /protein_id="CAE51797.1"
FT   CDS             complement(244134..244406)
FT                   /transl_table=11
FT                   /locus_tag="SMR0274"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC6"
FT                   /protein_id="CAE51798.1"
FT   CDS             complement(244456..244800)
FT                   /transl_table=11
FT                   /locus_tag="SMR0275"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC5"
FT                   /protein_id="CAE51799.1"
FT                   NTWGHSFIKG"
FT   CDS             complement(244976..245353)
FT                   /transl_table=11
FT                   /locus_tag="SMR0276"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC4"
FT                   /protein_id="CAE51800.1"
FT   CDS             complement(245759..246940)
FT                   /transl_table=11
FT                   /locus_tag="SMR0277"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.38C SWALL:Q935Q7 (EMBL:AL513383) (393 aa) fasta
FT                   scores: E(): 4.7e-98, 62.24% id in 392 aa, and to
FT                   Salmonella typhi hypothetical protein R0065 SWALL:Q9L5R6
FT                   (EMBL:AF250878) (317 aa) fasta scores: E(): 2.3e-77, 61.39%
FT                   id in 316 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC3"
FT                   /protein_id="CAE51801.1"
FT   CDS             complement(246949..247245)
FT                   /transl_table=11
FT                   /locus_tag="SMR0278"
FT                   /product="putative plasmid maintenance protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.39C SWALL:Q935Q6 (EMBL:AL513383) (98 aa) fasta scores:
FT                   E(): 4.1e-36, 89.79% id in 98 aa, and to Escherichia coli
FT                   killer protein HigB SWALL:Q52305 (EMBL:U43847) (92 aa)
FT                   fasta scores: E(): 0.0052, 30.1% id in 93 aa"
FT                   /db_xref="InterPro:IPR007711"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC2"
FT                   /protein_id="CAE51802.1"
FT   CDS             complement(247295..247765)
FT                   /transl_table=11
FT                   /locus_tag="SMR0279"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0063 or Hcm1.40C SWALL:Q9L5R8 (EMBL:AF250878) (155 aa)
FT                   fasta scores: E(): 3.1e-39, 64.51% id in 155 aa"
FT                   /db_xref="GOA:Q6MXC1"
FT                   /db_xref="InterPro:IPR001305"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC1"
FT                   /protein_id="CAE51803.1"
FT   CDS             complement(248199..250589)
FT                   /transl_table=11
FT                   /locus_tag="SMR0280"
FT                   /product="exported protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0055 SWALL:Q9L5S6 (EMBL:AF250878) (794 aa) fasta scores:
FT                   E(): 8.3e-101, 38.83% id in 788 aa, and to Salmonella typhi
FT                   hypothetical protein R0045 SWALL:Q9L5T4 (EMBL:AF250878)
FT                   (719 aa) fasta scores: E(): 6.4e-13, 26.63% id in 732 aa.
FT                   Also similar to the plasmid R478 CDS SMR0290 29.461%
FT                   identity (32.199% ungapped) in 835 aa and SMR0293 29.808%
FT                   identity (32.718% ungapped) in 832 aa."
FT                   /db_xref="InterPro:IPR022038"
FT                   /db_xref="InterPro:IPR025429"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXC0"
FT                   /protein_id="CAE51804.1"
FT   misc_feature    complement(249075..249119)
FT                   /note="PS00678 Trp-Asp (WD) repeats signature."
FT   misc_feature    complement(250290..250313)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(250530..250589)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.985 between residues 20 and 21"
FT   CDS             complement(250992..251243)
FT                   /transl_table=11
FT                   /locus_tag="SMR0281"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB9"
FT                   /protein_id="CAE51805.1"
FT   CDS             complement(251451..251708)
FT                   /transl_table=11
FT                   /locus_tag="SMR0282"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB8"
FT                   /protein_id="CAE51806.1"
FT   CDS             complement(251701..252132)
FT                   /transl_table=11
FT                   /locus_tag="SMR0283"
FT                   /product="hypothetical protein"
FT                   /note="Weakly similar in parts to Prunus necrotic ringspot
FT                   virus replicase P1 SWALL:Q91NQ1 (EMBL:AF278534) (1045 aa)
FT                   fasta scores: E(): 7.8, 30.43% id in 115 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB7"
FT                   /protein_id="CAE51807.1"
FT   CDS             complement(252236..252760)
FT                   /transl_table=11
FT                   /locus_tag="SMR0284"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB6"
FT                   /protein_id="CAE51808.1"
FT                   LNEALSTAIKR"
FT   CDS             252776..252916
FT                   /transl_table=11
FT                   /locus_tag="SMR0285"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits, doubtful CDS"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB5"
FT                   /protein_id="CAE51809.1"
FT                   V"
FT   CDS             253083..253847
FT                   /transl_table=11
FT                   /locus_tag="SMR0286"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0060 SWALL:Q9L5S1 (EMBL:AF250878) (258 aa) fasta scores:
FT                   E(): 5.4e-62, 62.74% id in 255 aa, and to Salmonella typhi
FT                   hypothetical protein Hcm1.43 SWALL:Q935Q5 (EMBL:AL513383)
FT                   (258 aa) fasta scores: E(): 7.2e-62, 62.74% id in 255 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB4"
FT                   /protein_id="CAE51810.1"
FT   CDS             253865..254689
FT                   /transl_table=11
FT                   /locus_tag="SMR0287"
FT                   /product="hypothetical protein"
FT                   /note="Similar to several including: Salmonella typhi
FT                   putative DNA modification methylase Hcm2.0104C SWALL:Q934W3
FT                   (EMBL:AL513384) (567 aa) fasta scores: E(): 3.1e-07, 30.2%
FT                   id in 192 aa, and to Thermus thermophilus modification
FT                   methylase Tthhb8iM SWALL:MTT8_THETH (SWALL:P29749) (428 aa)
FT                   fasta scores: E(): 0.00073, 37.28% id in 118 aa"
FT                   /db_xref="GOA:Q6MXB3"
FT                   /db_xref="InterPro:IPR002052"
FT                   /db_xref="InterPro:IPR007848"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB3"
FT                   /protein_id="CAE51811.1"
FT   misc_feature    254432..254452
FT                   /note="PS00092 N-6 Adenine-specific DNA methylases
FT                   signature."
FT   CDS             254783..255046
FT                   /transl_table=11
FT                   /locus_tag="SMR0288"
FT                   /product="hypothetical protein"
FT                   /note="Similar to the C-terminus of Salmonella typhi
FT                   hypothetical protein Hcm1.45 SWALL:Q935Q3 (EMBL:AL513383)
FT                   (119 aa) fasta scores: E(): 2.9e-22, 66.66% id in 87 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB2"
FT                   /protein_id="CAE51812.1"
FT   CDS             255090..255533
FT                   /transl_table=11
FT                   /locus_tag="SMR0289"
FT                   /product="hypothetical protein"
FT                   /note="no significant database hits"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB1"
FT                   /protein_id="CAE51813.1"
FT   misc_feature    255255..255272
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   CDS             255767..258187
FT                   /transl_table=11
FT                   /locus_tag="SMR0290"
FT                   /product="exported protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0045 SWALL:Q9L5T4 (EMBL:AF250878) (719 aa) fasta scores:
FT                   E(): 6.9e-79, 39.22% id in 719 aa, and to Salmonella typhi
FT                   hypothetical protein R0055 SWALL:Q9L5S6 (EMBL:AF250878)
FT                   (794 aa) fasta scores: E(): 2.7e-47, 32.22% id in 816 aa.
FT                   Also similar to the plasmid R478 CDS SMR0280 29.461%
FT                   identity (32.199% ungapped) in 835 aa and SMR0293 41.463%
FT                   identity (42.447% ungapped) in 820 aa."
FT                   /db_xref="InterPro:IPR022038"
FT                   /db_xref="InterPro:IPR025429"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXB0"
FT                   /protein_id="CAE51814.1"
FT   misc_feature    255767..255829
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.967) with cleavage
FT                   site probability 0.593 between residues 21 and 22"
FT   repeat_region   258442..258480
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 39), score:
FT                   13.6, E-value: 7.8e-05"
FT   repeat_region   258716..258758
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 43), score:
FT                   4.9, E-value: 0.033"
FT   repeat_region   258795..258874
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   14.4, E-value: 4.6e-05"
FT   repeat_region   258875..258955
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   59.9, E-value: 9.5e-19"
FT   repeat_region   258956..259035
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   64.3, E-value: 4.5e-20"
FT   repeat_region   259036..259116
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   64.2, E-value: 4.6e-20"
FT   repeat_region   259117..259197
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   74.2, E-value: 4.6e-23"
FT   repeat_region   259198..259278
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   69.7, E-value: 1e-21"
FT   repeat_region   259279..259359
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   61.3, E-value: 3.4e-19"
FT   repeat_region   259360..259440
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   64.2, E-value: 4.8e-20"
FT   repeat_region   259441..259521
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   60.4, E-value: 6.4e-19"
FT   repeat_region   259522..259602
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   72.1, E-value: 2e-22"
FT   repeat_region   259603..259683
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   72.4, E-value: 1.6e-22"
FT   repeat_region   259684..259764
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 81), score:
FT                   58.0, E-value: 3.4e-18"
FT   repeat_region   259847..259887
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 41), score:
FT                   1.0, E-value: 0.34"
FT   repeat_region   259986..260031
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 46), score:
FT                   15.9, E-value: 1.6e-05"
FT   repeat_region   260155..260189
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 37), score:
FT                   4.0, E-value: 0.058"
FT   CDS             complement(260265..261353)
FT                   /transl_table=11
FT                   /gene="repHI2"
FT                   /locus_tag="SMR0292"
FT                   /product="plasmid replication protein"
FT                   /note="Similar to Salmonella typhi plasmid replication
FT                   protein RepA or Hcm2.0131 SWALL:REPA_SALTI (SWALL:Q934T6)
FT                   (351 aa) fasta scores: E(): 2e-58, 50.99% id in 351 aa, and
FT                   to Serratia marcescens rep protein rep hi2A SWALL:O06448
FT                   (EMBL:U62006) (319 aa) fasta scores: E(): 1.7e-117, 100% id
FT                   in 319 aa"
FT                   /db_xref="GOA:Q6MXA9"
FT                   /db_xref="InterPro:IPR000525"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA9"
FT                   /protein_id="CAE51815.1"
FT   misc_feature    complement(260484..261224)
FT                   /note="Pfam match to entry PF01651 RepA, RepA family ,
FT                   score 618.7, E-value 2.1e-183"
FT   repeat_region   261973..262011
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 39), score:
FT                   6.8, E-value: 0.0092"
FT   repeat_region   262324..262356
FT                   /note="hmmsearch hit to HMM RepHI2 iteron (1 - 37), score:
FT                   0.1, E-value: 0.48"
FT   CDS             complement(262461..264917)
FT                   /transl_table=11
FT                   /locus_tag="SMR0293"
FT                   /product="exported protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0045 SWALL:Q9L5T4 (EMBL:AF250878) (719 aa) fasta scores:
FT                   E(): 0, 81.27% id in 705 aa, and to Salmonella typhi
FT                   hypothetical protein R0055 SWALL:Q9L5S6 (EMBL:AF250878)
FT                   (794 aa) fasta scores: E(): 1.2e-48, 35.88% id in 836 aa.
FT                   Also similar to the plasmid R478 CDS SMR0280 29.736%
FT                   identity (32.804% ungapped) in 834 aa and SMR0293 41.463%
FT                   identity (42.447% ungapped) in 820 aa."
FT                   /db_xref="InterPro:IPR022038"
FT                   /db_xref="InterPro:IPR025429"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA8"
FT                   /protein_id="CAE51816.1"
FT                   NIEELK"
FT   misc_feature    complement(264852..264917)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.997 between residues 22 and 23"
FT   CDS             265290..265916
FT                   /transl_table=11
FT                   /locus_tag="SMR0294"
FT                   /product="exported protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXA7"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA7"
FT                   /protein_id="CAE51817.1"
FT   misc_feature    265290..265358
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.995) with cleavage
FT                   site probability 0.638 between residues 23 and 24"
FT   misc_feature    join(265293..265361,265404..265463,265500..265559,
FT                   265587..265655)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 2-24, 39-58, 71-90 and
FT                   100-122"
FT   CDS             complement(265974..266255)
FT                   /transl_table=11
FT                   /locus_tag="SMR0295"
FT                   /product="putative inner membrane protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXA6"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA6"
FT                   /protein_id="CAE51818.1"
FT   misc_feature    complement(join(266010..266078,266151..266219))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35 and 60-82"
FT   CDS             complement(266242..266685)
FT                   /transl_table=11
FT                   /locus_tag="SMR0296"
FT                   /product="exported protein"
FT                   /note="no significant database hits"
FT                   /db_xref="GOA:Q6MXA5"
FT                   /db_xref="InterPro:IPR001383"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA5"
FT                   /protein_id="CAE51819.1"
FT   misc_feature    complement(266611..266685)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.906) with cleavage
FT                   site probability 0.646 between residues 25 and 26"
FT   CDS             complement(266746..266922)
FT                   /transl_table=11
FT                   /locus_tag="SMR0297"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi orf, hypothetical
FT                   protein R0044 or Hcm1.56aC SWALL:Q9L5T5 (EMBL:AF250878) (58
FT                   aa) fasta scores: E(): 1.1e-09, 61.4% id in 57 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA4"
FT                   /protein_id="CAE51820.1"
FT                   ANSTENPGYEEFF"
FT   CDS             complement(266919..268610)
FT                   /transl_table=11
FT                   /locus_tag="SMR0298"
FT                   /product="putative DNA restriction methylase"
FT                   /note="Similar to Serratia marcescens restriction methylase
FT                   Trag1 SWALL:P95799 (EMBL:U60283) (563 aa) fasta scores:
FT                   E(): 0, 100% id in 563 aa, Salmonella typhi putative DNA
FT                   restriction methylase R0043 SWALL:Q9L5T6 (EMBL:AF250878)
FT                   (558 aa) fasta scores: E(): 2.1e-164, 70.78% id in 558 aa,
FT                   and to Proteus vulgaris R-factor Rts1 restriction
FT                   endonuclease PvuRTS1 I SWALL:Q52611 (EMBL:U03474) (290 aa)
FT                   fasta scores: E(): 5.3e-18, 33.33% id in 195 aa"
FT                   /db_xref="GOA:P95799"
FT                   /db_xref="InterPro:IPR002052"
FT                   /db_xref="InterPro:IPR007848"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="InterPro:IPR031339"
FT                   /db_xref="UniProtKB/TrEMBL:P95799"
FT                   /protein_id="CAE51821.1"
FT   misc_feature    complement(267144..267164)
FT                   /note="PS00092 N-6 Adenine-specific DNA methylases
FT                   signature."
FT   CDS             complement(268858..270021)
FT                   /transl_table=11
FT                   /locus_tag="SMR0299"
FT                   /product="putative DNA-binding plasmid partition protein"
FT                   /note="Similar to several including: Salmonella typhi
FT                   hypothetical protein R0042 or Hcm1.58C SWALL:Q9L5T7
FT                   (EMBL:AF250878) (385 aa) fasta scores: E(): 2.3e-104,
FT                   72.84% id in 383 aa. Also similar to many partition
FT                   proteins including: Listeria innocua partition protein ParB
FT                   or Lin2922 SWALL:Q926W8 (EMBL:AL596174) (283 aa) fasta
FT                   scores: E(): 0.078, 23.17% id in 302 aa, and to Brucella
FT                   melitensis chromosome partitioning protein ParB
FT                   SWALL:Q8YJS2 (EMBL:AE009444) (293 aa) fasta scores: E():
FT                   2.6, 23.82% id in 256 aa"
FT                   /db_xref="GOA:Q6MXA2"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA2"
FT                   /protein_id="CAE51822.1"
FT   misc_feature    complement(269410..269475)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1789.000, SD 5.28 at aa 183-204, sequence
FT   CDS             270370..271203
FT                   /transl_table=11
FT                   /gene="dam"
FT                   /locus_tag="SMR0300"
FT                   /product="DNA adenine methylase"
FT                   /note="Similar to Haemophilus influenzae DNA adenine
FT                   methylase Dam or HindIVM or Hi0209 SWALL:DMA_HAEIN
FT                   (SWALL:P44431) (286 aa) fasta scores: E(): 9e-30, 33.33% id
FT                   in 276 aa, and to Salmonella typhi putative DNA
FT                   modification methylase Hcm1.59 SWALL:Q935P7 (EMBL:AL513383)
FT                   (274 aa) fasta scores: E(): 8e-80, 70.95% id in 272 aa"
FT                   /db_xref="GOA:Q6MXA1"
FT                   /db_xref="InterPro:IPR002052"
FT                   /db_xref="InterPro:IPR012263"
FT                   /db_xref="InterPro:IPR012327"
FT                   /db_xref="InterPro:IPR023095"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA1"
FT                   /protein_id="CAE51823.1"
FT   misc_feature    270406..271146
FT                   /note="Pfam match to entry PF02086 MethyltransfD12, D12
FT                   class N6 adenine-specific DNA methyltransferase , score
FT                   152.7, E-value 4.2e-43"
FT   misc_feature    270922..270942
FT                   /note="PS00092 N-6 Adenine-specific DNA methylases
FT                   signature."
FT   CDS             complement(271212..272063)
FT                   /transl_table=11
FT                   /locus_tag="SMR0301"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0040 or Hcm1.60C SWALL:Q9L5T9 (EMBL:AF250878) (273 aa)
FT                   fasta scores: E(): 1.1e-69, 63.17% id in 277 aa. The
FT                   C-terminus of this protein is also similar to
FT                   Schizosaccharomyces pombe WD repeat protein Spbc713.05
FT                   SWALL:Q9C1X0 (EMBL:AL512943) (297 aa) fasta scores: E():
FT                   0.17, 27.04% id in 196 aa, and to Mesostigma viride
FT                   ATP-dependent Clp protease proteolytic subunit ClpP
FT                   SWALL:CLPP_MESVI (SWALL:Q9MUV8) (229 aa) fasta scores: E():
FT                   5.2, 24% id in 125 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MXA0"
FT                   /protein_id="CAE51824.1"
FT                   VD"
FT   CDS             complement(272301..273017)
FT                   /transl_table=11
FT                   /locus_tag="SMR0302"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   R0039 or Hcm1.61C SWALL:Q9L5U0 (EMBL:AF250878) (235 aa)
FT                   fasta scores: E(): 4e-43, 53.41% id in 234 aa"
FT                   /db_xref="GOA:Q6MX99"
FT                   /db_xref="InterPro:IPR001305"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MX99"
FT                   /protein_id="CAE51825.1"
FT                   NYAAITVFKLSKLQDS"
FT   CDS             complement(273014..273214)
FT                   /transl_table=11
FT                   /locus_tag="SMR0303"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Salmonella typhi hypothetical protein
FT                   Hcm1.62C SWALL:Q935P6 (EMBL:AL513383) (66 aa) fasta scores:
FT                   E(): 4.1e-10, 53.03% id in 66 aa, and to Salmonella typhi
FT                   hypothetical protein R0038 SWALL:Q9L5U1 (EMBL:AF250878) (66
FT                   aa) fasta scores: E(): 7.9e-10, 51.51% id in 66 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MX98"
FT                   /protein_id="CAE51826.1"
FT   CDS             complement(273234..274286)
FT                   /transl_table=11
FT                   /locus_tag="SMR0304"
FT                   /product="hypothetical protein"
FT                   /note="Similar to many including: Salmonella typhi
FT                   hypothetical protein R0037 or Hcm1.63C SWALL:Q9L5U2
FT                   (EMBL:AF250878) (358 aa) fasta scores: E(): 1.2e-68, 58.14%
FT                   id in 356 aa. Also simuilar to many partition proteins
FT                   including: Borrelia burgdorferi probable chromosome
FT                   partitioning protein ParB or bb0434 SWALL:PARB_BORBU
FT                   (SWALL:O51395) (260 aa) fasta scores: E(): 0.042, 25% id in
FT                   212 aa, and to Helicobacter pylori probable chromosome
FT                   partitioning protein ParB or Hp1138 SWALL:PARB_HELPY
FT                   (SWALL:O25758) (290 aa) fasta scores: E(): 0.68, 21.34% id
FT                   in 164 aa"
FT                   /db_xref="UniProtKB/TrEMBL:Q6MX97"
FT                   /protein_id="CAE51827.1"
FT                   LLEIRDLLKE"
SQ   Sequence 274762 BP; 75215 A; 61803 C; 63225 G; 74519 T; 0 other;
     atgattaaaa acaacgagtt aatccatcct tttgacgtaa ccagtaatga atcaggtaag        60
     acttatcaac tgacgcctaa ctcgtccaag tcggttcagc ccgtggccct gctgagattg       120
     agtgtattta cccctgtcgg cacaaaagaa aaccgcgacc gaaactttga agttgatgcc       180
     tctgatgagc tttcgtgtat ggaaattgca agatcggagg gttatgacga catcaagata       240
     actggtgtca aactatctat gtctaccgac tttaagtgct ggctcgggat catcatggct       300
     ttcagtaaat atggttttac ttccgagaag attagcctga cttttaacga gtttgcgaag       360
     atgtgtggta tcagttcaac aaacatcaac aaacgaactc gtgcgcgctt taaagagtca       420
     ttaatgaacc ttgcatcggt agtgcttgcc ttctcagact ctcgtagtgg tcggttcaca       480
     gtaacgcatc tggtgcagaa ggctatgatt gatccaaaaa gcgatactgt tgagctggtt       540
     ggggatcctt ctatgtggga actgtatcgt tacgaccata agacattgtt aagccttcag       600
     gttctataca ttttggctaa aaaagaagct gcgcaatctc tctatattta ttttgaagca       660
     atgccagctg gtacgttgtt cgttaatatg aaacggttga gggaaaggtt gcttcttaca       720
     acccctattc gtacgcaaaa ccagataatt cgtaaagcaa tgcgggaact tgaatctatc       780
     ggatatctcg attatcaaga agttaagaaa ggtcgcgaca tacaatttca gatcttcaaa       840
     agaagcccta agctggccct tgccaaacaa ggttgaaagc tatctggtat gcactggtta       900
     taacctgctg aaaaataagt tatttatcag tgctatgctt agtgcttctt ttactactgg       960
     tcttacatct cggcttaatg tgcaaaaaag taacttttca aacgaactcc tgactattca      1020
     tctgtatgcc tttctgactc aagcgtacat gctagcccat tcattaaatg ccgttgagca      1080
     agatggtttc gtgcgcactc tattcacgtg aatgcctttt gtggattacg cctcttacat      1140
     tcatacaaat gcttttgatg tcggtatccc aaaaattcat tcattgaaat gcttttgttt      1200
     gccactgtat cccgagcata gctatgcagt ggtataaaaa ggcattttgg tgaatggcat      1260
     taggtcgaat gacacacagt tcagctttgt taagagcgag aatggtccaa gacatctatg      1320
     acattgggca tcagaaggac tatgtgcttg atatgagatc aaaaaaatat cagaagcatc      1380
     acaactccaa tggcattcaa agaaatgcct ttgttttgtt agtacaccaa acaacccaaa      1440
     attcatgcag ttatatcaaa gactcattcg caaaaggact cagccagaaa gcatttgctt      1500
     aaatagcatt ggccaaaagc attcgaatga atgatgttcg tatggacaag acaaagtccc      1560
     actcacgccc agaggtgtaa aaggcattta gatgaatgac gcaccggccc gaggattgta      1620
     tgtagtttct ccaactgata gttgccgaac cagggagcac agtgatatgc ggccttctca      1680
     gaatcaagag atagataata agggaacaaa aaagattaga tatgaagctt agttacctgc      1740
     ccgatatcta gttagagctt ttcaaaccat caaaagtgac ttttatgctt gaggagtctc      1800
     atcagcttca ggattgagct taacgtaatc ttaccccctc ccctctttca aacttttact      1860
     aagcgttcac tggtaccttt caaagattat gctttaggcc ctttgcttaa aaattcacca      1920
     atcgctaaac gttaaaaaaa gggggtttat gcgaacggaa ggatcggaat aaaaaagtat      1980
     tattcattcg cgtttacgtg aactcaaatc tacacggagt aattatggaa ctttctttaa      2040
     atattggcct tagtgaaaag aaatctaaca cggctgcact ttttaaaaca aaaagcgcaa      2100
     aagtgatttt gtttgttctg ctgaccgtgc ttttttgcgg tctggcatat gcgggttcag      2160
     atgatggggc actgggagat atttggtcat acatgagtga aagtatgact ggagctccgg      2220
     gcaaaattct ggcagccgcg atgttgatct caagcgtata tttctctgtc cttaagccta      2280
     acccgggcct ggcactggtt tcattattca tgatgctggt aatggccaac ggcgagaaaa      2340
     ttatcagcac ctttatggat gctggcgtac cgctgtaatt tattgttaat catgcatgag      2400
     ggggttcatc cccctctctg gatttttaat gagtaagcag aacgacgttc ctcagcatac      2460
     ctatagattc cctttcagga tcaacatgcc tctactgatt ttgttttggg atgccaaaaa      2520
     attagggctt gcattcattc tggttgcatt tgggaatatc ttcgaatgct tcgggttttc      2580
     tgttgtagca gcggttgtgt attggattgc gtataacaaa gcagctgagt caggaataag      2640
     aggattgcta aaacacaaac tctggtggct cggttttttg ccaggtaaag cagtttttag      2700
     tagccgttat ttcaacgatc catttatcag agatttgtat tcttgatgga gctatgaatg      2760
     aaaatgctaa gtggcattaa catccctttt ttcaaaaaat ctaaaaagga tgaaaacggt      2820
     gatcttgaac agtcatacgt aaagaaagat gaaagtgcta agggacgttt tttggacatt      2880
     aaaaaacgat ttagcccaca agctgaagcg tcaggtgctg gaattacata cagcgccctg      2940
     attaatcgtg atacaaaact tatccgcatt aatactgttt caatagccgt cattgggtta      3000
     ttggttgcaa agattctttt tttcactgac ccagtgacga ttgttacccc tccaaacatg      3060
     aatgaagaga tcacggttgt tggtaacaaa gcatcggaat cttataaaac acaatgggct      3120
     ctctttttta gtaccctttt agggaatatt aatccaacta atatttcctt tgtgacggcc      3180
     tatgtcctcg atgccctttc acctgaacta caggctaaaa cgagtgagtc tttacaggag      3240
     cagataaata tcatgcaggc tcgtggtgtt gagcagacct ttaagcctaa tgatatttac      3300
     tttgatccaa aaaatgacat ggtctatgtc tggggtacca aaacgactcg acttgtaaat      3360
     gttccggaca aaactgaatc atcgaaatgg acttatgaat gggttctcgg gatgaaaaat      3420
     ggtcgcccaa gaattgcata tgtaaatcaa tattccggaa caccgaatat taaaaaaatt      3480
     acgataaacg gcaaagagca actggcaacg ctggataatc cgccaccgtc tacaggtaac      3540
     aagtgatgat taaaaaaaag ggcttaggct tcaacgcaat tacagcattg atcatgctca      3600
     cgacttcgaa ctgcgtaatc gctgaagaat accaattgcc agcaacaatt aataacccgg      3660
     ttgtaatgcc agttggtgct gacggatttc agaatggagc tgcaaaagcc attattccgg      3720
     gtcaagctgg ttctgaacag tcaggtgcac aaacaaacct tagtgaagcc ggtaatgcgc      3780
     agggacaaaa acctacaact gatctcccta ccgtgcaact ttccccagcc agcaatgctt      3840
     cgcctgcggt aagcgctatt actggagcat tatcaaataa tcctagtctc cccggatttg      3900
     acgcacagac ccgatctggt gcaattgata gctatgggag accaacaggt acctcttccc      3960
     agcagaatgc aaccaatgcg accgccacgt caaaagccga tgaactttat gtcgaagctc      4020
     gtaaccgata taaagaagtt cagcgtgtaa atgtgccgcc tggtgggaat gtggtactgc      4080
     cagtttcacg aggacttcaa aacagaatat cgaccagctt caagaatgct tctgtcagta      4140
     cttctacccc tgctgaagag gcaagcatat ttgttaatgg tggcgatgtc tttatttcaa      4200
     ctaataccga taaaccaatc gggattatgt tgtctgaaga tcaggtacct gaatcgacct      4260
     ataacctgac cctggtaccg cttgatgttc ccggtgcgat gatttcagtt actacatctt      4320
     taagcccatc tatgcaagcc aaacgtgaaa cctcattgga taagcaaaac tatgaggaaa      4380
     tgttggcccg ctcccagtca gaagaactgg ctccaacgga tccaaaacaa gacgatcata      4440
     aacaaagaat cattgattta ttgactcctg tggctcttgg tgaggtccct tcaggattca      4500
     gtttacaaca ggaccgactt tctcgtattc ctgcgccaga gcagtcacca tgtaacttta      4560
     atatgtatgc aaagctcggt cagagactgg ttggctcacg tgaacttatt gatgtaattc      4620
     ttgtgaaaaa cgataaacca tacggtcaaa tcgttgctga tcagcagtgt atggcagaag      4680
     gcgttattgc aagtgcttta tttgataaag catacctgca accgggagaa gaaacagagc      4740
     tttacatagt ccgggataaa ttgttcaagg aacgcgaggc ccgggttaca accagaccaa      4800
     gtctaatcag aaaataatat gggaaaagtt actttgcctg ctctgcttgg ggccaccgtg      4860
     attggttttg tcgtatttgc tttaaccagc ttttactaca ggtcagaata tataccaaaa      4920
     aggagtgtat taatcgttcc ggacgcaccc attagtatcg aagatggcag taacgctttt      4980
     cccgttcaga cagtaataat gaacgatcca actcttattg ataaatttgt aggagagggc      5040
     aatattaatg aggagaatgc ttttgactat cacaaaagta acgttttgga acctaattac      5100
     aaacatgaaa tatctagaac gagccagata gataaagctg aaatgaatca tccatctgtt      5160
     cgtgaaaact gggccagagc aggtgaaccc tatatcgttc ctcagatgtc tgacagcgaa      5220
     cgaaatctaa aaattaaacg attccagaaa cctacaagtg gagctaatca tggacattaa      5280
     aaaggcctgg gaaaataaga ccgtcagact ttctgttatt ggcgctctgc tggtagtgat      5340
     tgtttatatt attagccagt ctattttttc cacaccagtt aagaaagaaa agaaaacaca      5400
     gaaaaaagac atgcagacca atttgttgtt agatgattcg caaatgaaca aattgagtaa      5460
     tgaagaaagc cagaaagtat ataaagaaat ggttaagcaa aaccgacttg accaaaatgc      5520
     ggcgaaagag gaccgcgaaa aagcagaaaa agcccaacag gaaactaaag cccaagttgc      5580
     aagtttaact tctcaacttc agcagctgtc tcagcaaatt aatgatatgc agacaaatcg      5640
     aaacggcaat cgtaacttgg atgctggtag ttcgcgtaaa acgattaatg agcaggcacc      5700
     ggcagctcct tatcagctta atgctaatgc gccgattaat ggcgtaaacc ctaattacgc      5760
     ttctatcaca cctacgcgta atagcccaat gagaacaatc acacaaagtt ccattaagac      5820
     taatggtacc gatggtgtca ttcaggttat gcccgtgtct gaaaacagaa tcaaggaagg      5880
     cagagaggtc attgcaggag ataaagcgcc aactcggact gtacgaggtg atggtactgc      5940
     gccagttgat agcaaagcgc ggcatgctgc ccgaaaagat gaaatgtttc ttccggcaac      6000
     atctattatc actggtgttc tgattaccgg gcttgaagcg cctacaagcc tttcttccaa      6060
     atcagaacca atgccagtaa cgatgcgtat taaaaaagat gtcatcatgc ccaataattt      6120
     caccatggat ttgcgtgact gtaatcttct gggttcagct gttggtgatc tggcgtcaca      6180
     gcgtgcttac atacgtgcca cttctatctc ttgtgttaat tcaaaaggga aagcttttga      6240
     cgtaaaactg gaagcatatg ctgtaagtga aaatgacgga aaaaatggga tccgaggcac      6300
     gcttatcagc cgaaatggta acgcaattgc aggagctgca tttgccggtg gactttcttc      6360
     acttgccggt agcttaagtc ccagtaaggt atcttcactt aacatcgacc ctaattcaca      6420
     ggctcagtat cagtccccta attttggtgc acttggggca ttagccgggg ctggtgcagc      6480
     tcaaggtggt cttaatcgac tcgtcgatta ctacaccgca attgcagaac aacagtggcc      6540
     aatcgtagaa attagccctg gccgagctat tacatttgtc gttcagaccg gaactacaat      6600
     tccaacgaat ctgaccagtc gctgaggttt aaatggatag tttagaaaaa aaagaatcgc      6660
     ctgaatcagc tggacctgaa atcactaaaa aaatggtgcg agaaaggaca acaaaaaaaa      6720
     ttaccttcga aattgatatt gaaaaaatat tgaagtattt atttttcttc gcctttgccg      6780
     tattggtcat tatttatggt tataaaggct ttatgaatgt ttacgattac ttcaataaac      6840
     aatcccagcc ttcgtacaag attgcagtgc ttgacatgcc tgaattacgt aaggaatttt      6900
     tcaagcatca cggaggccgt actgctgaca atgatagatc tcaattcgaa gaatatttca      6960
     gaacattaat gaagatctac cgtgaccgtg gctatttaat tattgatgca acgcttgccg      7020
     ttactgtacc ggatagtgtt gaaatcgtca cttatatgga acttgaagat agctctgaag      7080
     cggtacaatc aagttcttat aatgcaaaga agtagagggc acccaatagt gaaaaagtta      7140
     cttttccctt taatggcggc tttcgccatt atggcgaata cggtcactta tgcttcagag      7200
     caggtcctaa ctaatagtga tgctgctgcg ttaatggcaa aggcaaagga aggtggcgtt      7260
     tcacccagtc agatctcggg tgtgttatca aaaatgaaag gatataaacc taaggatgcc      7320
     atatacattc cttctggtgg gctatacctc tttcaggacg aacgttcgca gctaatggca      7380
     gtaacgaccg atggccgata ctcccttact gggggaagcc ttgttgatgt aattaaacgt      7440
     aaacctgttc tgactgtaga agaaatcagg aattcctatt ttattagtct tgatgaggcc      7500
     cccttccctc tggaaactgt agcgtccatt cctctgggaa attcaaagct taaaagacaa      7560
     gcagccattt tcataacact tgattgtgac ggttgcatgg aacttgttaa gaaattctat      7620
     gcagatcggg acaagtatcg gatagatatt gttttagttc cctcacccgg tgagccaaaa      7680
     gaagagctta gaaggctctg gtgtagtaaa gaaaaaggaa aaataaacaa cctcgatatt      7740
     cttcgttggc taatgggaag caaatccgac attgaaaaaa gattgctctc tcaaaaagaa      7800
     gcagaagaat gtccggcgga acctttggta gcgtcattga tgctcgcagg aatttataaa      7860
     ttgcagggtg taccttcagt tgtcagacag gatggtttgg ctggtaatgg cattccaaaa      7920
     gatttcgact actggttgaa ccaaagcgtt gaacctctct taaaaaatcc atttgagaca      7980
     aattaaggct agtttatgaa catcaaaaga ttggtactca gtgctctggt tgtaggtaca      8040
     tcctcatatc ttacggggtg ctccatcggt agttccgaat ccgaatgtcc aggcattgaa      8100
     aagggcgtta tctgtaaagg tcctcgcgaa gttatggagt taactaataa tcgagatgat      8160
     ctgtctgcac tggcggggga agagtcggaa tcgggaaagg agaaatcggc tgtcaatgac      8220
     agccgttatc caactgaaat tagccctcca ggggaagtca aatatccaca gtctactacc      8280
     cttaaaaatc agcctgtggc ttattcaaaa accgaaatta agccagttgg tcagttacct      8340
     gtcatgtacg ataaaacttt aaaaatgggt gcccctactt catccattgg accacggcct      8400
     atttctggtg taccggttaa ttcaaacgta aggatgacta gcagttatag cactgcctct      8460
     tcaactggta accctttcgt tcatccggct gcggaagtcg ttaaacaaac aagctatccg      8520
     gtttctgctg gaaatgcccc acgctacgtt gcacctaatt ctgatatcag ccctggtaag      8580
     gatatgtact ctctttacaa tggccagccc gttaacccga ctctcaaccc tgggcagatc      8640
     cagcaatacc gttcgcaagg ttataaacaa gctgtagtgg ctcctgaacc acttgctgtt      8700
     ctgcaacagg ggaaagtaat gagaattact tttgcacctt ataccgatga taacgatgcg      8760
     cttaatcttc ccggctacgt ttatgtcaac gtaaaaccgc aaacatggat tgctggcaag      8820
     aattcgacct caaacccagc tcgcatagtt cctttagaag tacaggatgc ggcccgggaa      8880
     aatatgcagc agcaacaaaa agcaactaaa gctgtctctt cgaacggcat tgttagacaa      8940
     ctgtaaggtc aaatatggaa gctatcaata attacaatag cggtttaaat cgccatcaat      9000
     taggtgggtt tatccctgtt tacgatcaat tagcagggac tcactatttt ttgattgatg      9060
     gcaacagatt agggtttatg tttatctgta atccatcccc tggagttttt gataatcagc      9120
     aagatgttct tgctgaaatg ttcaaaatgg atttccctac agatactgtc tgtcaaatat      9180
     ctctgactgc attgccagac ctgactttac agcttagtgc ttggtcagct gtgcgaggtg      9240
     ggcgtatgac tgggaacgat aagcttaaag cagatctgct taatggttat cagttggact      9300
     actacgacag aagtatgcat aagcctttaa aacctgatca tgataacctt atgttgaggg      9360
     attttcaggt atggatctcg ctatcgattc ctttacagtc tgcccttcct accgagctgg      9420
     aacattcgcg tatcgattca ctttactctg aacttgtaag taagttaatt acgattggat      9480
     tgcatccgtt taaggtcgat gcagaaaact ggctctattg tatagataag gtcgtaaacc      9540
     ccggaaagaa ctcccggtgg gctgaaggtt tcatagacgt taacactatg aaaaggctta      9600
     atgaacaagt taacgttccc ggccgtaagt atacagtcac agaaaatcat ttctcatcag      9660
     tcacacaaag tgacgacgaa tctgagcatc gttacttcaa acaactttcc gttgtaaagt      9720
     ttcctgaata cgtcaatttc ggttgtatgt atgagttagt agttaactgg atgcatggac      9780
     gtaagacaat tttcagccca tttatgatca ctcagactgt tcagtttgcc gatccgctca      9840
     agttgtcaaa agaaaacgtc cgctacaaag caatcactaa taaacaggca agtatacctt      9900
     cagttgtcac attctgccct cgcctgcggg atatggataa tgactacatg gccgtaactc      9960
     gcgagcttga ggatggcgca aagcttttaa gagggtatct tactttcact gttatgggta     10020
     gtaatgccaa ttctgtgcag acagcagcta acgatctcaa atccttttac ctcgaaagcc     10080
     gggtcaaagt agcagatgat tcctttatcg ttttcccgtc atttatgtca tgtctgccaa     10140
     tgtgcaatga cccaaagaca attttcgacc ttgaccgttc cgaagtagtg agcaacaccg     10200
     gagcggctca tatgacaccg atctttgggc cctggaaagg taatacagat agaccagtac     10260
     tgagtttagt ttctcgtgaa ggtcaactca tgggacttga tattttcaag acttctgcaa     10320
     gctataacat ggttattggt gcaacgtcag gtgcagggaa gtcattctgg acagcatatc     10380
     taatcaataa ctatcttgga gctggaccgc gatctaataa cctcgttcat tatcgctcaa     10440
     catttaagca ttttttagaa aacgaatacc cagatgatga tcctgacggt gctcaagtat     10500
     ttgttgtgga cgtgggccgt tcttaccagg ggattgcgga acaatataca aacagtcaat     10560
     ttattgattt cggtaaaacc cctgacttca ccctaaatcc ctttgccttc ctaactgaca     10620
     tcactgttaa cgacgatgta tttaacgaag cacctgaatt taccggtgaa tcaacttcaa     10680
     acgatgcaga aaaagacaaa gttgctcaga ccataatggt tttgaatcag ctaaaaatta     10740
     tggcttcaga gaaaggcctt atcgatgatt atcaacaatc agtgatgctt cagcttattg     10800
     cagaagagta ccaagaatcc agaaaatcag gtcggaccgg ttcaataacc ggctttgctc     10860
     tgcgttgcaa gaagcatgaa gacaaacgta taaaggatat tggggagcaa ctcggagcat     10920
     ggtgcgaagg tggaatttat gggcaccggt ttaccgatac gttgcctcca atcaacttcg     10980
     acagcagatt tattgttttg gaactggagg agctaaaagg caccccccac cttcagacag     11040
     ttgtattaat gtctatcatt caggctgctc agcatgcaat gttcatcaaa aaagatgggc     11100
     gtcgtcgctt gttcatcctt gatgaagcat gggagtacat tcgtcctgat aattcatcag     11160
     gtgccggaaa tcaatcaaac caattcttct cttccttcct cgaagcggca tggcgtaggt     11220
     tcaggaaaac aaactgcgct ggcatctgta tcacacagtc gtttgaagat tattttactt     11280
     cttctgttgg ccgggccctg actgctaact cgccttggaa gataatcatg aaacaagaaa     11340
     aagaaagcat tgaagcaatg aaggctaata aatatttttc tacttcagat gcagaatatg     11400
     aacgtatgaa aaatattcgt acagtcaaaa aggtgttttc agagatgtta gtcaggttcg     11460
     aaaacttcca agagatctgt cggttatacg tagaccggaa aatggagctt tgttttacta     11520
     cggatagtgc tgacaggagt aaattatggg aaattcaaag ccgcgagaat tgtagctatg     11580
     gcgaggcaat agaaattctc tatgctcaag aagtagcagc gggtttggcc gcgtagagta     11640
     aatatcttca agcaaaaata attaaaccag atgtctcata agaatctggt tttttattgt     11700
     atgccttaag taaacaaatg aggttgtgac ttaatgagtt catcactgtg ctgcaaattt     11760
     tggttttata attaatgtgg tgtaaaaaca gtgacataaa tacaaatcgc agttaggttg     11820
     tgtacgcatt aagtaaacaa aatttataac ttcaatactg acattataag atgaaaatca     11880
     cgtaaattac atttttgttt accaaaggta atcaaagtag cgcggcatta ttagtgaaaa     11940
     cagatcactg gtgtcatttt gcatacaaaa cttaatatcc tttaatcatt cttctaaaag     12000
     tttatcatta acggtttggt ttctgaaaat ttatccaatt tgctcaccga agacttttaa     12060
     cttatttaac cccctttatc gccaaactgt gattttctaa tgttagtcta cagttctagg     12120
     gcccttgctc ccatgatgcg aatcctgcca cctaataaag attaacgcct cattcctgta     12180
     tgccggtctt acgacgccag tgcacggact atttttggtc atcacaagga caggcgggag     12240
     atttaatcag ggcgtggtgt tgctgagcag cagctgcggc actgtaagcc gaaggcggaa     12300
     ttaactcctt tatcaccatc tggggacgtc attatgggta gcccttttaa cttgctcagg     12360
     accattaagc taaaattccg gatagcgatt gacgtaagat ttaggctaag caggtaaagt     12420
     gatccccgct cccggggtga caactttata caaaaggccg agcggaagat tgtccttagg     12480
     gaatatttct ttaacacagc acgggcactt actcacgctg ccggatttaa cccccttaat     12540
     cgccaaactg gggttctgtc ctcatgctgg ccttcagttc tgggcggggt tgctatcact     12600
     tgctccctaa tgcgagatgt acctgctgat acagattaac gtcatattcc tgcgtgccgg     12660
     tctgccgaca ccagtgcacg ggcttttttc ggtcatcaca ttaccgggca ggagatttta     12720
     tcaggacgtg gtgtgactga gcagcagctg gggcactgtc atccgcttgc agatttaacc     12780
     cccttaatcg ccaaactggc gttcagtcct gatagtgtcc ttccgtcctg ggcagggttg     12840
     ctaacactgg ctcccttaat acgaaatgcg cctgctgata aagattaaag tcacatcact     12900
     gcataccggt ttgccgactc cggtgcatgg ccttttccga taatcacaag gacggacggg     12960
     tgattatatc tgtgcatagt atgtctgagc agcatcagaa ggcactgtca gccactggca     13020
     gatttaaccc ccttaatcgc caaactggcg ttcagtcctg atagtgtcct tccgtcctgg     13080
     gcagggttgc taacacttgc tcccttaata cgaaatgcgc ctgctgataa agattaaagt     13140
     cacatcactg cataccggtc tgccgactcc ggtgcatggc cttttccgat aatcacaagg     13200
     acggacgggt gattatatct gtgcatagta tgtctgagca gcatcagaag gcactgtcag     13260
     ccgctggcag atttaacccc cttaatcgcc aaactgggat cagtcctgat agtgtccttc     13320
     cgtcctggag agggttgcta acacttgttc ccatgatacg aaatgcgcca gctgatacag     13380
     attaacgtct cattgcccat gccggtctgc cgacaccggt gcatggcctt ttccgatatt     13440
     cgcaagcaca gatgcttgat tttttcaggg tgtaatatac ctgagcagca tctgaaggca     13500
     ctttcagtcg ctgtcagatt taacaccctt aatcgccaat ctgggatttt atgatgttaa     13560
     cctccagttc aagacccttg ctcccatgat gcgaaccttg ccacctgata aagatttacg     13620
     cctcattcct gtatgcaggt cttacgactc tagtgcacgg acaattttcg gtcataacaa     13680
     gacctggcgg aagatttaat caggcgtggt gtgactgagc agaagctggg gcaatgtcag     13740
     ccgctggcag aaaaaaccct tattcgccat ctcaaaccgt cattatgggt agtcctttta     13800
     actttctcag gaccattaag cttaaactcc gtttagagaa tgacgtaaga tttaggctaa     13860
     gcaggttaag tgatccctct cccgggttga acactatatt catcgtacga gcggaagatt     13920
     gtccttcggg aaatatttct taaacaccgc tcgggatctt attgccactg gcggatttaa     13980
     cccccttaat cgccatactg gggttctgtc ctgatgctgg ccttcagttc tgggcttggg     14040
     ttgctatcgc ttgctcccat aatgcgaaat gtgcctcctg atacagatta acgtcatatt     14100
     cctgcgtgcc ggtctgccga caccagtgca cgggcttttt tcggtcatca catttccggg     14160
     caggagattc tatcagggcg tggtgtgact gagcagcaac tggggcactg tcagcagctt     14220
     gcagatttaa cacccttaat cgccaaactg ggattctgtt ctgatgttga ccttccgttc     14280
     tgggcgggct ttggtttact aacacttact tccataatac gaaatgtgct tgatgatgca     14340
     gattaaattc acattactgc ataccggtct gccgacaccg gtgcatgggc gatttccgac     14400
     gatctcaaga acatatggga gattatatca gggagagtag tatgcctgag cagcatctga     14460
     aggcactgtc agccgctgtg agatttaacc cccttaatcg ccaaactggg gttctgtcct     14520
     catgctggcc ttcagttccg ggctgggttg ctatcacttg ctcacataat gcgaaatgta     14580
     cctgctgata cagattaacg tcatattcct atatgccggt ctgccgacat cagtgcttgg     14640
     gctattttcg gtcaaaacaa gacctggcga gagatttaat caagcgtggt gtgactgagc     14700
     agcagctggg ggcactgtca tccgcttgca aatttaaccc ccttaatcgc caaacttggg     14760
     ttcagtcctg atgttggcat tccgttctgg gcggcgttgc tatcacttgc tcccattatg     14820
     cgaaaagtgc ctgctgatac agattaacgt catattcatg catgccggtc tgccgacacc     14880
     agtgcacggg tttttttcgg tcattacaat accgggcagg ggattaaatc agggcgtggt     14940
     gtgactgagc agcagctggg acactgtcag ccgctggcag atttaacccc cttaatctcc     15000
     acactggggt tgcctcctta agttgggttt cagttcgggg tgaggttgct aactctgctc     15060
     ccataattcg tagtgtgcct cctcaagaga ttaacacctc atatctttag actggactga     15120
     cgacaacggt tcacagttag gaaacgtata tcagcacacc ggtgagatag attttagggt     15180
     ctaagcaaga aatagggtag gcgtgaagat tcattaatgg agctcttaac ttcaaagcgt     15240
     agagaaggag acaagaatcg tggtttaaac aggttgtgca ttaggtatgg actagagagt     15300
     ctgagctcac atctgcaagt taagctcaca aaaaatcata aaaaagtaaa caaacattag     15360
     cttaagattg aaactaagga tagaattgta cgcataacaa ggaaatggac gcattatacg     15420
     taaagtttac atatatgcgt aaaagtcggt tttcagtgca aaaaggtcat aaccatgaat     15480
     ttacttgaaa agatcgccct cgttggtcag cgcatgaaaa gcgagcagat ttctctaaag     15540
     gaatctctga tggcttcatc aagagtatct gtttctgatg atagtgttga tggtgttgat     15600
     agactgatct ataaccactg tttgaataaa aaaaatctct ctgatttttt tgggaagtca     15660
     cgagtaacgt tcaataaaat actttcggac ttagaagaaa aagaacttgt tggtgcacct     15720
     atttatcaaa acaaaaatca tctttacacc cgctgggatg ttcaaaaaat aatggatgcc     15780
     ctgggttatc ccaagtaccg cgatcattac tttagcagag ctattgttac tcagaatcat     15840
     aaaggcggta cagggaaaag cactacatct gtagctttag cagtagcagc tgctttagat     15900
     ctacaactca atgcacgtgt attaatgatc gaatgggacc cacaaggttc gattggaagc     15960
     agcatgattc aaagtgtctc agaagatgat gtcttcctta cagcaattga tgcaatcctt     16020
     ggaatttatg aagaaaattc tgagtataaa aaatatttag attcaggatt ctctgaagaa     16080
     gaaatcatca ctaatatgcc tttttcaacg catctgccaa acttggacgt aataacggct     16140
     tttccgacag atgctcgttt taaagataaa tactggcaat gttctagaga agaacgtacg     16200
     tctttgttac tacgtttcaa ggaagttatc ttaccggtac tgaagcagaa ctatgatttg     16260
     attattatag acactccacc tgaagattca cctttgatct gggctgctga cgaagcggcc     16320
     gatgggattc ttgtcgcagt gtcaccacgt gaatatgatt acgcctctac tacagacttc     16380
     atgcttacaa taagtgaaag gtttaaacaa tcaccaagta agggcgacaa tttaaaatgg     16440
     ttcaaagttc ttgctgtcaa tgtagatgac aaaagtccat atgaaagaat agttttggat     16500
     aaattaatca gaactgttca ggaccttttg atgtccgcta acataaaaaa ttctgaagca     16560
     tttaaggcag ctgcttccaa agggcgtaca gtgcttgata tcaaaaaatc agaggaactt     16620
     tgttccgcaa agcagcttga tgtcgcagaa gaatctgtat tacaggtata tcagcaattt     16680
     ataaatgaaa taaaaagttt ttcagctaag caaggagtta acgcatgagc gatgagcaac     16740
     atatcgggaa tgataaatct cgatatttaa acgcaccaaa gcggacagaa gtcggtcacc     16800
     gttcaggtct tgcgggtttg aaaacagcac ctcgcataaa aaagttattc actcttcata     16860
     agggccggag acttgaagcg gaacatgtga ttgttccagc ccagagagtg gagaaggaga     16920
     ccttagtcca tccagcgaac ccacgaaatc aagaagccct tacagattat tctgttagag     16980
     atattcttaa gcagattgaa gaaagagggg tcgataccga agggatcgct gtaaaaagag     17040
     atggggttta tttattaata gaaggaagtc gcagacgttt ctgctgtata aaggcagaaa     17100
     aggatctccc cctgtgggtt cttccggatg aactaaccga agatgatata aattcaatta     17160
     tatccgcagc acaaacatct cgaaaatttt catatagaga agttgggttt caatttatca     17220
     aaaaaatgga agaaaaagga ttttctacta atgaagaact cgcagcatat cttgggatta     17280
     gtcatgtatc ggtagccaaa agaatccagg cggcccgtat tgacgaaaca ttgatctctt     17340
     tattcccgga ttatgaagga atcccgaact cctattatag tcgcttgtct cgtttacaga     17400
     aatatgtgca aaaaaatcta tttcctttag atgaagtaat agataatgtt aaagaggaaa     17460
     caaaagattt agacattgga gatctccagg ttgctcaaaa agttgtaatg gaaaaaatca     17520
     cacaatctgt ggaaagtgtt tgtgaaaaaa cttattccac aaaatgggaa acaagtgatc     17580
     ttattacttt tgataacaaa gataagtatg caagaatcag taaaaacaat actggtagaa     17640
     aaattcgctt tgaattcaat aggataaatg cgggttttat taaggaacta gaggagttca     17700
     taaaagaaaa attaaaagta tcagaataaa tattgaactg catctttatg atgcagttca     17760
     tatgatttat atttttaatt tcttgttata ttaatatggg gtgtgcgcag gttcagacat     17820
     ataaggtctt agttctatat gaacagaagc gccattccca tcatttacta cgtttaaagg     17880
     tgcttttccc ggcaatgaca tagttgcaac gtcaggtcca gaaacagcaa aattattttc     17940
     tgctgaaggc attactgtaa aaatctttat agcaacattt tcatgtctaa ataatgaaat     18000
     cccaaaagta gaaccagctt cggtattgct cacgtccaca accacagggg tttttcctag     18060
     atattcatta gttagtatgt tttttactaa tgccccttcc gggacagtat agatacggta     18120
     tggatatgct aaagccgtgt gacaaaaaca tattaaaata acaattaatg tttgtttcat     18180
     agattatcct cattcaaaaa taaaagatat aactcttgaa aatcgtggtt agtaattagg     18240
     tccgcttttc cgggaaaatc gtaactaaca gaaaataaaa gcgaaagcga atcttttcct     18300
     tttgctttgg gagagattct gctaaaagca cggttaataa acataagttg atcttcattg     18360
     ttgaagcaaa gtccaagcat tccaaccgta ggaactacga atgtgcttac gctgcctggg     18420
     ggcaaaagtt gcttactacg ggcattgtaa gcacaacgac taccacctag cgttaggcct     18480
     gaaagctcaa taaaacttct ggttccattc ttggcgacaa gccaaacatc agttcctgaa     18540
     ctttcgacac gtaaagtaac ttttccgtca gtaaaggcct cacttttatt gtatagaata     18600
     gggtcaaaac caactgtcgg gagttcttcg attttacttt ctactgactg acaaccagtc     18660
     agtaatgcaa acaataaaag tgtgataact ttaatcatcc cgcttcctta gattgttttt     18720
     ggcgctcgtt ataaaagata atgattcacc ggggtagaga attgtttctt tcgtccaata     18780
     accataacca ccgaggatat tttttctttt ctcaatataa acgggttcag aaaatactaa     18840
     atgttgatat ttaggaagag ataagatttc atattttcct tgtccaacta agaggtaatt     18900
     cttctcttta ggattgatgg ttactggatt accaacactt tgaggtatgt taagtttttt     18960
     tatatttagg tcagaatagt caggaacgga cacttgatca ttagacgtat ttccgggaag     19020
     agtaaaccct ttaccctgat ccggtccaaa gatggcaatt atatctttgt tgtttcttgt     19080
     gatcgaaacg atagcctgaa ggggcgtatt agcaaggtca tttataaacg atatagttag     19140
     acttgatttt ggctcgaccc aaacaatgct ttttccggat gtgccttcgc ttaatgcaat     19200
     tttttcattt agtaagattt tatttttggc aatgatatta tactcaagtt ttggtatcac     19260
     aataaaaagt gattctttat ttgaaacatt catgatttct aagaaattgg ttttggtcat     19320
     gctggtcttt agaacaggcc tatatttacc atttataaac caccttccgt ttataagctc     19380
     cgctttagca gatataagtg aatcactttt ctgtgcggca gaagaaaaag catcttttct     19440
     atgctctttc tcttgatgtg gtgcagctgc tgcgtgaaga tgcaaaagta atgttgaaat     19500
     tgagataatc ttccaattta tcttcatctt gttacctcaa tgttgttttc aatcgaatcg     19560
     agttctaaag gataggtttt aagtgaataa aacttgtttg ttgtttgtat tagctgatga     19620
     cacaataaaa ctggattgtt cttcatgatt atttctacta atgtaagtgc tggtgagtca     19680
     gtttgcggta tacccggagc aactattacc tggtcttcta attttgacat atagagtgat     19740
     ccagtattta tatgcaaaca attaccgatc agtactggaa gattgttttg agtacgacca     19800
     tgggcttttc gaatgctgtt tacaggattc ctacctagga ccataaggtt gacgtcattt     19860
     atcatcattg gtattacggc atggtccata ccgaatagaa actggctctg aaaaatattc     19920
     acattggcat agttgaatgc ttgaagcgca ttataagtat cagtgaatga tgtgcggata     19980
     ggggcgtaat cagaagggca aaccccaatt tttatatcgc cttttagtaa aatctgcatc     20040
     atcgtaccaa gctgggtatt aagaagtttt tttacctctt cctctaaata gtaacgattc     20100
     acagctttat gccactttcc gcccattaca caccatctct cattgaggta tgtgctgggg     20160
     taaaatgttc tccggtcttt gtttaatggt aacaattttt ttaacatttc ttctccggct     20220
     ccggcagctg agaaatgcct cacaaaacgt ccatcgaaaa agccactgtt tatcgccttc     20280
     atcaattcta tgggttccgg cccatagtca aacaaatttc cagtagagaa aattactatc     20340
     tcttcttctg gctttgtaac tgattggatc aagttgcaca gcgcagagta atgtccatga     20400
     ggatctgcca gaaagaaaat ccttccggag aagtttgtaa ggtctatagt ttggacgtgc     20460
     tcagctgcca taaattcctc tacgtatgtt tacatcgatg atacggtatt tcgaactatg     20520
     atttttttac aaaaaggcgt cattttggat tctaagccta aggacctttg ttacttacag     20580
     gtaaaggccc cagtcctggc tctcaaacag ttcatactta ggatgcaaag taactttctg     20640
     attataattg gctcctttat aaacatggtt aatacatgaa tacaggaaat ttaacggtaa     20700
     ggtatttaaa atggaaggat gctgaaataa catagactta cgtatttttt taatagtgtt     20760
     aatgttgata ataggtcacc attaatgtat aaagttaata tctaatatgg tcctattaat     20820
     aaaagagagt ttttatggct gaactattaa aatctgaaag tcctgtttca ccatcagtgc     20880
     aggatatcac tgaagcttta aaaatcgttg tcgatgatgg aagtaaagct gcaaaactgg     20940
     tttgtcttaa tgaaagaaac gaattagttc ccttgcttac acaaaatagt tttgttccag     21000
     atttccgtgt tcgccatgag ggtctcaatc cttttaacta tcttattgat gggctggaaa     21060
     ggttttcgca tcacagcgaa tctagtaact cactggaatc gactgatgta tctcaccaat     21120
     acgatgaaat tagccggtta aatgttcacc atgcacttca tgcttctggt ttagttcctc     21180
     aggatgttca cctctttgtt actttaccac ttagccagtt ctatactgct ttaggggaaa     21240
     cgaatattga aaatattcag agaaaaaaag ataatctgat gaaaccagta gagcgttatc     21300
     ttgacggtaa acgctattct tttaacgttt tgtctgtgac tgttttccct gaatctttac     21360
     cagctgtgac ccgggcagat gaaattgagg atattgcttc atttgaatca agtttggtaa     21420
     ttgatcttgg tggtactact cttgatgttg caagtattac tgggcaatta gaacagattt     21480
     cgaaagtaaa aggttttgac cgtattggtt gttctattgt ttacgatgag atcagcaggt     21540
     atcttgaatc tgagaaactg aatacgagta atgcttacat tcatcatctt gttgataatc     21600
     gtcatgataa atcagctttg aaggttgcag aggacaagcg tgacggtgtt tttgatgcgg     21660
     taaactctgc ggtacagaag ttgcaaagta aagtaatcag agcggttaca caagtcgaag     21720
     agaggcctca taatgttttc cttgttgggg gaggttcata tctcatcgaa acagctattc     21780
     gtaaacattt tgaaacggct aaagttatca tggtagacaa tccgcagttc gcattatctt     21840
     tggcaattgc tgatactatt tattcagaat aatgagctag aacatggcta aaaaccctat     21900
     ctcaaataag gcagataacg accggattca gatccggtct ttctggatat ccgaaagaaa     21960
     agcaccctat gtttatagtt tcttgaaaaa aacagaactt tctcataggg gtgaccaact     22020
     ggatttaatt aggtcggcta ttagtaccgg gttggtatta aataatttat ttcctgactt     22080
     ggcaaatttt ataaatggtt taaacgaaag attaacactt gcagatctta ataggtttct     22140
     gaatgatgga aatactatag atactgaacc taagcctcct attaatgtat tgctagagaa     22200
     tgtcttagat caaaagttta aggagtattt aacacctcta caattagata attcaaagca     22260
     ggattctgtt tctgtaaaag aaaccttcct tgtacaaaag gaacatgcct gctttggtgt     22320
     gaagattgaa aatgagggaa gcgatacctc tataccatct gaaagcccac tttcttcagg     22380
     tgcatccaaa atttcaaaag aaaagtccat ttcctctgtg gtgccagtgc tagaaaaagt     22440
     atcggatgaa aatcaaaccg cctccataag cataaaatct aaagctaagg caaacaagcg     22500
     actagcgact ttggcaagat aggtgagaga cagtacaatc gacttctgag ttcaacttgt     22560
     cttaccagga aagccagcat acttgctggc cttttttttg ttataataaa ctcaggcttc     22620
     agctgaatct gtaaaattac tgttaatgaa acggtatttt aggttaattt ggatgctgtt     22680
     acaggaagtg cggatttttc ctaaatttgt aaaaaaccta agaattatct taataaatct     22740
     ggtacttaat tattatttta cgtaaaaagt ctttgtggtt taatggttat gtaaggattt     22800
     tttgataccc ttatacccga tggacctaag gtcactgaca acgatgttca tgtagaatct     22860
     tcgtttctgt aatccctttt gtccttgtcc caaatgattg attattataa taaaggctga     22920
     tcgaatgcta tctcgcaact cactaataca tggtttacgc cgagaccagt taatcggagt     22980
     tctgactatt tcagagtttc cggtagttat ggtagaaagc cacttcattc agtctgaggt     23040
     tatgggaata aaacccgtaa tttttaatat tgatgagctt cttgtttcta tatccccaat     23100
     ttcctctctt aagttcgatt gggagtgggc cccagttgat acaatactca ttgaagttat     23160
     cattccacct gtagagtcag accttgtaag tgcagaaaat gacttcctcc gtgattctgg     23220
     tattggccat atccagtgcg agcctggcgg agcatcaata cgacgtacag ttaccttcgt     23280
     tggtggaata accgctgata acttactgta tcagttgagg cttatgtgcg taagcgcgtt     23340
     aaaactttta ggagaggaac tgggggatga agtctaagat tagatatgtt ttatctggtt     23400
     ttgttgtgtt atgtgcattt gctggagttt ataaaatcct aaacaatgtt ccggttaaac     23460
     ctgacctttt ggacttcact ggaaacacat ttaaaaagac atcactcttc ctgccatgtg     23520
     ataaaagctc gccttcttta aacattaaaa ttgctgataa cgagaaaatc gtgatcaacg     23580
     gcatcgcttc aaaagtaact tttgttgaaa aggctgaccc cgtcaaaagc cctggttttt     23640
     gtgatgatct tgatctaaac aattctcgcc ttgtacatac ggcatcttac agcctggtga     23700
     tttctgaaac caaaacagga tttacactat caaatttcaa gcatcttgcc gatgatgaat     23760
     cattaggcgg tatgtggttt tatcaaaagt gactttttat atggcaactt cagacttcgc     23820
     tcttaaaaac cataatgtta aagcatttgg tcaggatgca gcccttgtca ttgagatgaa     23880
     caatgaagat gttagctcat caaaaccttc acctttttca aatgagattg ataattatta     23940
     tcttacattg cacgtcgctc caaggaacgc aaaaaaagat tatgactggg gctcaaaccg     24000
     ttctgtactt ctaaaattgt cgacgaatga agttatgcag atggcatctg tatttcttag     24060
     aatcatgcat actttaaaga ttgataagag gaaaacctca catcatggcc acgtcgtata     24120
     caaaaatata agcgttaccc caaacgagag gggcggtttg ttgttatccg cagggatagt     24180
     tccagtcgat aaagatggct taaaaccctt catgcacatg gtccccgtct cacaaatgga     24240
     ttgcgttaaa attggcctct acatacttgg atatcttgct caaaaaacgc cctgggtaag     24300
     ctccgagtct ataattaccg cgcttcgctt atctgaagcc aagaattcaa aatagcgcat     24360
     taacatacgg aatatacgga aaaatacagg tttttttaaa tgttatacga acggatattt     24420
     ctgtttttca tcgtaaagtg agtttaattt tgctcagaaa aacaggtatt cgtcatgaga     24480
     aaatcaggtt taggtttagc cctgttgttt tctttaattg ctccgattaa agcggtctat     24540
     gctgaagcga ttatgatttc aggaaagcta caggctgatc tgccagccgt atcctttgac     24600
     ccggggccgg gcgactttgt tgcatacgtt aattctaaca ctatcactgc ctcaggtgca     24660
     ggcacagcct gtaatgtaac ggttgatgat cgagcgactt cctctgttga taacctcgtt     24720
     tgtttttttg agtggttacc caataccttg ggattaactt ctaacggctt cactctttca     24780
     ggcgttccca acaccaccgg tgatttaaaa ctaccttaca agatttctta cttctctggt     24840
     tctgaacgga aaaaagttga aatagtaaaa ggtgaatatt caatcaaaag tgtggcaccg     24900
     gtaaaaccaa ctatcaccgg tcttaaatca tccctgaacg gattagtcta tgacggcttt     24960
     tctttcaaat cgtatttaaa ggatgaagcg atcaaagata tcgctgtttc tgttgaaccc     25020
     cgcaattata ttcaatacat ctcaataggt tcaggctccg cctgtgaagt acctattggc     25080
     ggaacttcct gtaccattga agttggaagc attaaggcca gtgatacaga tgaacttttg     25140
     ggttcacgtg atatcacaat tacagcaaac tctaagaata attatttcgc acctcctgaa     25200
     tccaaaaagc ttgttgttaa ctgggattat cggcctcctg tagtagacca tacactttgg     25260
     aattttaccg atgaggctaa aacaatcaaa gtaggtggcc aggacatcta taccggagcc     25320
     aaaaccgttg ctgtggccgt taaggtaccc cagcaagaaa cagaaggtga atggtggctc     25380
     ccaacagcta tgtcgctcac tatgactccg gatggcgtgt ttaagccgac gactaaagtg     25440
     actttagatg atggcactga gattgatttc aaacagtcct gggcaacccc tttacgtaga     25500
     actttacagc cggtaagtgg acctcaaaaa gtcggtgatg agtacctcta tatctttgac     25560
     ttaacggatc ttataaacgg gtcctacgca gcgactttta cagtagaaaa tacgagcaaa     25620
     aactcttcta cgtacactga gcctgaaagc aaactgatgc tgtctgataa cccaacgctt     25680
     atggttctca aagatgggca ggtattaact aaacgagcac ccgtatactt cctgaacgag     25740
     attatcgttg cagctttcca ggggcaggct ggggttgctg acataaaatc agtaacaata     25800
     gacaacaaag tagtttcgtt aacacctaca aattataaag gtatttacta cctgccggtt     25860
     ggagacgatt tagcagttaa ttcggatcac gagattactg tggtggctga aaacctttat     25920
     ggaaaaaacg taaatttcag taccgtgttc acttatcaac ctactggatt cactcttaag     25980
     aatctggaaa aaaacgtaac tctttactcg cgcgtacgtc agtatacgga cctgcttagt     26040
     caaacagctg gtgataaatg cactctgttt accacagagg aaaatgcgaa tgcttacctc     26100
     gcctggtatg gggaaaaatc agatgttaca gcatgctacc ctcagtggaa caatgtccct     26160
     gatgggttgg agttctattt taaaggacgt accccgggtc taactggatt ctttaataaa     26220
     acaggtgaga atctgctcga ctatcaagtc tatatgatta acgggaaggg ctctaaagcg     26280
     gtttccgcaa ggaatcgccg tactctgacc acacaattac catacaaccc gatcatctct     26340
     tacaaaaaga ataaagtcat agcaggcatc aatccgaaca ctgctctggc ttatacgacc     26400
     gggggggagg ccgctcgaat attagcgaag gtggtaccag ctgacgttac gatgatcgtc     26460
     tctcaaaacg gctctgaggc tgtcaaaacg tcatttaaaa atcgttcctc aaacaacgat     26520
     gcaacgacct ttgtacaaag ggtcaaggtt gctgctgcac cattgtggac aaagaacgtc     26580
     tttgacatag ctgtagaata ctcaaaggat ccagaattaa gaactacaga ccccctcaac     26640
     gtatatacgg tgcctgattt caatattcga gcatcgatgg aagtggatga caaaaaaaca     26700
     gccacatctc ttgaagtgcc cttaaaggta acagtggggc gttataacaa ctccacacgt     26760
     aaaagtgcat ttgaccgtaa aacaatggga gaatgggacg tcacgatata ctctcaaaaa     26820
     agtgtatacg gcaaagatcc agaaacaggc cgttataaaa ctacatacga aagaactgcg     26880
     ctgactgaag cattgccggt caatgatgcg ggcattgtcg aaaccaagat taaaattgaa     26940
     aatatggatc tgggtaatat gcgtctggtt ggtgtggcta aggtcagatc gccattctct     27000
     gattttgaaa tgaaacgtga gaccagtgct gtaggcattc gaatctataa aggtgaggaa     27060
     ctggagggta acctgtcgaa aagccttatt atcggaagga tcccacttag tactctggta     27120
     agcttcaaat ctgccagtac ggctaactct gatgcactcg cccccaccga atggcagcag     27180
     tcctctgata atggtcaaac ctggaccatg ctttccgaca tgaccggaaa gagaagtgta     27240
     agtatcaaaa agacagaagt aggaaagtgg ctttataggg caaaaatgac taataaattc     27300
     acatccaaga tttcctacac agatgcctta acggtagtta cctacaagca gcctaagctc     27360
     agtatagatg ttacagacat tcttcagggc tcagatatac ctgtaaccct gcttgataac     27420
     gatgaaccta taccagcagg caccgctgag gttctctggt cagaggataa agtcaactgg     27480
     gtgcagggag atacaactta cactgtggct tcagctgata ccctaccgtc tacgatttat     27540
     gcccggatgc gttaccttga ttccgatgaa ctggcagagg agtcttcatg gaaggaaacg     27600
     tctgctcggt tggcagccgc aaaacccaag cgcctttctg tctcggtaac gggggtttca     27660
     aaggtagagg ttggtcaaaa agttactttg gaaggtaagt tcacgaaccc taacagtaag     27720
     taccagaatg gtaataacgt agttgaagaa tggaaaacac cggatggcca gacatttaag     27780
     ggctcttcac tgtctgttac ccttactgag caaatgttgg ataaacaggg atatgctgct     27840
     tttgaataca gtgcatggtt agcggacaat aaggagaata cggtttctac ccgtagagtt     27900
     tctgtcaaat cgtgggttta taaatttccc gagatgaaaa taagctccaa acttaaatac     27960
     gacatggcac cgaccaccct acgcgttgcg ttgagcggta ttaaggatgg agactatcct     28020
     ggtgttactt attcccgtga atggatctac gacaaagaga atctggtaat cactaaagat     28080
     gaaggtgaca ccaaagaatt tacaattgaa aatcctggca aatatacatt gatggttgtt     28140
     ttcaaagata accgaaacaa tgaacagcgt atcgaaaata cctttgttgt cgatgaacaa     28200
     acgccaatga acgttgagat gacacccaag ttctctaaca aatatatgag agctccactc     28260
     gatgtaacct taaggtcaaa catcaagcta tctcattcgg cggactcgat agatacggtc     28320
     acatacaagg tgaacggtga agtaataccc agcggcaaaa attattgggc tcaactgatc     28380
     tcgggtttaa aagaaaagaa atacgagatt acaattgatg ttgttagtaa acttggacag     28440
     agaggttcag catctgttga gtttgatgtc gttaaaaacg cagtgcctaa ttgtacattg     28500
     agctacacgg aaaccaacct aagctggagc tttaccaata aatgtgatga tactgatgga     28560
     aaaatggtta gatatgaatg gttcatcaac ggcgaattaa ggaacgtttt cggtagtacg     28620
     gctacacttt ctaaaaacct taaccgtggt aagcaggaca taaaagtaat tgcttatgat     28680
     gatagtggag actttgcaac acagcacgtg acagttttcg gaccggctga agaggcaagt     28740
     aagtctgaaa acactgtatc aataccaagc agtgagtagt taatttttaa atataaagcc     28800
     gggacattat gtcccggctt ttttataccc aataattgga cctttgaaaa attaatgtcg     28860
     gaaagtaact ttgctccaaa ggcatctttc atggccgcta acaaagctgc gtatacatgc     28920
     tgaggaatta acattcttat aggtgaatat taggttagtt tgcagacttc cgagcgttga     28980
     aaaacatgga taatagttac ttggatagag gtgcatctgc ctagtaaaaa tattcttcag     29040
     tgccagtgag aaaaatatga gcgactacat acctaaaaag agagggctgc ttatactgga     29100
     ttggtatgtc ccccttaata ttttattgct gattctcgtt atgtgtgtct ttttcacccg     29160
     ttatacattt ggatacggtt tattgaatgg gtgcctgcct gctgattttt atatgattga     29220
     tcattcggat aaaagtatta aaactggtga actcatagca tttaacatgc cgaaatcggt     29280
     acgttttatc ccagaaaatg aacgagtcat aaaaattgtt gccggtgtgg gcggtgacaa     29340
     acttaaagta acaatggatg gggtttataa cggggacaaa ttttttgaag ctaatgcacg     29400
     tcgtatttcg aagaaataca atattccgtc cattttgatt gaaaaagaat tgataattcc     29460
     tgaaggcgaa gttttcctaa ttgggcaaac cgatcactca tgggattccc gtttttgggg     29520
     aacagtaaag ctgaattcag taattgggaa aacatatgcg atcttttaat gtaaataaaa     29580
     aatatttacc aatacttcct ggacttgcgt tatgtgcagt tttaagtaat acaaatgcaa     29640
     gcactgagta tcaacatgat gctgacctaa tcgctcagca agcaaaaggg cttggggcac     29700
     aggctaaagg tgcacagcag ccagatgggg ctcttagcct tgatgctacg ctaaaatcac     29760
     cagatgtgca gaagtacata gcgcaagctg aagcactcca aaaaaaccag gacctgagca     29820
     agcaaataaa ccgtggttac gtccccggta tgaatgcgga tagtgttcaa gcagttatag     29880
     accataccca ggctatcagg gcccaaagta ataactctga agctgtcaac gatataatta     29940
     gaagacgtga tgaaattcaa gaaaacgcca gccttaatga agcggctctg aaagctgtgg     30000
     aaaataagcc ggaagtcatg cgaggacaat ctaaaaatat cgaaaaattg tttggttcct     30060
     cgggcatcac agctgctgac ttcgaaagaa aaatggatag cacacgtgaa gaagcactat     30120
     caactgaaaa tggaataacg atctttgctt catttagctt gccggattat gtactggaag     30180
     accttctacg tacggcctca gagcataaag ctcgtgtagt tttcaatggt ctaaagaaag     30240
     gaactactcg gctaccagag acacaggcag caataaacca aatgattgtc aaaggaaaat     30300
     ttgaatctcc tttgattaca attgatcctg atagcttcag tcagtatcaa gtaactcaag     30360
     taccgacaat tatttctagg gagcaagctc gttttgcaaa aatggtaggc tccttcaacg     30420
     ttgagttttt tcagcgagaa cttgctaaaa aacccgatca ggatattttc ccggttgctg     30480
     gtaccactta tcccgttgaa gaaaagagca tcattaaaga actggaagaa cgtgcacaaa     30540
     aatatgactg ggaaggtgca aaaaaaaggg ccgtttctga cacatggaaa aatcaatgga     30600
     tggtcgacct ccctcctgcc caggaacaca aagaattttt aattgaccct acagtgaggg     30660
     tcactcagga cgtaaaagat aagcagggcc gtgtaatagc ttccgccggt gagttgatta     30720
     atccactttc gagatttcct caaaacctga cgatgataat tttcgatcca ctcaatccgg     30780
     gccagctggt atgggctgag cagcagtatc gacaacgtct gggtagtgga aaagtaatgc     30840
     caatgtttac ccgtatccaa aaagataatg gatgggatca cctaaatgat ttacgtgaaa     30900
     aatttaacgg taaggtgttt aaagttaacg aacagattat ctcacgcttt cagattaaaa     30960
     acacacctgc gcttataact actgaccaag ataaattccg gatcaccctg tttagcgagg     31020
     cagaagtccg tggtatcgga gccccaaatc tttcagagga aaaataagat gaaactcgga     31080
     tttattatag gcgctctctt tgcaacatgg ctgacgctaa attatccgga ccagatgaga     31140
     agttatttta ccaaagccgt cgactatatc gaaagtgttg caacatttat tacatccaag     31200
     tgagcatgat ggtgaaaaaa ttcaaaaagt tacttttaga gttcattgta gcagttatgc     31260
     tttcgctttc tataccgggt atggctatgg cagcagatgc tggagtccct ggggctatgt     31320
     gtcagtcagc tggagtgtgg cagggcttga ttaagaatat ctgttggagc tgcatttttc     31380
     ccatgaggat aatgggcata ggggcagctc cagaaggcgc tgctccttca cgtccgggtt     31440
     gctactgcac agatcagaac ggcgtaccgg aaataggttg gcaattgagc ttctttcagc     31500
     cggtgaagat tgtagaagtt gtaaagagcc cctggtgcag cccctttctt gaaggcacga     31560
     tgcttcaaaa atcgcagttt gatattggta aaagcaacac aaatcagcca atgacagcaa     31620
     ctgaagccgg attttacgat gttcatcttt gggagttccc aatcatgaca atgctcaaat     31680
     tactgattat tggcgagtgc actgctgaac cctatataga tgccagcctg acctatataa     31740
     gcgaagtgga ccctatgtgg gaaagtgatc tgcttacact cgtcctgaat ccagaggcag     31800
     tagtttttgc aaacccaatt gcctcaatgg tgtgcgctgc tgactgtgta gcagtaacag     31860
     caggaaagga taatctcgct gcatactttt gtgccggatg cgatggcaac ctttatccat     31920
     taaccggcca catttacgca aatgatgacg ctgtaaggac gagttcactg ataacccagc     31980
     gtcttctgac taaactacat cgccagggaa tgctgatgcg aacgatggga gcagacgcaa     32040
     tgtgtgagaa aacgtgggaa tactttacac ctcgttccca gtatcggctt tcaatgcttt     32100
     tcccaactcc tgaggcgaaa gggccggatt gctgtcatcg tcttggtgat tcggtacatg     32160
     actggtcaac ccttaaaggt gggcgcaaaa aaataggcaa tgataattat gtctatatgt     32220
     tgtggcgtta caatgactgt tgcgtcagat atataccagg cgcttgattt ctaagggtaa     32280
     aaataatgaa acttagaaaa acgatagctt caactattat tgcatcaatg attgccaata     32340
     ctatgagttg ggctttttat atctctctca taaatatggt aatgactcct cgtatttatg     32400
     cggcagacgc tatatttgac cagctcgaaa gtaactttaa tcttgctaat cctaacgcaa     32460
     atcgcaatgc gacaaccagt gctcaggaca ttgttgagaa gtacaagaat gcggattcag     32520
     gcgagaatgt cagtgggaag atcaccgaga aatacgtggg taaagccgaa tccgctaatc     32580
     ttaatctcgg aaagtatggg gcagggaact caaatgaaag tgtcatgaaa aatgccgcat     32640
     ccgatggaaa gtccattggt agcgccgtac aactgccgag tatgtctgga gggacaatca     32700
     attcaaacta taccaaggaa ggggcaaagc tgctctctcg ggatgctaat ggcaacattg     32760
     gtataagcag taatcccaat actactcctg gaaccaaaac aaataccgga gagattttca     32820
     gctcagagca aaagcacagc gatattaagt tcaatgccgc agatcgttat ggggatgagg     32880
     atggctttgt aaacgatata aagaatcgga aaagccagtt atttgatgct caaagttatg     32940
     atggcgttgc ctaccgcacc ctcgtaaatg ctaacaagga caacccggca tcatctataa     33000
     agcctaacga tcccatgttt actgcgggga gaaatgagat aacaaatgct gttgctggta     33060
     ctggaaactg gcttcagaac tgtaatgttg agacctctaa aaaaacagta accacacact     33120
     atcctgatta caaagagttc tactgtaact cgcctaagca agataacttc agcagctgca     33180
     cgataacccg tgatttttca gtccctgttt acatttcagg cggaaacgga gacatgtcga     33240
     tgtgcggcga taattgtgtg cgtatatggt ttggtcgccg tgatgacaac tactggagtg     33300
     acggggtata tgataacgaa ctgacattaa aattccatcc ggatgcaaaa ttggcctcag     33360
     caaagattgt taacgcggag tgggatgacc acatgcgggt aacacttgat ggcacgcaga     33420
     tttttgctca catagatggt gcatatcgag aaagtgacta tccggctcct aagggatctt     33480
     gggagttaaa aaaatcgtgg aaactcgaca aggtttacga tgtgactgat aaggtcagaa     33540
     aatcggtgta tgaggagcct gatcgagaag tgacaatggc atccagagta tgggttggtg     33600
     ggaagggtga agggtatttt gaggttgagc tgacttttga aaatatgaag ctcgaagata     33660
     agcacgtcca ggaaccagct ggttgttacg atgctgtaca agctccgaat acattctgcc     33720
     gtttcgatcg gtttaaagat atggatgttg gcacaaaacg gcttccggaa agcgtgcttt     33780
     cattggcaaa gcctctgtat gaaggtgata aaggatttct tacctggaag acaaaccttg     33840
     aaggctactt ttgtgatcca ttggccaaag acaaaatttg ctcttatgac gctagtggaa     33900
     aaattatgaa agacgctaat ggaaaggacc tctgttacaa ctatgaagaa ataaagagta     33960
     tgcctgatgc atgtagtgct tataaaaatg atgcagcatg tgtactcgat aaacaaacat     34020
     gtgcagaggg ttggttcgat gagggcacta acagttgcta catgtatgaa cagaaataca     34080
     cctgtgacag agggaaggat gtagttcggg aggttgaatc ttctacaaat gcctgtgttg     34140
     gcatgatccc atgttcaggt ggaacatgcg aaactgggcc aaaggaagag aacaacgatt     34200
     ttggaaaagt tgcggcttat tcaaacatgg ttcagtacat gcagggcgaa gccaaatgcg     34260
     aagaccctaa cgatgccaat tcatgttccg tctttgaagg aaaacctgaa tggtgtggtc     34320
     gttcagtagg ctttgtaaat ggcctggcaa agacggactg ctgcgaagca ccacagggaa     34380
     ccgcaggagc acttgaaggt atcatgcttg ccggatctat gatcagaaac acaaactgga     34440
     ccagagttaa tgctcagcta ataaaatgga ccggcggtga tacaggtaca tgggcttcta     34500
     tgtctaatgc ggtcggagag tggactgcat cagctggtaa aacagtaggg caaatgtgga     34560
     acaacgtcac gagctcctta acgagcgtat atgaaaacgt cgctggtaat ctaagcaggg     34620
     cagttgggtc ttccgcaact tctggagggg caggaggtgc tggccagttg gcacaggaaa     34680
     caatgtccag cttcggtata ggtcagctta agcagatggc aatgaagaaa gcctacgaat     34740
     tgctaccaga tacagttcgt gactttgtct ttaagaacgt tgctactacc ggaggagagg     34800
     ttgtcttctc ggctgcggtt caaaacttta tgcttgcatt aaacgtgatc ggttggattt     34860
     atacagccta tcaggtcact aaaatgcttt tagaaatgtt ggtagcatgc gaccagaaag     34920
     agatggaagc ttctattcat aagaatcaaa aatcctgttt tacattagat acggaacgat     34980
     gcgtcaaata tctgaatgtt ggtttcacaa agaaatgcgt taaaaaagca acagacatgt     35040
     gctgttataa ttccatgttg tcacgcgtta ttatgcaaca agcttatccg caattaggaa     35100
     tagaccctgt cgcctctaat tgcgtggggc tatcaataaa gcaaatacag caactggatt     35160
     tcgataaaat tgatctgacg gagtggatta atgatgcagt tcaggtagga gaagttcctg     35220
     atcaatattc aaaattctcc gaagaatcaa ttgtggaaaa cttaccattc cagaatgaga     35280
     actatcaact tccatcagaa cgtaccaagg aagcaatggg cggtgaagaa aatatgataa     35340
     aggccagaca agaaaatgct caggctataa aagaggaaaa tgtagattgt agctatttac     35400
     ctcgaccggc catatgtgag gtaggttcaa ctacgctgga tccggttacg ggcaagcagt     35460
     tgccgaaata ttgaagaagg ggccgttagg cccctttttt aattacttgg ctttcaatgt     35520
     tttttctggg aagccttttt taccgtattc accggtaaag aggtaataat cttttccgtt     35580
     gatggaggct gcaacacccc ctggagttgt tgtatttggg ctatcagaac ggaaaatgat     35640
     acccgaaaaa tcagcgcttg tttcgtttcc tttaaatggg atgaacacat aacgaattac     35700
     agcgtaatca ccagcgggaa ggtttagctc aggaatttcg gttcctgttg cggggcgaat     35760
     cgcctgaaag ctgtacattg aatctgtagg gaaaacatca gcatcaggct tagagggcag     35820
     atcacaggta ctccatttat tgacgactgc catatcaatt ttacatgtgg ccagagctgc     35880
     tttctgtttt tcagggttgt atccaaatga ggcctgagtt gcttttgtat gctcaaaaac     35940
     atacttagct ccctcacgta ccaaactttc atcattgtaa ggcaattttt ttggattggg     36000
     gacgaacact aggtattgat tgacctggat gtattcggcg tcagaagaac tgtacaaaga     36060
     gctgaggctc atgatcccaa aaccttttag accgcctgtt acgtagccca tcgaactatt     36120
     gatgagatac ttagaaagaa agttgtcggc atcccctcca ggagtaacct cttgctcctt     36180
     aaaattaacg tcgaaaccag caaacgaata ggcattcttg gcgacagaat catttgcatt     36240
     agcatgccag tactggccgt gactgtacgc attcagagcg gtgcctggcg tagtgccggt     36300
     gtcaccggca caacccgata gggaaaaacc aatgacgaca gaagagacca gagatactaa     36360
     acgtaaaagt ttcatttaaa gccctttttg taatgtcttt tggagatgga accattattc     36420
     catagtcacg cgtttcacaa acaacctgat tgcataaaaa aggaaaaaaa gtgatttcca     36480
     gtagaaccag cagtacacaa gaaaagcgct tttataaaaa tgtataatta ttaaaacgaa     36540
     gtaatgaggt tgaaatgggt aagccaacag aagagcaaag acctgttatc gagaatgcta     36600
     gcgcaaacaa tatggtgata gcagcgcctg gatcaggcaa atcgttcacc atgatagaag     36660
     cggttatatc gattctcaaa aagtatccat atgcaagaat cgggatggtg acctttactc     36720
     gcgctgcaac aaacgcactt gcagcaaagt tacaaaagcg attgagcaag aaggatcttg     36780
     accgggtgct ggtggatact tttcacggac tcgttaagaa gcaactggac atgattcgct     36840
     ggccgggaaa gatgttgata gggccagcac agagatctgt cattcaccgg gctttgaaag     36900
     aatccggtgt aacgatgaag tttgctgaag ctgaattcgt tattgatgct atcggcagag     36960
     aaatggatac ggatgtgatt tcagttcggc ataacagaca acagatccat ttgtttaata     37020
     cctatcaggc gttatgccag aaagaccatg tggcggacct caatgctctt tcaaaatttg     37080
     ttgtcggtca aatgcattcg ggaaaaatgc gcacgttaga tttgacacat ttgatagtag     37140
     acgaagttca ggatactgac tctatacaat tctcatggat agcattgcat acaagagctg     37200
     gagtctatac gagtatagtt ggagacgatg atcaggccat ctactccttc agatcctcag     37260
     gaggagtcaa aatatttcaa cagtttgaaa aacacttcag acctaacata ttttacttaa     37320
     acacatgctt taggtgtgaa cctgaaattt tagaggtggc cggagcactg ataggaaaga     37380
     atgtttaccg ttatgccaaa gagttacgct cggcaaaaaa gggaggggga aaggtcactt     37440
     ttcgttcata tgtagatatg gaggaacaga tacagggtat tttaagcctt ataaatcagg     37500
     atccacatgg atgggcaatt ctaagccgca ataatgctca cttggatgag ctagaaagtt     37560
     tgatcgaaca gccagtaatt cgttacggag gtaaatcatt ctgggatgaa aaagaaacaa     37620
     gcgatgtgtt aagccttatg gcctttttcc gacaatcaaa tgatcctcgc ttaatgaaga     37680
     gagtattggc attgtttgga gaacaggaat cagttttgga tgaagtggca ttgagtatga     37740
     gaggaagaaa agttactttt ggcgaccttg ccatcccgga ggacagttct ctcgaaacaa     37800
     aaacattaca ttcaaacttc gtgcgcttta cccaggaaag ttctgataaa gttgagatag     37860
     caaaacgttt cgccaacctt acgaaatgga tggaatcgtc gtcaatcaag atgaggagta     37920
     ataaaggtac agcaacctta acaaaaattg ctttagacac ttgtaaacag tgggcagaaa     37980
     agactggttg gatgaatatg ataaatcgtg ctgctgcaat gtcattaggc cctaggaaga     38040
     aggacgagga atacagccca gagaaagtag tcctatcaac cttgcatggt tcaaagggtc     38100
     ttgagtggaa taaagtaata ataatgagtt gtaatgcgga tcagatacca agtaaaagat     38160
     cagttgggga ggaggcaata gaagaagaaa gacgtttgct ttatgttgga tttacgcgtg     38220
     cagaaaagca actttttgta atgtggtatg gtgatccttc tttcttttta agagaatgca     38280
     gtgaagaaaa gataaaagaa gcagctaata ttcgaatttc tccactttat acagaataat     38340
     tcgatatggg catttactta tgcttaaagc tatagtataa aaacaatgag cttaaatatc     38400
     agctcccaaa tttgagtaac tttgcttaaa gttactttcg cgttaagcgt tgatttagcc     38460
     gtgaaaagcg gccagcttaa acaagctgta agacaccacc ggcaaaatgt cacctttgtc     38520
     gctggtgcac ttcccatgcc tgcaaaaggc aatctgaatt taccaaaccg taactaattt     38580
     agctcctcct ggggctattt ttgttgcgta cttctaatgc cagatagtat aaatcaggcg     38640
     gttcatagct tacgggagat gaatgacagg ctttgccttc gtgttgaaac gaaaatttgt     38700
     ttcttccttc ttactatata taggtgaccc caaatgtcta aaaataaagc tcgcagtaaa     38760
     gcccttcatc aaacctttag tgaaattatt ccagagatgg ataaggcgct aaacaaacag     38820
     ctcttagaag ttctgatgaa atatacagaa cgtgataatg aactgattgt tattttgaat     38880
     gaggacggcc caaatatcat tgaacttaag tctcttaagc ctgtgtcttt gttggccgaa     38940
     aagctttctg cttattcaag ctattatcat gtggatgttg tggagctcgt ggtcaagaaa     39000
     attgatttcg aaggagctta taagcttctt aaagcttccc cagatgtacc actttttaaa     39060
     agcttaactg aactggataa atatcttgtt gaggagtttg aaaaatacgg attaaattca     39120
     tttcttgacg tggataatct ggattactca cttgaaaaag ccagtgaact caaaaatgag     39180
     cagttaataa attgggtttc ggacatcatt tgcaaacgtg aaaaattaac tttacgtaag     39240
     cgttttgatg tcgcagtaaa ggcccactac gaaaatgtag aaaaaatgta tgataccatt     39300
     cgtccgttaa tgaaaaaact gggtttccca gaagatctca tgacgcacac ctttagtgag     39360
     ttaagcgttt ttgaaactaa aggatgggac catgcaataa aatcgaaaat tgagactctc     39420
     gctaagcgtg aaactcaata tttagatgat gcggctaaag cagagaatcg acgtcttgta     39480
     acagagaagt tggagaactc tttagcgatt gcaccaacta aaccaacaag aaattggtta     39540
     catattgccg gaattgcctg tttggtagtc tgcacgttca tgtatgtaac taataaattt     39600
     atttaatcct gttaaggggg aaccctaacg gggcttctct ttgaacaaat cgaggagcgg     39660
     aaaatgtcat atcttgaata tatcaatgaa gtaaaagtgt ccgggatagt tatcagtgct     39720
     gtggagaaaa aaatgactga ccagagtata ggtttgttaa taaagctcaa aaataggatg     39780
     aagacagaag ttgatggtga aatcactgag agagaatttt cagttcaaat caaggtgtcg     39840
     cctgaaatgt attcaacctg tttcactggt ataaatcagg gtgatgagtt gatggtctcc     39900
     ggttatattg ttgtcgatac tattatgatt gaagggagag aacatcctct tgactacatg     39960
     agagtggtag caacaagtaa gttggctcac atacctaaac ctctaaaagg ttttggacaa     40020
     agtagcttta atcagatctg acattaaacc caccctaaag gggagaaatc ccttcatggg     40080
     atttctcctt ttggagtccc catgaaacaa aaatttaggg ctactgcaat aagtagtaat     40140
     caacttagtt ttttttctat attcgatata gatgaagatg aaataacgca aatagttgat     40200
     tcacccaaag agcatttaaa tgatgcatac acgtccggat taaactttaa atcagatgaa     40260
     agtaacattt ctgagataaa ttatgattct gaaaggcgtg aaaatcacct ttatgaaaaa     40320
     tccaaattac ttaaaaatca gattttgcat acaattaatt ttgcagcaga aacagattat     40380
     ctatattcgg ttgaagaata taacccagat ttgggtggtc tggtaataga atggacccct     40440
     gaggatgtgt atgttgtttt tctatccgct atggaagagt ctttggaaat cattaaagaa     40500
     ctagtgttga ggagaaagtt attcttcaaa gatgacaatg gtaatatcac agtgaatcca     40560
     cttttagaag ctgaaacacg gtggtatatg tcaaaatcat ttgaatacac ttgtttatct     40620
     catggacttg atgcatgtga atttagagcg gaattaaaat catggctcta ttatcattcg     40680
     catcgttcga ttagtgaaaa cacgaaatta gctgaatgca ggaatgatga tgaaatcatt     40740
     ttgcatgatt gcaatgacga tatgggctgg gacatcttct ttgatcagga ttatttaatg     40800
     tcagaaaaaa aactggctgt taaatggact gacagggaaa ttatggatgt ttacataaaa     40860
     gcttttaaat ccacattaga gttgtttgac gagcttgttt catgtgatct gttaactaaa     40920
     cgaaacgctt ttggcaagtt agaaataaat ccaatattcg aaaatcattt tgaatggatc     40980
     atgtctgaag cttttgaaat agtgggaaat catcttggtt ataatgtgcc tcaaatcagg     41040
     aaactgatgg caactatttg ccaaatgaat ctcaaataaa atgccactgg caaacatctg     41100
     ccagagggcg gtgtttgcat tttaccggag ttaaaaatgt ctaatgccgc tatgaagtta     41160
     aatgaaacat cttctgatgc ttatgaaaaa ttagaagctc ttctttcccc ggatgttata     41220
     aagttaaaac attatgtgga taaaggtgag tatcttttag ttctagcaaa ggaccttttt     41280
     ggtattccag aaatggatcc aaagatggct gtgcctgttt tcaaaactaa aacctcgtat     41340
     cgagctccgc tgaacaaaga ctacatacca aatccccgaa tacttgaaca agtggttaaa     41400
     ctgcttatca gtccggatat agatttaagt gtgtgtctta aaggtgagtc cggttctggc     41460
     aagactgaaa tggtaatgta cattagccac atgatgaatt ggccgctgac aattaagcag     41520
     atcaacagca atattcgagt tgatgagctt gaaggtgagc gcagtcttaa tggtggtaat     41580
     acaggttttg tacacagcga tttggtaacg ggatttcgta atggtcacct cattcttctg     41640
     gatgaagtgg acaaaatcga tcctgatacg gcagcaaaac ttcacatgcc cattgaacgt     41700
     aagccctggt cactcagtgc taatggtggt gaggttataa ctgctaatgg ctacacgcga     41760
     tttattggta ctgcaaacac aaacatgagt ggaggcgctc gccggttcgt ttcttctcaa     41820
     cgtcaagatg cagcttttat aaagcggttc ttgatagttg aaatggagaa gcccgacaaa     41880
     gttgctttaa ccaatgtgct tactaaacga tatagctctt tgccttttca ggtcattgag     41940
     aagttcgtaa gagtagcgat tgcagtaaat gactctggta cagaagacag tgtgatggat     42000
     attcgtcaat tagtagcttg ggttggcacg tcgatgacgt taaaaacctt tagtcttctt     42060
     gacactttca aaatagcttt tgcttctgct ttacctttac atgtggtcga tcttgttctt     42120
     caagctatag atctttctct tggcgaagac aaggataaat cgctggagta tttcacagca     42180
     aaaaagtcga gttagatggg atttgttatg aaacctctga tatttgtatc tcagagttat     42240
     cccatcttga atttagtgcg tttttaagta cggatggtgc tgctaccatt gctatagcaa     42300
     aaaacggaac taattttact ggacttatgc aactgaataa cgactattct ttattgtttt     42360
     atcatgatgg taaaataaat atggaaggtc taattaaaga aatggaatta aaaggttata     42420
     tgtatcaggg agcaatgggc aatgatgatg ttgccgctga gtttcccggt attcttttaa     42480
     ttgcaccaga gaagctttaa tatcaaccct atcgggaaat ctttcccgtt ggggagggtt     42540
     tccccttttt tttggagaaa cccatgactt taaatacttc aatgcttaac aaagtatctg     42600
     caaaacaaat ctctgagaat tttgcaaaat catatccaga tttactggaa ggtgcagtta     42660
     taacaaaaat tgaaataagt ggctgtcaag gatcgcgtcg aaccgataaa atcgatttgt     42720
     cttatgatgg agatgatatt acggatcaaa aaagcgtatc taaaagcgaa gtacgttgga     42780
     ttgacataaa agcccttagc ttcaaaagta cgattaccag cagaatatca accctttgct     42840
     cacgcttgtg catccgctat agcaatatgt ggattttacc agtttccagt atggaagagt     42900
     ttctggaagg ggcccaagag attgaacgag agtttcaggc aggtattcaa aacgttgtag     42960
     acaattatga gatgcatatt gaggctgaaa aaaatagaag cccaagaatg tcttctttga     43020
     ttgatcagtt gaaattaact aaagatgatt tcataaaatc ctttagattt aatattgctc     43080
     actttattcc ttttacgcct attagcgttg aaggtgatga aacccaggac tactatcagg     43140
     aacaattgat aacagatctg gcagaagaag caatgagggt ttatgaaaaa attagtaaaa     43200
     ataataattt gcgctcaagt actattgacc gactgaagca aatgcaaaat aagatcatta     43260
     gcttcatgtt tatacataaa gaggcggcag tacttgcaga agctataaaa cacataatga     43320
     ataatttacc taaaggtgcc atttctgaac ctcgcgacgt tgcggtgtta cagcagtggt     43380
     tttatttcat gagtgatgct tcaatgttaa agcgtattat ttcaggagag caaaaggtta     43440
     ctgactggtt ggaatctatt accagatcat ttaatcaaag ctcacaaaca gaaccgaacg     43500
     cgctacagaa cacaggtatt gaagctattt tagattcaac aaatgtgttt caggttgaac     43560
     ctgtcgtaga gaacgatata aaaaacagca cgttttcaaa gactgattct gtagctgaac     43620
     ctgagaaatc agtttcgcaa caggaagaca atgctgaaaa tggttttgat atcgagctca     43680
     aaggctggta actgtttgct ttattaaaaa ccccagatgg gtacttcacc atctgggtga     43740
     gtaccccttt tttataaaga ggtattctat gaaattagat cttaaatcat cgccgcgcca     43800
     tattaagcgt ttacagaata tagcaaaagt cattagcggc ttaggcgatg taagagttgt     43860
     aatagacgac aataccaaag gaccgtattt tgatcctgtc aataaagttt gtgttttacc     43920
     aaacggcgat tatagcgatg atgactttgt cagtctgatt gaaggtttta cctgtcatga     43980
     agctggtcat ggtcgctata ccgtcagtga ggtttacagt gacgccttta atagtgttct     44040
     catgtcatct gaagggttta cacgcttcga tgacggaatg aatgcagagt ttgagagcct     44100
     cgctgagaaa cgtaaagctt atagcagggc aaaacgtctt accgggctta taaatctgtt     44160
     cgatgatgta cagatggaag agaaggttgg taacgattat ccggatgcaa agcggcggct     44220
     tgcagccact tacgcactga tggttaaagc cggaaggatg actcctgata tatcttctcg     44280
     tccggaaaat cctgtcctat ttattgagtg gtatctgctt aactcattgc gagtaaaagt     44340
     ccttcagcag gtaggtcaca aagaaaccct cgatccgttt tttgactatg cccaaaagat     44400
     actttctcca gtaatttctg atgttgagga aatttttcat gatgctcttg gttgtgaaaa     44460
     tactcagggc tgtgaatccc ttgctcgtaa gaccctggct cttttagaga gactgcggga     44520
     tgaggcaaag gaacaacagc agcagacaga gcaggaggag caggaggcat atgatgaatc     44580
     cgagaccgat accgataccg aatcagaaga taaatcgctt acgtcgactg atagtcgtga     44640
     ggatgattct gaggacgata gtgaaggtca ggcagatact tccgataacg ctgatcttgc     44700
     tcaagaggga tgttctgagc cttcagaact tgctgaagat aacgagggaa ataatgaacc     44760
     caccggtggc aatcccacgg gtgataacat tattgaagac gatactgatg cgattaaccc     44820
     ttccgagagt gaatcagatg aagccagttc gactaacgtt gaagatgaaa gtaacttttc     44880
     atcggctcaa tgggagatac tggcagattt gttggatgcc tttcttagca gtgatgagga     44940
     tagcgaagat tatcacgatg ctttggctaa agagattgaa ggtattgcat caaaagtatc     45000
     cgatgacgtg aaagccgaat tcggtgcttc tgaatgggat atccctgatc tccttatcga     45060
     tttgaatgtt tacaatgagg ctttgtctct gagtcattca atcggtagcg acttgtctgt     45120
     tttacagcag gttaaaatgc gtggccgaaa caaaactcat gagcgtggaa ttaccttcga     45180
     tggaaatcga ttaattctgt cacaaatggg agttcgtgat gtcttcagag ctcaaagcga     45240
     atctaaaaat agagggcatg ttggcctcgt attagttcgt gatatttcag cgtcaatggc     45300
     taatgatgaa agatatattc atgccattaa gtcagatctt gctttatcga tggccgctga     45360
     aagtttgtca aaaatgcatg tctccaatat agtttttccc ttcaaggaaa gtgaatttga     45420
     gattatcaaa acgtttgatc aaagcgttga ggaatctcta tcgaaattca ctcttggatg     45480
     taagggttat tataccccta cgggatctgc tttaatggca gctgttgatc tgttacttga     45540
     cagccaattc gataggaaaa taatttttct tataactgat ggttatccga ataaatcgga     45600
     atttactatc gtcgaagtta tggaaaaggc taaatgtaat ggaatagaaa tcgttggtgt     45660
     tggtattaag actgatgaaa taattggttt tgaaacggac actttcgtaa cagttgatga     45720
     tacttcttta ttgtctattg aagtcagtaa gctagttcat caaatacttt cttaataaac     45780
     tctacccaat cggggcaaaa aggccccggt gggtcttttt gctccatgaa ggaataagga     45840
     gcaaaatatg actcagataa aaacttaccg tgtagaacat gaaaaagtcg gtgcgatgca     45900
     taaagtccgt attttcggac gtgttggtga agttataagc aatgatagcc ctcaggaaag     45960
     aatcttccgc gaagtcacta tagcggaggg taatagccag caggctgcgt tacttgtaga     46020
     taactacata cagcgtcttg agaataatgg cttcacgact gaagcataaa tgttgagggc     46080
     ccccgggccc tctttcttaa attctgcgtt gtgggtttct ccctgtcttc tgcaccgcag     46140
     aaggcattga gaaactcaca atgccagata agagagatca tcatgactta tgcatccccg     46200
     gctcttcgtc gtaaaccaca ggaagtatct gaacacttta ttaaactcgt tcatgctcga     46260
     attgctgaag tgtctggctg gaagtatata ttcgaaagaa tacctgcttt caaagacgct     46320
     tgtgcaaaag ccccgagcca ggttccttgc ccgtttactg gcgcagggaa atcgaagttt     46380
     cgtttccgac aaaaagacct ttataccgga tgtgcgatcc ataatgactt tccggtaaat     46440
     gagttttgcg acggaattga tgttctggcg aaatattatg aattaagtaa aacgcagact     46500
     tgcaaaaaga ttctctcaga ttttttcggg atggatctgc atgctccgtt aactgacgcc     46560
     gacattgaaa atgaacgacg ctataaatca gcagttcgtg ccacagaaac tcttgaccga     46620
     gaggaagtgg caaagcgaat gcgaaaactt gatgtgatgt atcactatac cggtgaaata     46680
     aagcctaata ctcctgttgc tttgtacctc cgtaatcgtg ggatctcccg cttactgagt     46740
     cacttaccaa aggatttagg ctttaataac cggatctact attgggataa agataagcag     46800
     aaatcgatta tctatccggg aatgattgca atctatcgtg acacccgagg tcggcctctg     46860
     actatccata gaacatacgt agacaaaaac ggtgataagg cacctgtaga aaatccaaag     46920
     ctgatgatga agcctcctgc cgatatgaca ggtggctcaa ttcagttgtt tgaccctcac     46980
     tatgattcag gtagttcgac ctggacactg ggagtggctg aagggatcga gaatgcgctt     47040
     tctgttgtag aagcgacttc aacaccatgc tgggcagcca gctccgcatg gtgccttgaa     47100
     aacgttactg ttcctgattt tttactgcct ccgccggatg taaaatatat aaacttttat     47160
     atctgggcgg ataaggatat tgctaactca caaggcactc gtgccggtat cgaagctgct     47220
     cagcgacttc aaagccgcat ggttgagttt ttggctaaac gatatcccgc atcaaagctg     47280
     acaattgaag tcttcgaacc agcacaagat attcctgatg ggaaaaaggg tatcgactgg     47340
     aacgatgttc tccagttaac agggcaggat ggattcccga ttcactgggc tcctgaatgt     47400
     cttaatcagc tgtaacaacg ataactcccc cgcattttgc ggggggggtt atcttatcaa     47460
     tattattttt taaattgtat tgataagata accgctttcc ttcgtgataa ttacctgcct     47520
     ttaaggtctt ttcacggctg agatgcttgc tcagttaaat aaatgtgcgg tactactggc     47580
     tatggtcggt tgtatgacat ggttattcca taaactatta aaacccataa cgggagtatt     47640
     accgttatgg tgatgctcgt cgttttacat cggagagcat tttaatgaat tttcaaacta     47700
     acgaagtttt taataaattt gctgctgtta taaaatcgcg catcgtcaat gaaccatcgt     47760
     catgctattt gctgcatgat aatgagatag atataacgat tttgaaacat ggcatattag     47820
     aaaatgacag aaacctgttg tacgtagttc gtccttcagg aacgtgtttg ttgcgttgtg     47880
     acaaatattt ctatccgaaa tattatcttc gttgccgtgg agattataag tcattcatat     47940
     atgtccatct tgatctacat agtggtgaag ctaaagaaat cacatgggag caagcagacg     48000
     atatgctgtc tagtccagga aaacccccat taaaaggaaa tcttggacga tttgagtata     48060
     taaaagttgt ggttgaggac cttcgtattc gaggttacgc tgattatctt cctgcgtata     48120
     atcttgatga ccttcgccgt tttgccttac aggacgaccg cccatccctt gtcagataca     48180
     ttgacaatgt aatggcaacg gtctgattgg ttgctaattg atttacatat tttccctgat     48240
     ggccaacctg catcagggag gcctcaataa cgactggagg ctgtatgaag ttagctacgg     48300
     acctggtaaa agctattttg attagaaatg gtgttgaacc agtaaatata agcgaatcat     48360
     ctaaattatc tttgaaacaa ccactgacag aacttaaatt cagtttatat ttgcgaactg     48420
     agcatttatc tcacttccta cccggttatg tttattctat aaaagaatgt ccactgtcat     48480
     atgacatcgg gatcgaaatt cagaaaatct tcgaaagttt acatttgtta aacgaagaat     48540
     ttgaatccct cggttttgtt tctgtatgga tagaaatgca tcaaagcatt tttgaacaaa     48600
     gtcggtttaa gaaaagtaac tttacttttc gggaggaaga ggtcgagctt gctaaagggc     48660
     ttgtttgttc tcacaattca caaataagta atgcggctta tttctggctt cagcactttg     48720
     aggagtttat gatttatgtt cgtaataagc ttatcgacct ctttcgagag gcctatgacc     48780
     tgatccttgg aatgcagcaa gtatttttca ttcgggaaaa ggaagagctg ttgaaaacta     48840
     taagttatgg ggatgacctg tatgaggtga aattaatggc ggctgagctt tactctatcg     48900
     aacagaactt aaagtgttct gaatcgataa gtacaaaatc tcaagcttcg gcatatatta     48960
     accgcatccg tgagtttgtg cgttcggggt ggaggcaggg ctatatagtc tgccatcata     49020
     agcgaagtaa tcaaatctca tcattgtcat taccgatgta cttgaaagat acgtcaggcc     49080
     gaagtgctcg aaagcgagta aaacgtctta tatcttctac agtttgtggt agaaataaag     49140
     atttaggtct tacagatttt taattaaatt atacccatgt ggggatcaca ccccatatgg     49200
     gagtgatccc ttttttattg agagaggatc acatgaaaat tatcgaaaaa atcattaatg     49260
     cctttttggt tgttcaacat aaaaaaatac aggttaaaaa cattacattt ttagacaatg     49320
     ggcagggcat gttctctggt atgtcttttg atgctgatgt ttcactggag tttatgtatg     49380
     aatcagcaaa agcatatagt tcttgtttct gtgatattcc ctttccaggt tttgaagatg     49440
     caaatctgga ggaaattacg aaatttcaat tagatgcttt gaagcaaaga aagaatcatt     49500
     ctttcattgt taaccatttg aggtttccta tagttttaag ggaagggtgc aaaatcgaaa     49560
     gaggagaagt ctattcaatt tcgaattgca cttataataa agaaagattg cagtatcttt     49620
     tttctcagga tatttacggt aagttgtata attccttaga gaaagaatta agctcgtttt     49680
     tctcatttat caatgttgag gtgcacgagt tgttaaaaga tgctgtatgc tttgcattaa     49740
     aaatcctgaa taagatatct ttggatacac ctgaaagact tattaaagct tttaattatc     49800
     gtgactggta ttgtagttac gatgttgagc tttttaggaa aggcttacct ggtcatattc     49860
     tggaagagct cattgctcca gatatcttac tttcagacct taacggttgt agaaaaatac     49920
     ttagaaatgc aaaacgattt ctaaatggac atacaaaaac caattgtgtt tatattaaat     49980
     atgaatggtg gttggggcct gtggatacct cacactcagc taagttgatg tctgacaaag     50040
     aaattaataa ccgaagtgac ttgaagaatt tttcaaaggt ctttttcaaa gagtgtttaa     50100
     gttctggtaa gtcggaatat gaaaaccatc ttagtgaaaa agaacatgcg cttcgctaca     50160
     attattaatt aaaattattt tctcccatag ggatttctcc ctttgggaga aatccctcta     50220
     ttaagagggt atttaaatga atgcgataca aaagttagtt gaatctattc ttgttaaaat     50280
     gggttttgtt ggcgctgtag tggaaaatat atatttggat tcaaaaccat ttcggcatat     50340
     tcgatttgtg gctgatattc cagtaatatc ttttctacct catttggtga aatatcttaa     50400
     gggcgcagac catctttact gtggtaacga tgatttgcat cctcttttca tttatttttc     50460
     cgaagcggct acattaaaag caggccctgt aaatctcgcg aactttcgtt ttgaagtttc     50520
     tatagcttca actcatttac gactggtctc agagcagcct gatttgctta tcaaaggatt     50580
     taaccgggat aatctagaat acgtttatta ccgctcagat ttggcctcta aggatcttat     50640
     actaggcctt gttgaacacg gttctccttt cataaaacat ctacatggac ttatacaaaa     50700
     gcgaatttta aacgagttct ctctgatttt ttctgttctt gaaaagattt tagaaagcgc     50760
     gaagccacaa attcttgctt gcttccatag tgttgattat gaaatgaacg taaaaataat     50820
     agccgaagct atacctgaaa ctgtatctaa tcagatagtc acatctgatt atatagttaa     50880
     ttctatatca gatgcggaca agtttataaa tcatgttcgt cgctatttag caggcagggt     50940
     aatgaagagg cggatatacg ctgaattaga tgtttgtgaa gaaacatcaa atatttcact     51000
     agtgaactta ggatgcttta cgtctcctct gctcgttacg gaatatcaaa tgtttaagcc     51060
     acactcttca gggttatatc gaaaagctat aaacaactcc ttaaaacagt tcaaaccaga     51120
     aatgcatgta ccttctgaag aactctttta taattaatct aacccatccg ggaacttgct     51180
     tcccggtggg aagcacttcc tttttagtca tgaggtagtg taaatgttta aagaatctga     51240
     ccacgtggaa tttgttagtg cctttcttta tcaaaattta ggccttaatg ttcccgctga     51300
     cgatataacc gttcaattat ctgatacttc gttcgacaaa gtaacctttg attacgatgt     51360
     agatatcgat aatttaaatt gtatgttgga tctctacata tctgaactaa taaagcacaa     51420
     cgcatcttac tccgattcta ttcttttgaa acaaaaaata atttattttc ttggagtatt     51480
     taagaatttc ggatttttta cgtttgatat tcgcggatat agtaatactt taagcccagt     51540
     taaagttatt gatattgttt caatgattat taatgactgt gaagagttat ctaaagctaa     51600
     ttcttctact gatgctataa gaaatcttta tctcgataaa atgaaggtgg atgggaaagt     51660
     gttagttgcg aaatttgcac ttaaacagtt ttttcattcc gactttggtg actttatctc     51720
     atttgtcgag aaaagaatta cagattgtct taatgaaact ttaaggatta tcaaagctgt     51780
     tgaacatggc tttgtacgtg ttgggcagca taagattaat cgccgtatta atgatgactt     51840
     aaagttatgc attgatttca atactgatga ttatccggca aatatgccag atatatatat     51900
     taagtttaac gatacatttg atgggaacgg ggcgttatat tgtgacaatg atgccctcat     51960
     atccctctat accgatgttg cttcaattat caatgtgccg gtgatgatgg aagtaagatt     52020
     gatcaataaa agagggcgtg ttgtctgtga ttcttcgcat tcaacttacg tatctctcga     52080
     aagtaatgac cgatacagag taactgatcg cacattacta ataactgaag cttttgacga     52140
     ttttcgtaac gcgtctcaat gatccttttg cttcagtcca aaaaagtaac tttggttggc     52200
     tgaagacact tgtctatgac aatgtaaaat ctgtcgctgg catcttcttt tagcttaacc     52260
     aaacttttat ctaacccagt ggggaagtcg cttcccttct ggggcacttc ctctcaaatt     52320
     tgaggtagtg tatatgacac attcatctga tgataaaaac tatgtccgag cagttctgag     52380
     ctatcttggc atagattttg atgaggcgga tatagtatta agtgtttgcc attgtcaaag     52440
     tgacgagctt tcttttacct gtaatatcaa agctattgaa ctcaagaatg ctgttgattt     52500
     atatgtcgat agtatctctg agaatgaaat agaagcttta aacagagaat ctttaaaatc     52560
     tcgactctgt tactttcttg aggtgtttga cgcagtctct ggtcagtacc ttgagatttc     52620
     aggaaaacac tttgcaacta gccgttttga atatgatgat gtttgtagtg aagttcttag     52680
     catgtctaat gatgtttctc agtcgaaagg ttatgaccgg gatgaatata acagactgat     52740
     gcaggttgat ggtcaggtta tgattgcccg ttttgctttg caacagttct gggatactca     52800
     ttttattgga ctaataacat ttgtatctga gtctataaca tcgagcctct ataaagctta     52860
     tgaaactttt agtgatataa gtttggcttg ctataaactg agtgaatatt cttattcacg     52920
     ctctatcaac agtgaattga cccttaatat ttcacttaaa gaaaatgact tctgtgagga     52980
     cctatctgat tgctatatgg aagatgaggc tttaccttct ggtagggtaa tttctcgacg     53040
     caacaatgac tccataataa gtatttatga gagctatgct gcggcttctt atattccgat     53100
     gattgcatct ttggaagtcg ttgatgaata cggcgaagtg gttactgacc tctgccatac     53160
     cgtttatgtt tcagagttaa ccggtgggcg gattaaaatc cacgaccgta atgacttagt     53220
     atctgaagtt ttcgataacc taagaaattt aaatcttgca gttggagatt cagtttcaca     53280
     agctgcttga ttctttccct gattttgatt ttttctcaca tactcttatg gcacggtttc     53340
     cgtgcctttt ttttgcctcg cttacaagcg tctactcctc ttctacctat cccaccttac     53400
     atcaccactt aaaatctatc tttctaattc cattatcctt ttcgtagcct ctaatgctct     53460
     ggtatgaaca tactctttaa actcaaaaaa gtgctattaa cgaaaaaaaa tccctaaaga     53520
     gatttgtata ctgttctcaa ccaaggagag ctcatgaatg aactaaaatc caaaaacgag     53580
     aacagtacca aaagcaactt tcccccggtt gataatcagt tttgctttta ccatgttgat     53640
     ttcagcatag aacgactact ttcaacggcc gaggatctcc agcttgagta catcttccag     53700
     aaacctggaa gtgaagtaag aaaggatttg gttgagcgat tcgaacgtgg agagcgcttt     53760
     gttacagctt cacactgtga caatttctgt gaaatccttg gttgtcaagg ccatcaggaa     53820
     aatgcataaa cccataaacc tacatttcca cttttaagga tgttcactaa agaatgattg     53880
     gagaaagtat ttttgactgg gtaatttacg gaatatccat tttgatattt gcctcagcac     53940
     taattgaagg aaagacaact cgctacccag cacttttttt ctatgggagt ttaattttaa     54000
     tgttaatcct gatagttgct ggaggcctta actggtggtt ctacaggtca aaatatggcg     54060
     cagtaatcgt tatcttcaca gtggtctctt tactgatgac tcgattccgc ctggtcatat     54120
     ataaattaag attaagaaag ttagtttcag aaatcagatt tcgtataaaa acgggttttc     54180
     gtataattct tgttttgtcg gataatgagg atgagcgtaa tgttctgctg tctatgctta     54240
     gcaacgtatt gccagagcaa acgcttattc acacgcgtga tgctctcgga cctcattcag     54300
     agcctatcct aaaagctctt gagctacatc atcaacaggg aacaggttac atactcgtct     54360
     gtgaacaaca aatctcagcg cgtacgtggt tgagtatcgt agaaaatggg aaacctgata     54420
     catctatagc tgttaatttt cattcgatcc cagaaatgga gtgatttttc aatgagtaga     54480
     accgtttcac aaagtgtcac agaagattgt ctttttgata cccgcacaca agtcagatta     54540
     caactaagtc gaagcgttca taaaacgctg gcatctgcta aagaaatttt acagggaagg     54600
     ggggttgatt cggtctctat tgaagatctt gttcgagcct gtcttgaaga gaaccagcca     54660
     attgatctag cctcacttta ccttgaaaat ctcttaaaac agaaaggtac cagcatttgc     54720
     gatttttagt gttttcaaac ctattagata aaatgccggt tgtgtttata taacatcaat     54780
     aatttcatgc aacaggtaaa acatgagtac tcaaaagcaa ctttccagaa ctaccggcac     54840
     tgaacgtatg tttaaggaag agctggcgtt atccttaatt tgttgggttt tcaccagtcc     54900
     ttttaccaac tggaccgata aagtcttcag tggtattgaa gttccgtctg aaggaccgtc     54960
     atcattacgg ggtgagacag aaaaattctt tcgttttgtc gttaatgaag aaggctacga     55020
     cgcaggaagg gctgctattg gtcttgacct atgttgtttt tcacttccgt tgtgtttgtt     55080
     cccggacgct gccctgtctg aggaagaggt tatgagtaag ttaaccggag aagttatcca     55140
     tggaattctt ctttccttac ctgagtttat tgatatgcca gaagtgctcg cttaccaggt     55200
     cagggatgaa attcttgctt ttaacactcg ctgtggagac gggatctttc atggttggaa     55260
     cacggcttca gaattgtgga agtttgaaat ctttccccgc accaccatca tgatgcagca     55320
     tacttcggca atacattaaa attaggcggg gcagaatgca taaaaaactt tttcttctcg     55380
     aatggaaacc ctgtcagagc cgcgtatggg ccggttggat ggccctgtgg ttgactatca     55440
     gttttctgat gttatctgcc ttgcttatga cagatcatct cctgaacaaa gtcatcctgc     55500
     cgccaacatg gttgttgatc tggttttcgc caatgctggg gtttttgata aaagttcgcg     55560
     tcgtcgaaac tcaacatttc ctggagcatg acctctgtgt tgcaggtttc tctttttacc     55620
     gctggaagag gttagtttct cccgggcttt ggtcagttga ctgtataaat ggtcgttttc     55680
     gcctcaatcg gatcacccag gtgggtaaga ctatccacta tccatggcgt ctccattatc     55740
     atcctttgtt catgagccct atcgaacata aatcgcatgc tgtgaaagct gtttcaaaat     55800
     gacttcttta gaggtttaca tgacatttat gttctgcaag gtcagcctgg gcagcaaaat     55860
     tgattggaaa taacatgagc ctggagaaac gtatgagtta tgacgatttg ccctattttc     55920
     gtgaccagat tctggaacgc atcgactcgc tcaagtgttt tctttcgaac acccccccga     55980
     tgatggcaaa cctgatgact gtctccaccg tatctagaac agaagagcgc ttgaagcagg     56040
     ttaaacccat cagggttagt attaaagacg atgcttcggt tgaggaaatt attcaggcac     56100
     ttactgacat ctgtgtggat gacatagagt cattaagtca tgattccacc aaagtaacca     56160
     ctaaataccc gggtctaatc attgtccccg aaagagcaga tcttctcgaa agcttgatca     56220
     cttctataaa cgaagcaaaa aatgattttg ctgcggcaat gaggcgtatc gataataaaa     56280
     agaatgtccg ttttgataaa gtgcacaaga agctcccggg ccttgtcgct atgcactcaa     56340
     caagaaatat ccttttcatc aagtcccagc ttaaaaaagt tactttttca tggcggctaa     56400
     accgaaacca ggaagttaaa acagcagagc aacttgtgag tttgttggag cgcaggagag     56460
     cctcagaagt aaaaaatgta gcaactacca atttgaatgt cgtgtctaat atcgataagg     56520
     ctttacaccg tcttgaattt cacccactga agcagggcga atcttatcgc ctttgtcgaa     56580
     ctaactcttt ccctgttccg attgctcaca tttttgcatt taggcctgaa gggcaggaac     56640
     gaaacgggaa taaatatgct gagactgatt attcagtagt aaaagcatcc ttgcccattt     56700
     tcgcagcagg caacatacct caattaaaaa cgctctctga ctgggctcct gaaaacagcc     56760
     agggtccgtc caaccaacgg aagctgagcc tgaaatatac agaactcgtg ccgggggctg     56820
     agctgggcat tttcattgtc agccccgaaa attaaggaac aacaatgcaa tggatttcca     56880
     cagccagcca gaaaatcgat gagcgtctct atcgtgtctg cgtctgggta aaaaaatatc     56940
     acgctgatgc gattaaccgc gttgtgctaa ccgttgatct aagtaaagcc cgacatgacc     57000
     ctgacgagga ccaggtaaga gcagagctgc tgtgcggcca ttattttttg cttcgtaagg     57060
     aaaacgcttc gaactctgcg cctgacgatc aaaagtttgc tttcctgcct gacgggcgca     57120
     atctgtgttg gcagaccgca accccggtgc ttcagcatct cctactcaat aaaaacgttc     57180
     ctgagtcgct gaggttgctt acggactaca tacatatgcg tctggccagg ctgacaatgg     57240
     tacctatgtc cggaaccatc atgaacgagg ctctgctgga cagcatcagc tgggttaagg     57300
     tggatttgac ctacttctgg cagtacgaac agctcagctc tcatctggga cccatccaga     57360
     taacccacaa ggcacttgta cgcttcgggc acctggcaaa gaatgatgaa aactccagtg     57420
     ccataagaat tctgcgtcag cgtctgtctt cagaattctt acaagaattt cagatggctg     57480
     aggatgagct aaagcgcaaa cagtcgttga tgggcaccat ggacgtgaaa atgctgtttc     57540
     atgctcatta ccccagccag aagatgctgg tggctcgata taaaaatggt tgggtaatgg     57600
     tggattgttt tctgtttcac cataccaaac ctaagaaaaa agcaaaaaac aaaactactg     57660
     tggctaagcc tcaacttaaa cagactaaaa gagaagggag tgaaaatgga actgggcatt     57720
     atggtgtgca tcgtgttgtt actctcagtg gcggcggcgt ggatcagtaa taagacagtt     57780
     gatttgctcg aaagattcta tttcaagcgt ccgctgagca tggagtacgc ggcatggcta     57840
     cgtgtaatgt gtgcaggctt gttattagtt tttattcagg ttgctcccca atttacactc     57900
     ctgtataccc ttaaacttgt cacgcttatt aatcttggaa tccagacaat gaaattaaat     57960
     ggcgtgtaca aatataaaag gacgggaatt ttgcctccgg gaggggcact ctctaatctc     58020
     accagactta acccgttcaa gaaaaaataa agttatgcgc ccgtgagggc gctattcatc     58080
     aaaggcattt cgcataagct tgatcatggc ttttttacca gcttcaatat tgcgaatgta     58140
     gcgcataacc atttcttcat tcgaccagtt ccccatttcc ataatctgtg gtagcgagta     58200
     accttcaata tccagctgta tcgcaccgcc tacacgaacg ctgtgccctg tccagtaacg     58260
     ggttttagtc tcatttggat aaagctcatt ccacatttct ttaaatgccc gtaaaaggga     58320
     atttttgctg agcataccgg catcgtccac agtgtcttcc tcatcttcat cgttcagaag     58380
     actttgttta gcacggtagg gcaggttatg ccgtttaaga agctcagata gctcattccc     58440
     tttactccga agcttccagc cgggtggcat atagcctgta tcatggaaat ttacggcctg     58500
     gaaaaggtat tcatccggat gactgtgctg atccattttc acaaggttca tcaatctcaa     58560
     gaggcagtta gttaactgac gtgtcagccg gtaggtaaga agtgtactga tgttcgtttt     58620
     tgtacggtat accgtcaggt taaattcacc ggtcatacta tccagagaca gatctttcag     58680
     acgtatacgg cgaatttcgg atgaacggag cagtgtttca aagcctgtcc agatcaggca     58740
     caggtcacga agcttacgaa ctgagtttgt agtactgcgt aactttatca gagccttgag     58800
     atcgccaata agaaagggag ttgcctgttt agtcgtcttt cgcttccggg cttccgattg     58860
     ttttaaggct tccagcatgt accatgcttc agacgtaata atcccgggca ggttaagccc     58920
     ttttttatgg atactgttta aggcctgaag acagctgttt atgctgcttc gtgacaattt     58980
     gccttcaaga tgccccataa acgccagcag agcttcctca gacacgggga gcgaacttac     59040
     tggccagtct gtatgcaacc gggcattcgc ctgataccat tcgttccata ctcgtagcca     59100
     gtgcagatag gttttagctg tgttgtatct cagatgggaa aagtaacgga tcaagcgtga     59160
     aagctgttta tcatggttgc cgaacgtttc cagctgctga tgcaattcgc tttccgaaaa     59220
     ctgtctgatc actgattgat tcttcatcct gctcaccggg atacactggt tttatttaca     59280
     gtcattttag cactcatgta cctggttatg aacagggtgg aaacaacgaa aaaggttgtg     59340
     aaatcgttag gcttaagtga aaaatgatat taagattatc cctggccagt tgaggcctgt     59400
     ctaaagaagg ttgattatgt ctgacacaaa gcagtcttat ttaatgaaat tccgtaagtg     59460
     tagttcgttc gaaacgctcg aaaaagtatt tgaaaggtta tgtgaaaaaa actcgggtgt     59520
     cgcctctctt gaaatttctg gtgcttatga tcatcgtaaa gctgaactga caatgaaaaa     59580
     gttatatgac aaagttcctg cgagtgtgtg gacctttgtt cgcgagtaat tattgatatt     59640
     ggcacaacaa aaagactgtg tctggatttg aaaatagttt atgccccttt cggggctaaa     59700
     ggcactgtaa tagcctgtct ttttaacttt cttattaagt tcggagaaag actttaatca     59760
     taagccaagc ccactgctaa atacatccga tattctcctt aattttagaa gttgtgataa     59820
     aagttacttt acctaaactt ctctctccat atttgtaagg ctctcatttg attcttgtca     59880
     aacattaatc tggaaaacta aaaaatcatt tcttttaatt cgttttacag aaatcctcct     59940
     ccgttatttc ggatatagtt tgaataatta tcaaaaacgg ggtgcagcca tgcgtaagag     60000
     ttacacattt ggtattccat ttggactcca gagagaatca ggactctttt tagatattac     60060
     agaggtcagc cggggtatcg actgtaactg catctgcccc gcttgcaaaa ctgatctgtt     60120
     agcaaagcag ggggaggtca agctttggca tttctcacac agtactgctg tagccggtga     60180
     ctgtgatggt ctgatggaag ccatccgggg aaaaattatt gaagtcatca acgagcacca     60240
     ggttcttggt ttcccaaatc ttctcgctgg cgacgatggt gggccggttt cactgaatga     60300
     ggttattgga agcggcagta tgttcggagg cacagctgat ctgttcgtaa aggttaatga     60360
     tttatgtgtg gccgtctttc tggacaggga tcgtagcatt tctgcgaagt taacctttga     60420
     ccaccttcat ccttccgaaa gagttgccgc attgcgtatc gatcttccag atattgaata     60480
     tgaaatcagt caggtgcagc tcgggcgacg taaaacaaca tacagtgagt gcattgaaag     60540
     cctgatcatt gatgagacca gttcccggga atggctatat catccattaa tgcatgaact     60600
     tgaatctgaa cctcttcagg agtatcgggg acgggagcct tcagaggaag ggcctcttct     60660
     tcagcgcctt gctgactgta agatgaaatt gcctgatatc cttccgggca gtcataacgc     60720
     gttagtcagg ttacagcagg atacgattgt atgtctgtgt cggttaacgg ttcgggctta     60780
     tgacatcgct cagaccgatg aatttccttt gttccttcgc tatttcaggt tgcactgcct     60840
     ggaaaacagc gaacatgtca gttacgaaag actgatctgc tggcaggaaa tgatttcaaa     60900
     aacccaggaa ggccagtcct tgacacaaaa cgaacttgaa tatcttcatg agattgtccg     60960
     catcgcctta tacaatcacc ggcttaacaa tgtcagtatt tcagatgtta aaaaccatga     61020
     cacaggaaag gagagcggca gggtagagcc acaaaactat tcactcttat aaataaattg     61080
     ggctttgcgc attaaaccct tgccgcagga ggtgtaccgc atatccggca cagacagtca     61140
     gtttttctgg cagcttaaat ttgacacagc ttaatatagt gattcattaa acaggttcag     61200
     tatgctgcca gaacgtttta gtcgttatgg gcgtccgtta gttttctact aactgaacga     61260
     cgaccagcct gccgccttcc tcctttgaca gaacaaactg agcgttattc gtcagttcaa     61320
     ttttttcccc aatggcaatc tgtcgtttat ccggtaatga cataagccca tttatgcctt     61380
     catttactaa ccaccactga tcgttatgga aaacaaaata cccaactcgt ttcctttgca     61440
     aatcggttgt acgctcattt ggcgcaatga ggcgattcac atgccacgca tagattgact     61500
     gcccgctcca caccatcaac cggtggtcgt caggacgata actgccttcc tttcgggaag     61560
     aatataaatt tagaaccggt aatttaccct tgtatggcgt accgcagtag ggacaaaccg     61620
     gctttgtctt acccgagaaa acgtaccatt tctgttcaca cgccttgttc tggcagggct     61680
     gtatcagatc gactgtttta accagggcgc tttcccactc atcggcggtc gggcgtttag     61740
     tggcatcgtg taagccatct ataaaggcgc gctcaaacaa aggtgtcaga taagggccca     61800
     tgatggtgta aggaattttc tccgggtcag cccagggcag tgaaaaggac gatagctgac     61860
     tgactttgac tgcattgctt ttgtctgtcg gatgttcaat gaagagtgcc ttctcaccca     61920
     tagataaggt ctcatcacgt acttcatccg acatgtcatg tatttttccg ccacgtagcg     61980
     gatgacggaa gaacagatac atgtagataa gcaccgacag cgcatgacgg tcagtagtaa     62040
     tgcttggcaa tacgcggttc ggatcctctt tggaaagatg actggttttc accacttccg     62100
     gagcgataaa atccggggtg cccaccacgt cgggaggata ctttccaggg acaaccaggc     62160
     cgtctacgtc aatgatgcag gcatgtccca tttctggatc gataagcacg tttttatagc     62220
     ttagatcgct gtgacagaga cctgccgcat gcatccttct gacggctctt gtcagcagca     62280
     gacagacctt gagataggta agcgtattgc ctcgttcacg tgggtcgaga aatttgttct     62340
     ggttgctggc gctggcaaac catttgcctt ccttttcacg accttttatg ccaagaaaat     62400
     catcgttttt agagccgtat ttaaagaaaa agtagctttt gtaggttgga accacgatgc     62460
     cgattttatc cccatgctca acaacatggg tcggccagca aaacaggtcc ttccagtatt     62520
     cacctccgga ctggccaaaa atgttttgcc tgtagcgtcc ggtgatcata tcaatccgat     62580
     cccgggcctg ctcgttctgc ggtttatgat aaaaagcgac gacgtatgat ttatcaggcg     62640
     aaaagtaaac atccttcatc gagcccgaac caattacctc gtcaacatac tggactgttt     62700
     cgccgtcctt tgttttgcac gtaacgatat ttgccatatt gatcaccgaa aaagcgtatc     62760
     ccttaccaca acaccgcaat agtgcggtca tcatggttcc ctgtggagaa aaagttaagc     62820
     cagtcgccta acctctcagg cgcaatactg gcgtctgtaa ggacagggtt gagctcatca     62880
     acgagacggg tccatttttc gtcactgcga agcccattat ccgtctcaaa cagagggtct     62940
     gagacgccgt ctgtcatgag gatcaagtga gatacatcat tccatttacc cacgctgatg     63000
     cggccgctaa acgaggggtc tgcgataatg ctctggtcaa ggaaacgggt ttgtcctgcg     63060
     tattctccgc tatcgggatt tcccagtatc ctgactttac cggaagggct gtatgcacct     63120
     atcgcaccat caccaagcca gaatgcagcc gcaaacagct cgttatcagt tcgtagcgct     63180
     acagttgcca gaagggttgt tgaataggat ttcacaggtt gttctgcaca aatggcttcg     63240
     ttctggatac tgttgaccgc gagcgtagct gcctgtttaa aatgatgaag catggcgttt     63300
     attgttgcct gctgatcgct cccttcccac gccgtgatgt gctgctttaa atggacgcct     63360
     ttcacaccac tgagctgatt taaaaggtaa tcgccagccg ttttgactgc aatccgggag     63420
     ccttcccggg aatttaccgc actaccggct ccgtctgcga ccagcatgac agaccatcct     63480
     gtttcctggc agtggttgat gtagaagtcg tcatctctga agcttccggc atgctcatga     63540
     gagcgtcccc ggcgactggc ggcagcaata cgtatatcac ccctgaccag gccagcagcg     63600
     tccagatggg acttagggta gggagcgtct gctggtggct ctaccacctt ccacaggctt     63660
     ctcggatcgg gattgattat aaatagctgt tttgtttcac attcgtcgtg cgacgtgcat     63720
     gaccagatta ctgaaagctc tatatcgccg ctttcggtgg gagtacctgt cagcaactcc     63780
     tgttctttgt caaaagacag gccaatgttc cggggaaaga caacgtccct gacagtagcc     63840
     tgctggccct cacccagaac gatagcaacc ggcgaagaga aacgttcgcc tgcgcgggcg     63900
     ttggggatcg ttattttagc tctcggggga acggcaggtg gcacagctaa gctggcccgc     63960
     tgctggcctg tcggtatctg cccgggtttt aataccaggg aagacaggtt ttcgtcttcc     64020
     ctctgtgctg gtttatcaaa ttcgtaataa ggcatcagct tccagaacgg aggatgaggc     64080
     tcattttctg gcaggggttg cagtgctgat gtatcggtag cgtcaatgcc cgggttatca     64140
     gcaacactta cgaccgtttg ttgctgatcg gaaagactgg atgctgacga ggcggcaatc     64200
     tctgcgtcgt tatcaccttc gctaacccgc gcagataaac cctgtgcaag gctctcaatc     64260
     cgctctttaa gccgcataat ttcttcggta agggatgggt cctgcgatag aagtaaaagc     64320
     cgctcacctt caacagggtg gcccagctca gacagaacta agcggataat cttctcttca     64380
     agtaaagcat tttgcgacat caacctctcc ctctgtttac gtcgaagtta gtgtttccgc     64440
     catcattgct gaatgacagg cctgtttcac accacgggca gatcacgtca tccgggccgt     64500
     caatacacag caactttccg catgagcaca gggcaaacgc actggcatta ccgcagtggg     64560
     ggcaacccgg tacgccatgc agttcgctgg tatttacctg caaaccggta gcggtggcat     64620
     ctgaccacgc aaaatagtcc tcatcgatgg gatagcatcc ggcaatatta aagctgttca     64680
     ggttcagact gaaatcgagc ccggaaaccc ttgctggtgg ccgttcatac ttcatcaggt     64740
     acggacgacg ggtcttgctg caacggccgg taagcgtaac gcagttttcg tcgtacgctt     64800
     ttactggctc gtccttggcc agccggacta tgtattcagt ctggctgagc tcaggttgtt     64860
     tgtcgtcccc gacgctgcgg ctgtgcgccg taaccgaggc cgtgatccat ttgatgaagc     64920
     gggtaaagtc cccttcctga gattcggtga acagcatgac attctctgtc agttgccgca     64980
     ggatattcag gtccgctgac ggccccaggc caacggcaat gagattcact ttactcgcgt     65040
     agtgatcctt ccagcgcttc acttctgcgg ttgtgtcgtc agtcggacgt ccgtcggtaa     65100
     ggagatacac gacgggtttc cagtcgcctt tagcctcatg agtggttttt ctgacctggg     65160
     tatcaatttg cacggtcagc tcacgcaatg cagctccaag gctcgtaccg ccgccaacgg     65220
     gaaggcgggg agggtagaac gaggcaattt cgtgaagagg tacaatcgta cgggctacac     65280
     cggcaaatgc gattaccgag acccaggctg tttcaagtgc gtgtggatcc tttcttaaat     65340
     ctccgacgat catttgcaga ccatcagtca tttttttcag gttttcacca atcatggact     65400
     ctgaacagtc caggacaaaa aacacgggaa ggcgtctcat aattttcctc gtacggctgg     65460
     tacggccagc agaaaacgtt gctgtacaga aaggtgctgc ccggaaacag cacctttctg     65520
     tctgtcagag caccagctgg atttctggtg gaggaggggg aagggtatca gttccgttat     65580
     taatccccgc gcttgtgctg ccggaagaca cgctggccga tacccattta aagaaacctg     65640
     caaacgcggt tgaatctagc gtctccagag acacaacctt atcggtgagc tgttttaagt     65700
     gctcatggcc tgctttagga ccaacggcgc aggcaatgat ggatccgaat ccccggccgc     65760
     gaatcgcttt taccgcttca ccgtacgcca gggcatcaga aggggttcca tcagtcatca     65820
     ggaataccag aggacgccag tctcctttgg tatcaccatc tgagcgacgt acatcccgtt     65880
     caacacactg catcagacat tcaagggcag caccggtgaa cgtcccgcct gcgcttggca     65940
     caacgatgtc agaaaactgg aagtcttcca gcggcgtgag aggaatgaac tcacgcgcct     66000
     cattgtcata ggtgataatg gagatatgaa cgctttcgag ggcgtaggga tcctggcgaa     66060
     gagcgctaag catcgcctga attccaacgt taacggaatg gattgactca ccgcgcatcg     66120
     agccggatgt gtcgataaca aggtaaacag gcaggcggcg catcacatgt aattcctcag     66180
     gtgcgagaca aacgaatctg attctgaagg ctcaccaatt gccctgagtt tccagcctgt     66240
     agcctcgcgt atcagctcgg caaagaccat ggagcgctgg ctggcgaagg cgggtccgcc     66300
     agaaagatcg aatcgtgcca tttcaatatt acgggcatct actgcccgga tgaaggcatt     66360
     ctgaacttta ccaaagtgct gctggagctt ttcaccattg tagatctgaa cgatgaacac     66420
     aattttctcg tactgagcgt caagggaatt caggcgcaca ataatttgct catcgtcacc     66480
     gtcaccggct ccggttcggt tatcgcccgt cagccagata ttgcctgact tatggcgaag     66540
     gctgttgaaa aagatgatat cgccattcac aagcgttggt ttaccatttt ccacattgcc     66600
     gagatcggtc acctttccgg ctgaattaca caggaaagcg atcacatcaa ggtcgtattc     66660
     ttcttctttt ttaccaaaga tcccgccgag aaaacctttc ttttcctcat taatatccca     66720
     accgaggccg atagtaacgg acgagagatc gtattcattt tttttcaggc ttacgccctg     66780
     gcctttgctc agactgacag acatgatatc cccttaatca ataaaattat aagaccacat     66840
     ttacttctgg cggcggcggt ggcaggtctt caagaccgat cacttctttt ttgctggact     66900
     ccactttctg actgcctacc gaaatgctcg cactgaccca tttaaagaaa gctttaatcg     66960
     tcgaactgtc agctgtatcg agctgaacca cgatttcagt gatttctttg aggacgctgg     67020
     tatcggcatc atgcccggct gcacatgcca caacaacgcc ggttctggcc gctttaaagt     67080
     cattcaggcc tttacgccag tcatcattcg gacttccatc cgtcatcagg aatacaaggg     67140
     gacgccagtc acctttagtg tcagccgtcg ttttctgtac ttctttggca atggagctgg     67200
     ccgtgaggga aagcgcttcg ccaagagacg tggtgccgct ggctgttagt gctggcatct     67260
     ggaaactcag gaggtctgtc agggggactg cctgtcgggc tgaagaatca aaggtgatca     67320
     ctgacacgtg agccgtttcg agtgcatacg gatcctgttt cagcgtggta agcagcgtct     67380
     gaacgccatt tttaaccgct tcgataggct ctccgtgcat agagccggac gtgtcgagta     67440
     gcagatatac gggtaagcgt ctcaaatgta attccttctt aagagatcgg aagaggagag     67500
     tagtttcagg aagaggccag ggtttgttga tttgataaaa cggcacgaca tctgtcgggt     67560
     ggagattaaa tactcagaag cggcattaaa gaaataagtt aaccaccata gaattaccga     67620
     catgtgaatg gcctcttatc aacagaaaaa taattcagac cggactggaa tataagattt     67680
     ctgaaaaaac tcggacaaat aaactgtctt atgtatgaaa ttcatcatac atcacagatc     67740
     tgcatgaatg gagtgtaaaa cgcccaaaga ttgatgtgta gcacaagagg atgtcaagac     67800
     accaggtttt gtagtcagta aggcgctgct ggcattgcgg gaggagaata gatcaaaact     67860
     acgtcacgcc aatacagagg taaaatatga caaaaccggg gttttcaccc cggtctgaga     67920
     tttagcgtca ggacttttta gcgctgtatt cttttatcag ttcgtcaacg gagtgcagag     67980
     ccagcttctc taccgcttca cttcgggtcg agccactcag cgcagccaga cggtcaattt     68040
     ttcttaagat ccgcatgcgt agcgataagg acacggctgt ttttttatcc ttatcgagta     68100
     cgaccttccc tgtagactca ccggttttca gttcagcatt ctgtgcgagc gcttcattca     68160
     tccggcgaag ggtcttttta tccagctggc ccggattaac gagatggtag gaatgacctg     68220
     ccttgctgta tttgatctcc gcagaatatg actcgcgtag ctctttgagg gcccgggtta     68280
     atgtcggctc tgagcattcc agactggtta taatgtcggc agcggaaacg ggcttgccgg     68340
     tgcccagtaa gttggcaagc ttaaaaatcc gggcctgtct ggtatttaat tgcatcgtaa     68400
     gatttagcct gcttaaaggg ttagtggttc aataggctga aaaatgaagg tactgctcat     68460
     ctttcgaata accgggtgat cgcctaacgc ttcaaccgga tcaatgtgtt ctatgcctgc     68520
     aaaatttact gacgacatct ggctgcgagt gcatttgcag gacaggatat actcatcctc     68580
     cagatagccg gtccgcttac tgacccgttg cgtaaagcct gacacaatca cgttgtcgaa     68640
     aggtagcgta tgtaaaacga taccgaccag gcggaacaag cagccatgga cgtggcgggc     68700
     atagttttcg cgtacggctt tttgcgtcat ggctttttcc gtcagctccg tgccccgggc     68760
     attaacgccg taaatcttat cagggaaatc ttcaatctca gctaaatcaa cgtccagcag     68820
     gactgctgat agctccggct ttacttcaaa tgcaacaatc gtttcacgcg gccattcagt     68880
     ttctgccagc acacccgcca ggtatgattc gaaaaacgcg gcgtctgtcc ggaactgctg     68940
     ccgggcatct gcctgagccg tggcgagccg tttttcatgt tcttctgctt caaacttcca     69000
     gtttgcatac tgttcggccc aggccgtccg ttgttgctgg taccggtgct gtcgaagggt     69060
     attctcacgc tccacatcaa tcagctcctg ctgccaccgg cgaagatttt cggcgtggcg     69120
     ctcagcttta gctgattccg attcaaacca tttacccaga aaactaatgc cttcgctctc     69180
     ggcaggcttt tccggcaatg caaggtagtc tggcttttct ggacgcaccg gtgccggaac     69240
     ctgaaaaggc gacgttctgt tatgcaggta tactgcttcc agctctgccc agctgatgcc     69300
     tgtttttgga tccggcgtca gctcgtgaat attacggatt gcggttaccg ctgacatgag     69360
     ttcagcggct tcctgctcaa gcgcctgtct gagccccggg tcggttgccg tccggtttcc     69420
     acctccggaa cgcgcggccc ggtcaagccg ggtacggtaa ctcagcccgg taccgggcaa     69480
     gcccagattg gcataggtcc cccggctacc aaaagaaacg gaagcacctc tcggcccgac     69540
     actcaggctc ggtgcaccgt tactcaggtt gaggcgaacg ccaggaataa tgttgatcga     69600
     ctttctgaac ctgaacccca ttatgatttc cttaatgatg ctgggtcacg gtaagtaatc     69660
     tgattccatc agcgctttgc tcgttctgta acccataaaa acgagctctg tccagaatgc     69720
     cagccgccca gcggcgatgt gtggcgggtt cacacattgc tccctgcgac ttaaacacgg     69780
     cctgggtaga gttcaggatc cgcagagcgt cagaatactc accctgagtg accatcagcg     69840
     cgttttgaat gacctctatc tgacccgggt gaatggccgt tttcccaaca agcccatgtg     69900
     ccatatcaag agccagctct ctggccataa cggcatgatc gtcaatatgc tcacatacgg     69960
     gcgcggtcag ggcaaaatca cgcgggccga agactgaaac gagcattttg atgacgtagc     70020
     ccatcgggct gtcatacagc gtcaggtccc gggggcggcg aagcgacaca acgttcataa     70080
     gatcgttgcc gccgattcga agcgcaataa tgcggtcgtg gcagggatgt tccaccaggc     70140
     gagtggccag ctcgcgcatc tgaaccacgt caaagacgtc ttctgtttcc agcgttggca     70200
     tcatgcacag gtgagtcccg cccatgatat cccaccattc agctaacgaa ctgagggtaa     70260
     atttcggcaa cacaaaccca tcgacagcgg aaagatcata atgcgctttt aaccatctgc     70320
     ccatttcggc atgccgaggg cgaatgaaca ccagaggcca gtcattttta cccaggctac     70380
     gcatgctgtt actgagctcg tgcagcaggt gctccagatt tttgagggcg atggggatgt     70440
     ctgcttcact gacagcatcc tccaggcaaa tcaccagaga gcgcaaaccc gggattttcc     70500
     cgtgcaggac ggcatcagca atatcttccc gtgttgcagg catgtatagc gtggctccca     70560
     gattccaggg agaaagacga tttttcatca gagtaccttc ttgataatgg ttacagcccg     70620
     atactggccg agggttcccc ccatttctgt aacaactatt cccttttcac gagcaagccc     70680
     tacaagcaag gcaacgtccg ggtcgtcaat agaacgcaca aatacatggt ccggtacccg     70740
     acgtaataca gcccgggttg cttcagcaat accgggttta atacgattga cgctgtccac     70800
     tttaaattca tcggccagga acgcgataac gtcgcgactt gtctgccata agacccgggc     70860
     tgactccata ttccagctca gggtagcgag ggatgacggg gttaacttct tacggaaatg     70920
     ggcgacggta tcgacaagca tccggctgca ttcgaattca ctgagatgct cgcaaaccat     70980
     gcacccatgt aatccttcag aggaccatac tgaccgggag atcaggcctg ataccggcgc     71040
     acccatgatg ccaaaaggaa tgagccagtc atcatcactg gctgcaagcc aggagcagcc     71100
     acagggatcg gccaggacaa ccagtcgcgg ctgctcagga tagcccgggc gatctttcag     71160
     tgcgcgtaca agctctccgg taattgcgcc tttacctgtc catccgtcaa caaagacaat     71220
     accgctggta ccatggcgct cttcaatgac gtcgagggct gcaccgtcaa ttccacgatc     71280
     ccggataatg ctgataccgt aatgccatga ggttttcccc atgtcacgca gggcctggtg     71340
     cagcataacg ccgagcggca cgccagctct gacgagactg gccagtacaa tgggctcatc     71400
     accgaagcgt tcggccagag caatagcgag ctgtgtgact tcttttgcaa gtctctctgc     71460
     gccccgatcc agcgcccggt gaaacaaatc aagatgccat tgtgttggcg ctggctcctg     71520
     actgagcatg tccgaataat gtttcttccc tgactgaatc agctcttctt tttgctcaac     71580
     cggcgtcatc tcaatgacta ccggctttag cagaaattcc acgtcaccgg gctggtatga     71640
     gccggtaaat gtgtcatgtg gctgcatttt aattttctcc aaaaattcgc tgtgaaatgg     71700
     catctgcaaa ctgactctga cgcgggatgc caaaccagct gcacagtttc ataaaacgat     71760
     gatcgctcag gctgtcgccc agaccaatta cggggaagac tccgcgttca gcccgaagtt     71820
     tttcaagcag ccatctgact gccagccctt tctcaaccgc ggtgggaagc caggccacgt     71880
     tattactgtt gcggtggatg tagaagccct cggtcggaaa caccgtttct atctcatctg     71940
     caatggcatt gagctcgtca aggcgggtgc tgtcgcggtg cttcatcacc atataaaccg     72000
     ccgtttcacc gtattcgaag ttcagccttg cccaggcatt gatccctttt gcgtccatca     72060
     tttcagtgat cagacgctgc atcgatgtca gcttttcctg atagggagcc agctggccga     72120
     gcatatgggc cttccactcc tcgtcgggtt tgccttctgg cgtgagaatg acggccccgt     72180
     gagtggtgat tgcccaggag tggaaaggga tccgtacgcg gctgatttct tcagttcccc     72240
     gtgcggtaac gggtatgagt tcagcctgct ccaggagcca gtccaccaac atggactgtt     72300
     cttccgtcat aaagcttcgt ggattcaggg tgcgatcaac ggcaccggta cggaatggct     72360
     ccagggccag ctcgtccacc attttacgac gggtctgaaa gagcgtgtcg tcaaggtcgc     72420
     tcagaacaac gggtttattc ataggtaaca atctccacga cggccgcaac ctcagccagc     72480
     gctttaagaa gctgcgtgtc aatactttct gcgggtgtct cagtacacac aagaatgcgg     72540
     tcaaactgct ggtgggcgac gttatagaca aaattgggga tgcccagccc gtagttatcc     72600
     gtaaaggaaa tggcggactc aatggcataa ccaacggcga taggggagcg ggtggtcgat     72660
     ccataaaatg cctgtgctcc ggcagcttcg agccgttcag caagcaggaa cggctcccag     72720
     acgaattccc cggtcccgag aaccagaata cgttccccct tgtggacgga gacctcatgg     72780
     ccgagatcgg ccgcaggtgc gagcatcccc agtcggcccc aggactgttt tccctggatg     72840
     tcccattctc ctcgtgaagt tacgttgact ttcggcatgt ccgggacagg tgcatcaggt     72900
     aatggggtcc atccccactt accgcttaca agagaaaccg aagtgactgg taaggtgctg     72960
     cgctcggaca aggctttgcc actccagtcg gtaagcgtaa cggctataac ctgttcaata     73020
     tgttgaagct tgccggtatt acgcagggct gaaagcaggt taataaaggt attaccggtg     73080
     gttgcctcgt catcaatcaa aaccagcgtt cgtgcgttgg taacacgacg tcttttctct     73140
     tcatcatctg gcagatagat cagatgatcg gtggcgtggc tgtgttcttc cttgaactcg     73200
     caaagcaacg tgccatcaac cgggtgacgg gtagaggtca gatagacaga ttcaggatgc     73260
     tggtggcgca cttcatcaaa tacaccggcc ccaagcccaa cggcggtttc agccataccg     73320
     ataaacagta cgggtcctgt cagtgtcgag gggaactggc tggcaagctg tctgtaggcc     73380
     tgccgcatga ctgagggtgg cacgggaatg tgcctgccga gtactttgct gacaaacaga     73440
     aaggcgcgtt tcgggttacg tctttcagcg atgtcaaaca ggtcatcgag cgaaacttca     73500
     ccctggtcgc gggttacctg aatcgtaccg catgagaggg tacggcgata aatcatatct     73560
     tcgaggatat cagacataaa tacgccttaa ttcagaaggt tagagagtga ttccgggtat     73620
     gcaattacat ccgtaatgga tctcaccgca accggagaaa aggtgttttt agcgctctgg     73680
     cgcaccatat cttcagacat cagaccgagc ttaaaggcag caaataaccc aggaaggttc     73740
     accccgctgt gaagggtata acccaccccc cctgacggac gcatgttggt ttcaagcagc     73800
     accgggttgc cattcacatc gtttcgcgtc tgaacattca ccagcccgtc ggccttcata     73860
     accctggcgc agtcacacgc cagttcccag gcgcttcctt cgtttaccag atactggata     73920
     accccttcct tacggcgtcc cacggctgcg agtatttcgc ccttatccgc gaggatatcg     73980
     acggaaaatt ccgggcctgg caggtacggc atcaaaacaa ggggtttaaa cgactcagca     74040
     gctgatgctg ctgcaatata ctgttgcgga ctgaccagac gatgttcggg atgattaaag     74100
     acggccatag gcgaagcact gtcatcaaag cgccagaatc ccatgccata gatacccgtc     74160
     accggcttca cgcataccgg gctgtcagtg aacggcgggg ccgcgaggtg tgtttttaat     74220
     tctgtcagcg tattcacccg ccaggatggt acgaccggga gacccttttg ctccataaac     74280
     tgagcaaaag taactttttc gtcagccaga gttaaccagt cgacgcccgt tgcaccggta     74340
     gtaagggtgg caccggtcga ttcaatggct gaacggtgtt cttcaaacca ctggctgtta     74400
     cggccagtat gaatatggtg gatgccgtag gactgaatgg tttcctggat aaactgaaga     74460
     cgtttttgag gatcttcagg ttcagtcaaa gaatagtcgg caacggaaag gatttcattt     74520
     ctttcgttac ggtgggaggc aaaaacggta atggcaaaat tatttttttt ttgcaaatga     74580
     ttttaccccc tgaataatat ctcgctggga ggataaacct tccataaacc aaattttctt     74640
     gttcattttt tttaattatc cggaacgcca tgcaaattta tgattgagaa gtgagtctat     74700
     gagtgtctaa gctacatgtc aatcataata tgattaataa ctcctgtggt tatggagtgc     74760
     gtcaggtttt ttggattcct gataacacat tgatatttaa attaaactta gaaaattaac     74820
     accctgaaaa ggatttcttt ttgtgttttt acagaaaact accaaaattt cccttgtcag     74880
     agagcttcat catgatatga ttttcttcgt cagttactaa atataccttt gattgtctcg     74940
     gtcattacca ttttaaggaa taaaacatgg tttcattagt taagaaccag acggtatcac     75000
     tcagcaaaga atcatctgca ttaagccagc ttcatttcgg tctcggttgg gatccggtta     75060
     agaaaaaagg tcttcttgga ggattgtttg gaggcaacga ctcaatcgat ctcgatgctg     75120
     gctgcgtatt aatggacagc accggtaaaa caattgacac catctggttc cgcaaactgg     75180
     aatccacctg cggcgctgtt gtgcacagtg gcgataacct gaccggtgaa ggtgacggtg     75240
     acgatgaggt gattaatgtc aacctctccc gactgcctgc aaacgttgaa tacctggcgt     75300
     ttacggtaaa cagcttccgt ggtcagtcgt tcaatgacgt cgaaaacgcg ttctgccgcg     75360
     ttgtcgatca aaccggcaaa gagctggctc gctacaagct gactgagcag ggctcacata     75420
     ccgggatcgt tatttcttcg ctgcgccgta ataacggcaa ctgggacttt accgcccttg     75480
     gccatgcctg tcgcggccgc acaattgacg atatgcactc cgatatcgtt tcagcggtta     75540
     ttcgctaatg aacctgacgc cggggggcaa tgcccccgtt ccagcccagg agttgcgggt     75600
     ccggatcacc tcgggcggcc aggtggatgc ttcggcgttt cgcctgtatg ccgacgggaa     75660
     ggtgcagggt gatgcggaca tggtgtttta tggtcagcca cgtaacgatg atggtaccgt     75720
     cagcctggtc agtgaaggcc agtactcaac ctttactgtc gcgctcaacc ggctgaaacc     75780
     tgatgtccag aaaattgcgt tcaccgtgac ctgtgacggt gggcagacgg tgtccggtct     75840
     tcgtaatctt tccatcgacg tggagcaagg ggctaccggc ctggttagcg gcagtgtcga     75900
     actgagcggc cgtcaggaag cagccttaat tctgggtgaa ttttaccgtc gtaataatga     75960
     ctggaaattc cgcttcgttg cgcaggggtt caacggtgga cttaaaccgc tggcagagca     76020
     tttcggcgta aatattgccg acgaaccggc tcccgcagcc ccgactcctc cggttgtaac     76080
     ccctccgcca gttgagacaa aaatcagcct gagcaaggta tcgctgacaa aagagaagcc     76140
     tgcaatcagc ctgaccaaac gggataactt cggtgaaatc cggatcaacc tgaactggca     76200
     ccggggcagc ggcaaatcag gctttgcagg catgttcggc tccaaaggaa tcgacctgga     76260
     tctgggggcc tttgttgagc ttcaggacgg gtataaatcg gtcattcagg cgctcggtaa     76320
     tgcattcggt gattatcgcg atgaaccgta tgttcagctc aagggcgatg accggacggg     76380
     tgatgtatca gacggcgagt ggctgcatat caatggacgt gaatggaagc atatccgcga     76440
     agtgctgatt tacgccttta tttatgaagg tgttcccagc tgggacaaga ctgatggtgt     76500
     ggtcaccatt catgtgccgg atcaaccgcc cattgagacc cgcctgaccg aaggtgaaaa     76560
     ccgtcgcaca ttgtgcgcca ttgccagact cgtaaacgaa aacggcgcaa ttaaagtcga     76620
     gcgaattaac cagtacttca aaggccagga cgaaatggac cgggcatttg gctggggatt     76680
     tcgctggagc gccggttcta aataacacag caacaaagga aacaggtatg agctttttcg     76740
     acaaagttaa aggtgccatt aactcaggcc gtgacgaact gacccgccag gttggccgtt     76800
     tcaaaaacaa aaaattcatg cagggcaccg ttgctgtatg tgcccgtatt gccgtatcga     76860
     gtgacggcgt aagttcggaa gaaaagcaga aaatgatggg ctttctgcgc tcttcagaag     76920
     agctgaaggt cttcgatacc aatgaggtga ttgagttctt caataaactg gtttcaagct     76980
     tcgatttcga tgttgaaatc ggcaagggcg aaaccatgaa atacatcctg gcgctgaaag     77040
     atcagcctga ggccgctcag ctggccttac gtgttggtat tgccgttgcg aaaagtgacg     77100
     gtaacttcga tcaggacgag aaactggcct cccgcgagat cgctatcgcg ttgggcttcg     77160
     acccggctga atttggcctc tgatccacat ccctaagggt aaaatatggt ttccacacac     77220
     atcggcttcc cgactgaaac ggtcattgtt tttattgcgc tttcagtcgg tgccatcttt     77280
     attgacctgt ttatgcaccg tgatgacaag cctatttcgc tgaagagtgc ggcgctctgg     77340
     tccgtattct gggttgtggt tgcgatggca tttgccggtt tcctctatat ccaccacggt     77400
     gctgaggttg ccagtctgtt tgtcacgggt tatgcgctgg agaaagtgct gtcggtcgat     77460
     aacctgttcg tcatgatggc catcttctcc tggttcgccg ttccggatcg ttatcgccac     77520
     cgtgttctct actgggggat cattggtgcc attgtcttca ggggcatctt tgtcgccatc     77580
     ggtacgagcc tgctgagtct ggggccgtat gttgaagttg tcttcgctat tatcgttgcc     77640
     tggacagcgg tcatgatgct taaaagcggt gatgacgatg atgaaattga ggattactcc     77700
     cagcatctgg cttaccgcat ggttaaacgc ttcttcccta tctggccgaa gctcagaggg     77760
     catgccttcc tgcttaacca gaaggaagtg gatgctgaac tggcgaaacc agaaaacagc     77820
     gatgtcacca ttggccgtgg taaaaaagcg gcgctgtatg cgaccccgct gttcctgtgt     77880
     gtggctgtgg ttgaactctc ggacgtaatg ttcgcgtttg actcggtacc ggcaatcatt     77940
     gccgtcagtc gtgaaccgct tatcgtctat agtgccatga tgtttgctat cctgggcctg     78000
     cgtactctgt actttgtcct tgaggcactg aaacagtacc tggttcatct ggagaaggcc     78060
     gttatcgtgc tgctgttctt catcgcggca aaactcggcc tgaatgcgac cgatcacatc     78120
     tggcatcatg gttacagcat cgcggcaaca accagcctgt atgttgtact gggtgtactg     78180
     gcgctgggca ttctcgcaag cgtcatgttc ccgggcaaac ctgaatctga ggaaaagggg     78240
     agttaatccc cttaagtgtt aacctgaaca attactaatc gaagaggtta ttttatgagt     78300
     gtttctcttt ccaaaggcgg gaacgtctcc ctaagtaaag cagctccgtc aatgaaaaac     78360
     gtcctggtgg gccttggctg ggatgcgcgt tcaacagacg gtcaggactt tgacctggat     78420
     gcttcagcat tcctgctggc ctcaaacggc aaagtgcgcg gcgattcaga tttcatcttc     78480
     tataacaacc tgacgtcatc cgacggttcc gtaacgcaca ccggcgataa ccgcaccggt     78540
     gagggcgatg gtgatgatga atcgctgaaa attaaactgg acgccgtccc gtctgaagtt     78600
     gacaagatca tcttcgttgt gaccatccac gatgctcagg ctcgtcgcca gagctttggt     78660
     caggtatccg gtgcgtttat tcgtctggtt aatgacgata accagactga agttgctcgc     78720
     tacgatctga ccgaagatgc gtccactgag actgccatgc tgttcggcga gctgtatcgc     78780
     cacaatggtg agtggaaatt ccgcgcagta ggtcagggtt atgctggtgg tctggcatct     78840
     gtatgtgctc agtacggcat taacgcgtcc tgatcaaaaa gtaacttttc tacccggggc     78900
     tgttaatgca gccctcattc aactgtttgc aggagctaaa aatggcagtt tctctcgtaa     78960
     aaggcggcaa tgtatctctg accaaagaag caccaaccat gaatgttgct atggttggcc     79020
     taggctggga tgcccgtgta accgatggtc agggttttga cctggacgct tccgtgttcg     79080
     cagtaggcga agacggtaaa gtgttgtcag atgcgcattt cattttcttc aataacaaaa     79140
     ccagccctga tggcgcggta gagcaccagg gcgacaaccg taccggtgaa ggcgacggcg     79200
     acgatgagca ggtcaaaatc gatctgacca aagtctcagc agatatcaaa aaactggtgt     79260
     ttgccgttac catctatgat gcagaagcgc gtaaacaaaa cttcggcatg gtgagcaaca     79320
     gcttcatgcg cgtttacaac aacgacaacg gcacggaaat tgcccgtttc gatctgtctg     79380
     aagatgcctc aaccgaaacc gctatggtct tcggtgaact gtatcgtcat ggcgctgagt     79440
     ggaagtttaa agctgtcggt cagggctttg ccggtggcct ggcggctctt gcctcccagc     79500
     acggcgttaa catctaaaat aacgctgaat cataccccgg caatgccggg gttttttttg     79560
     gttgcgatcc gctatcagga gggggggggc agaaagggtt cgggaatctc agaaagcaga     79620
     gagatgttaa ttctgacgtg agccttttaa aggcaggaaa cggatttttc tctggttgct     79680
     ggttaaagcc tgtattccgt gccttatatc aacagcatgc ccctctgata tatgttacgt     79740
     ttgcgactta tgaaggcacg ggttctggaa gataaaatac ccgaccaatg gaaattccaa     79800
     ttcaacaggt atagaaactt caacgtgatg aaatatggtg tcacaccata tatacgcctc     79860
     accagaaatc cagcgtcctg aactaagcca ggggaaccta tataaacgct gcgctttaaa     79920
     ataatcaaaa atcaggagag ttaatgtgaa tctacaatcc ggacaaaaca taccacttca     79980
     gcaatctgcg atcaggctga atcttcagta ccctaccaaa tccggcttta aaggcgaacc     80040
     cgatacctgc ctgttcctgc ttaatgctca gggaaaggtc agcggcgatt ctgactttat     80100
     cttttacaat aatctgtctt ctcctgaagg ggcagtaaag ctcgttaccg gttctcagca     80160
     gtccagcatt gagatagcac tggatcgtgt tcctgcgaac atcagtaaaa ttgcaatcac     80220
     agttgtcatt gatggtgaag ataccatcag tgggctcagt tcgttgagca tgcaggctca     80280
     aggaatcgct gagttccagg ctgagactca gggccgcagt gagaaagcaa ttatcctggg     80340
     tgaagtatat cggcacaatg gcgcctggaa gcttcgtgcg ctcgggcagg gtttcaacgg     80400
     tggtcttgag cctctggcca ttagctatgg cgttgatgtc gcacagccag ctccgcagcc     80460
     agcaaagcct gctcgtatca gtctggaaaa gaaactggaa accagatctc cgcgccttgt     80520
     aagcctcgct aaaaaagcct cggtcagtct tactaaaaat aaactggaca cccttgaggc     80580
     agcggttgca tttgtacttg acgcatccgg ctcaatgagt ggccagttca gtaagggtaa     80640
     cgttcagtct gtgctggacc gcatcgccgt tcttgccgcc cagttcgacg acgacggtga     80700
     aatggatgtc tggggatttg gagagaagca taagaagtat ccaaacgtca cactggacaa     80760
     cctggacaca tatattcagt ccattcgcgg ggctggaaag cgttcagcct gggagaacct     80820
     gccgggcctc ggagggacaa acaacgagcc tcctgtgatg gaagaaatag tcgactactt     80880
     taaggactcg aaaatcccgg tgtatgttgt atttattacc gatggcggga tcagcaagac     80940
     ccgggcgatt aaagatgcaa tccggcgttc tgccaactac cccatcttct ggaagtttgt     81000
     cggcctgggt ggttcaagct acggtatcct caaaaatctg gatgacttta ctgaccgccg     81060
     ggttgataac acccacttct ttgccatgga tgatttcggt tcgattagcg atgaaaagtt     81120
     atatgataat ctactggaag aattcagacc gtggatcgat gaaacaaaaa ggttaggcat     81180
     cctttaatac gcacagtttg agcttggttg aatgagctct acagcagctt aatactgtag     81240
     agcctttgtt cattggaaat cgtacaggga ggcgcatatg gaccgcatca agtacctgaa     81300
     atggatagct gaagaatcac caagtacggc tcagcagctg gtggcctggt taaacagagc     81360
     aaggcactat acgcccgaca tgaaagagca tcaggcaggt gtacagattc aagaaaaggg     81420
     gattgttgta gggcttagac aaagtactaa tcgttatcat ggagattgtc tgaccataca     81480
     tgtggtacgg cttccggaag aaatacaaaa caagggatgg tttaagtctt ttctgaagct     81540
     ttgctgtgaa tcgaatccct ggtgcgatgt tgtaatagaa gacgtgaaaa acccatattt     81600
     attaagcttt tgtaagaaac taaactttac tgtattagat gaattttacc cgaatactta     81660
     catagtaaac acagatgcca ttatgagttt acctatccca cccttaggga gatacgaaac     81720
     ctatctttat taaacctgcg aacctttacc ggttgcgtgg ggagcggatg gacttcggct     81780
     aaagaaaaat cacatcgtct attttgacca gaaaaagcta atctgcttga tgtaatgcag     81840
     aaacgcatta cattaatatc ttctcccaac aatcacctga acaattccct gattgctttt     81900
     cacctcatac cagtgctggc tcatagttag tccttaagca aatttgttat cggaataaag     81960
     aacgaagcca gcctcatcga ggcgcataac cttcttccct taacgcctgt tgtaattttt     82020
     caattgcgct tttcattacc caggcttctt cgtcactcac agcacagcca cgaagatcgc     82080
     tccagctcag acgtttaact aattgagcaa gggccatagt ttcattctca tcaagctgca     82140
     aactcagtgt ctcaatacct tccactatct aacctccctt atactgaaaa atggcgcttt     82200
     atttctgacc agatgccgaa gccttgaatg cggccggaac tgccgttgtt tctactttac     82260
     agaaatggaa ttaaaaagtg gtggtgctgg gcacgtttct tttccagtcg gggtttaagc     82320
     cagagccgaa actcattcaa cttctcagca gccaaaaccg cttcaacggg gaaaacttta     82380
     tatttaccct gctgctgagg ttcacccaac catcgcctga tggctccgtc agtccataaa     82440
     cgagtctctt tgagcctggt tacagtgacc catttcctgg accattcatc aaattgtcgc     82500
     tggcgatccc gataacgttg ttcttcctgc tgacgaagcc agtcgcgatc aacagcgaat     82560
     tttcggtatc caacaaagag cccttgtact ttggccatga caacattccg gtttgcttag     82620
     aactgttcag acagacatgt cagggataaa gctgaagaaa aaggtacaac gaagaataac     82680
     caagacatag gcctgccggg taagtggtgc ggtgcacagg actgtcggaa agtacgctca     82740
     gagagggtcg tttaagcatg atgcaccacc gccagccagc cttaataatg gtaatgtacc     82800
     actgggttac cagacagacc agtaacgcat caaacataaa actgtttttt aaaaaacgtc     82860
     aggaacgtag cctgaccttt taaccagtgg tgtaaaaaac atacagattg ctctgaggta     82920
     tgaggttcag caactagcct tgtcgacgca gaaacattaa gtaatcaata gcagctatcg     82980
     caaacaatgg tgaaaaccac cacgtgcttt tcaacaagcc aagcggcaga aagagtacag     83040
     ttgccatcga ataaacaaaa acacgaacca taccatctgt aataaacata ggctatttgc     83100
     aatctgaggt tggattgtag attttagtta gaaatggatc aaagtccgtt ttgtgcaaaa     83160
     cttggttgac aaccctcttt tggaagatgt gccgtttcgt gcaaaagttg gttggaggcc     83220
     aagatggcag agttcgtagg ttcggctgct tcgcaagctg atttcatttg gaagaacgcg     83280
     gaagacctgt gggggggatt tcaagcatac cgacttcggc aagatcattt tgccgtttac     83340
     tctgctgcgt cgattggagt gcgcactgga gtctacacgg gaagcatcgc tcgatagcca     83400
     accagccacg attgagttct tagaagcaga gttcagtgtt gatttcgatg cgctgctatc     83460
     ttgaccgcca atcagacccg catggttcag gtttgtgtat gagagtcccc aaatggctgt     83520
     agttctaacc aaagccttga ttgaagccgg ccgcgccgga aatagtgggt acagaaaagg     83580
     cagttgcttg cgctgggcgt aagttacccg ccgaaaagcg gctggatcga acgactgatc     83640
     ggcactgagg tatctgacga gcagtacgaa cgctttctgg ggcacagcac gagcaagcag     83700
     gctgaacaga tcctacgcgg agagcagcca gccaaggggc ttcagtatgc aaagcgagcg     83760
     aagaagctcg cttctgaaag aaaagccaca attgatctgg ataacgagca cctgtctgaa     83820
     atcgaaaagt atcggtagcc ctagactttt agccgctgaa gatctcttag ataccattgg     83880
     tgaaacttgc tgaagtcagc cttctgtttc tctaccgtgc tgttatagat cgcatcactg     83940
     gtaaccgcac aagcagtcca gccagcctca tagacgaagc gagtagctat cggtgacttc     84000
     ttcggggtgc tatcccagcg gtttttgagc caccgcgcaa gcccttcatc aagagggacc     84060
     accagattta gctgctgttt tgtgcgagtg ataccgacat aaaacagccg acgttcctcc     84120
     tcgatttcct cttcggccgg aggggtgttc atcgatgtgc gaacgctgta aacatcatcg     84180
     ggtttgccgc caggaaattc ctgctcattc agcccgatca gtattacgtt atcccactcc     84240
     agccccttgg aaccatgcag tgtggaaagg atgaagggat cgcagtcagt agcagcctcg     84300
     cctggattca agataaggtt taaaaacgtg cgggaatcga tcttactgga gtcaagtagc     84360
     tccccgatcc tcacgacccc tcgttgctgg tcgttcgatc cagtgcgagt tacaccctca     84420
     gagccaacac tatcaatgaa accctccata ctcaggcgtc gtaacacatc gatagcaggc     84480
     gtttcctctc cgtctttctg gcagatagtg gcgagcctgc ccagccgatc tttttggtat     84540
     tgtgcgccct cgaataactg acctagagca gaccataggt cggcgtgcgg agccatcaat     84600
     ccactgagcg ccgctttgaa ttgccctttc tgccatctaa aaccagcctc cttcagaaag     84660
     ccgtaaacaa tcgcttgttt gttgggatgg ttttccagta gccgcagatc gccgtacaca     84720
     gacagcaaga cgccaactac cagtatcccg atttcggtgc gggtgtgtaa tgcgcttgaa     84780
     ccattgaggt agcgataagg tagcccacac aggcgtaaag caatttccgc ctcagcaagg     84840
     ttcgccttag tgcgggacaa tatggcttgt gttccactgc tcaccgagag gtttgatagc     84900
     accttggata ggcagttatc aaagtgcaat ctgacctctg ttttgggggt gctaggatga     84960
     ctgacacaaa gcttggtcag ctttgtagag ttgcgccgaa ttaccgagtt agccatcaag     85020
     gaaagctcat ggccaaatct gaacgtgcat gacagttgaa acaccttcgt attcgggtag     85080
     tgcctttcaa acagtccgcc gataaagtct ggtcgagcac cacgccactc ataaatacac     85140
     tggttaacat caccaacagc cataaccgac gtatccgact tagatagcaa gcgggtcatg     85200
     tcatgctgta tcaggttaac gtcctgatat tcatcaacaa tgatgtgctt gaagtgggca     85260
     ccaaggctgc tgtcattacg caacagtgcg acagcctcaa tcaaacagtc atcaaaggtt     85320
     cgcagactgt tttcctccag cagctcacaa tagcggccat aggcgtgaat aaactcccgt     85380
     ttgatgttgc tgaacgttgg atcattggca gcatcaacag gagttacggc cgccgcccgg     85440
     cagcgagcaa taaacagctc gaagttttca atttcattgg ggtcaatata attcgcctca     85500
     tggtcaaagc catagcggta ggcttgcttt accagttgct catagcggta gtcgcttgga     85560
     gtaatgaggt ctttcttctt gattatctgt tggcgttctc cgtaaccaac aatctttaag     85620
     gccaagctgt ggaacgtgcg gatttctgga atcacgctcg acatcagtgc cgtcttcaag     85680
     ttctccgtga agctcacctg cgccgacttg ttgtacatca ggatcagaat ggagcgagga     85740
     tcagttcccg tcttgaccag ccgctcaacg cgctttacaa gtgtggttgt tttcccgcta     85800
     ccaggtacgg cttttaccaa cgcatgtccg gtgtcatggc tgacaatact tttctgctcc     85860
     caagtcagtc ttttggtcat gccttaacct tgtaattggc gcactgacgg gcctcggtgt     85920
     agggaacgat ctttgcctta ctgtgacatt gcagatagcc atcctcccat cggcctgctt     85980
     gctcgcacat aatgcagttg ggaaatagtg aatgaggatc ggcgtgacgg ataaaagctc     86040
     gtaagttatc agccagctca gcggccccta acgatctagg ccatgtgttc acgtcagaat     86100
     tgattgttaa atccacttca gcgagcggca tcgtttgttc gttgagtcgg ccggaaccac     86160
     ttaaactcca gacagacata tccacgttac ctactgagca gacgccgcta caggtgtcca     86220
     cagattgaaa cgggggaagc cagttgaata ctctcaggat cttctccttg atcgagtagg     86280
     ccccggtaag caacatctga atatcagagg cagattggac cttaaactca agaatcggga     86340
     taccggcttc gatcttgtct tgagagcagg ggtgtgtgac acaaatctct acgtagcaac     86400
     gcctttcgcc agtcgtatca tacaacatca cgtctggtcg cagccctgtg accttatcgt     86460
     gtttttccag ctctgcctga tcgaaaaatt gagtcaagtt gtagcgtgca ggcacggatt     86520
     ttacgcactg acgtgcttcg tctctaacca aggctaaacg agaaccatta caggcaaccc     86580
     ggcgctccag ctcaaggcta ataggcattt cacggctgag agcttgttgg tagcgataga     86640
     agaatgcttc tttgccgcac ttgtgaagat aggtttcaag ggcacagcat tcttccgaat     86700
     ggcgaaagtg cttagcgttg aactcgccca ttaccggggt cagggggctc ttacaacctg     86760
     ggcaggtgta agtatgtgag cgcagggcag cgccaatgtg cgtgagggtg ccctcgccgt     86820
     ctagcgcgta agcgtattgt attgagctgg attgagttgt catgactgcg tatcctccca     86880
     aaaaaatcca gctaagaaca gaccttacgg caggcaaatg gtaagtagtg cttcttgaag     86940
     cagtcgagtg tacagcggct cagtgaaaaa gctaatcgcc cgctcaacaa cctagtgata     87000
     ctggtgcaga ttcgacaatg agttaatgcc cggagagcat ctgcaagact tctagctgga     87060
     aggcattcca accagccctc gcttctgaaa agccgtcagg aaacggtaaa atccaaccaa     87120
     gtgagcaact tcacttgatc aaagatctaa ggctagaatg atggaattcc aaccttagtt     87180
     tgcaaatagc ctaaacatat aacttcctct gaggatttaa aagaattctc agatgtcttg     87240
     aaagctactt tttaaacttt ctcattctga gaagcatatt taattttgct gcgtctgctc     87300
     gtgctgctgc tacagaaagg gctttatgca gtgaaactac cacgacaaac aaacagaaca     87360
     tcgaccagaa tccatccatt tcgtttacct aatcgttgag gtttttattc gggatatctg     87420
     gctaaatagg actacacaga tacccagtta aaccccccgc ttacataaca ctccggttcc     87480
     tcaccagacg ttttattcta tcgcggtctg tggttatcag aagctgcata aaccggttat     87540
     ttagtccgtt acgcgaaaat tattgaggat ccgggctgtt aaactgttct tcctctttcg     87600
     cttccggaga aaaggggagg tgtcaccctg cggccgggta gtgaaaggga tttgacgtaa     87660
     ttcaggcgaa gggcgaacaa gaccgcaaag gacgcccggg cgaccggata cctgccgggt     87720
     tgtgcgaagt aaaaaccgga agcagtgata acacaaacag gcccctacag cgtaaggatt     87780
     gtgatggacg ataaagagca atttacgaat cttgtggcaa agcatgcctc cggactcacc     87840
     gaagagcagc tggccggtta cgatgcctgt tccctggatg gtgaatgcgt cacgccttca     87900
     tacgaggttt tccgggggta tcgtacccgc cataccctgg atgaatttct ggagatggcc     87960
     atatcgctga atgccatcca cccggatgaa tatttaacgg atatgctgct taagcctcat     88020
     gaggtgatcg gcgctctggc cgatgaaggc gaccagctga acaacgccac cccggtttat     88080
     ttcttcccgg ataccggcgt ctatgcagcg gccgtcagtg aaacccgggt gctcgatgcc     88140
     tggctttgct ggccatgcta cccggcgaac tggtaacgcg gccgttggaa ttgcaccggc     88200
     aggatacgaa tttaaccgac cccgtggcgg gaaggttatc acaattgcat gtcctcatcc     88260
     ctcaagcccc ctgccaggcc ctaacgtgct gtcaggcttc gcctgattcc cgatctgcgc     88320
     cggtacttca gccgataact ttttgttttc tttttatttt ctccccattt cctcaaagtt     88380
     cgcgggcggc gtggacaggg caccattgcc gcatgtgggg tcttaataag ggcagggtgg     88440
     tcaggtttgc tcgatgccgg gggtaggccc taccctttat gggatgagga catgcaattc     88500
     actaaattaa tcgacagcac cggtggtgac ttatctgtaa cgggtcagtt ttgatacggg     88560
     gaatgtttca gggttaagat ctggaatcat aaaaatatac gctcccgttc aggacatacg     88620
     acttgaaatg gataatgcca ttaaaggaat tccagccttt cgtcgataac agtttctgac     88680
     catcgccata accatgtcat ggaggagact aaccgtgttt cagaggtgag ctggtgcctg     88740
     gcaaaacata caaactcaaa tatcaggaag cgagtttagt tgtttataac atgcagccgt     88800
     gtaactgatt aggtaccggc aaaaggagga aataatgttt gaaaactacg tttgtaaaat     88860
     ctatgtaagc aatgatcctc attttagtag ccatctcgaa gcaactgcgt ttggtttcga     88920
     taatggtcag cagcaaaaga ttctcaccgc agcccatgtt gttaccaatg ctcttggaaa     88980
     aatttatccc gtcagcaata cacttaaact ttacgtcaaa tttcttaacc atcaaggact     89040
     ggtgaacgaa gagcctgttc tagtcgattt cattctcaat gaggctaatg acagggcaga     89100
     ctttaaagac ggcattccgt ttgttgacag tgcagaaatc gtattaccag ctggaataca     89160
     acagcctgta agtagttact ttaaggtcct ggctcccgca gctggcatgg gtacattggg     89220
     tgtcggatat ccaatgaatg agacaacaat ttcgacattc cctggtgaag tttcaggcat     89280
     ttggccttta aattgctcaa atcattctcc ccaacatctc acaactcgct ttgtaatagc     89340
     acatttcaac accgatggtt gctctggtgg accctatgtc gtctccgaga atgacgagca     89400
     ttttgtcatt ggaagtctgg ttggaataat gtctggaacc tgcccagatt caaatccaca     89460
     catgtctgtt cagtccgcta ctgattttta gcaaagtcag ttccaaaatg acgctggcac     89520
     gatagttatt ttgggtctgc ccgatatggc gtctgccctt actaacagca acagcattga     89580
     aactgacaaa catgaactcg aaagtgccac aatagtaagt catgatttct tcatcacttt     89640
     tatggtgctc tttttcacct atcacacagc aagttatgaa tacgaggcct gtaatggacg     89700
     ctaccgaaac tgaagagctc gaaaaaattc gcaagaaggc aatggatgaa gttacaagtg     89760
     ctcttcaggc gcttgaaaat aagttcccgg gtattactga gggcgcagca gctttggcgg     89820
     ggtcaggcgt aggcgcagcg gcttccttcg gtgctctcta tacgcttggt acaacgggag     89880
     tgtcagcagc aggcataacc tccgggctcg ctacagcagg gtctatcgtc ggtggcggta     89940
     tggttgcagg cattgcggta ttggccgcac ctgtagctgt gttagggatt ggcgggtacg     90000
     cgatagtgaa acacaaaaaa aatgcgaaac tgacagccgc ccttagtcag gccatccaaa     90060
     agctctacga agttcaggaa aggttgatgt cgaatgcgga atattttaag gcagaaattg     90120
     ctggcatcaa ggcaacaatc gacatgctta ctaagaaagc tccaaaaggt agcctggtcg     90180
     cggtgaggta aacacatgag tcagtctcct tatgatgatg agttcagggc catccgttat     90240
     attcagctcc gtggtcagga tatcgcgaac gctcacgaga caattaacag tgatatagag     90300
     agccttaagg cacagttgac cgggctaatc agcggcactg aacttgatga agcggagcat     90360
     ctggcgctta aagaacatca tctgcgagaa atgacccctt cagatactgc catgcattct     90420
     actggtctca agactatata tagcgaggct aaccagcgtg tatgcggtga tattggactg     90480
     gccacaatac tctccacgga tgacttggct gttgtagatg cccggatcca gaatcatatt     90540
     aaagaattta atgatcgcta cgcactcgac gcctgggatt atgctattgc ctgcggatgc     90600
     gggctcatag catccatgct ggatttactt tgcgtcagag ccccgccaaa acctacggtg     90660
     agctttacgg cagaagtgga tggtattttc aataaacagg tgcagaaagc cttcaatgcc     90720
     attttgccgg aggacctgag tacaaaactc tcagatttgt tccctatagg ggcaccagac     90780
     agttcgatca gcagcgattt agtgggtgcg gccggtggcg ttttgtctcc cacaaatcac     90840
     cgcttaagag ctttgtcaca cgatcccgta ctgggcatta ttttcggtat aaaggatatg     90900
     ctgaacggga cctgtacggt ggttcagaat ggacagatcg tggtttatcc ttccagtaaa     90960
     ggcgttacag acgaaaccaa tattttcagg ctcatcgcca gaatgtttgg acacctggca     91020
     tcggatgtta atgccccctc agcaaaagga aaccgtggca tggggttacc ggctcctttt     91080
     atggggctac ttcgtatgct tgaggggatc cctgtgggga gttctaactt cggcaaacaa     91140
     atagagtaca tgtatgtcaa cgggtatgac tttcgtcagt ttatcgtgac aagtattccg     91200
     atgagcataa tggaagtttt gatgcgggtt ttctatgtgg cgaaacaggt atcgctggga     91260
     aaaggagctt ttggggagac cttactggat accatgccgt tgcggctaaa tccacgcttc     91320
     cggatgatgc ttgccctggg ttatggaact tccagtgctg ttaacgcagg taaaatgtat     91380
     atcaccggca atattctcaa tgcgaattac gcctcctgga tggggttggc ctggaatggt     91440
     tttcactcac tcaagtggtc cctttatcag cgacacttaa agctttgggc cggtattgaa     91500
     aaggcagaac tggaacggct tcagaacaat atagacagca tcgaggcatt gaccatcaga     91560
     gcaggaaact tgccagtcaa gtaacattca ccggagcacc tccggaaccc catagcccac     91620
     cagctgctaa aaatgtctgc ctttgctttt aatactctct ctgcctcctc cccgaggcag     91680
     agagtagctc gtagttattt aggcactgtt gcaaatagtc ggtggtgata aacttatcat     91740
     ccccttttgc tgatggagct gcacatgaac ccattcaaag gccggcattt tcagcgtgac     91800
     atcattctgt gggccgtacg ctggtactgc aaatacggca tcagttaccg tgagctgcag     91860
     gagatgctgg ctgaacgcgg agtgaatgtc gatcactcca cgatttaccg ctgggttcag     91920
     cgttatgcgc ctgaaatgga aaaacggctg cgctggtact ggcgtaaccc ttccgatctt     91980
     tgcccgtggc acatggatga aacctacgtg aaggtcaatg gccgctgggc gtatctgtac     92040
     cgggccgtcg acagccgggg ccgcactgtc gatttttatc tctcctcccg tcgtaacagc     92100
     aaagctgcat accggtttct gggtaaaatc ctcaacaacg tgaagaagtg gcagatcccg     92160
     cgattcatca acacggataa agcgcccgcc tatggtcgcg cgcttgctct gctcaaacgc     92220
     gaaggccggt gcccgtctga cgttgaacac cgacagatta agtaccggaa caacgtgatt     92280
     gaatgcgatc atggcaaact gaaacggata atcggcgcca cgctgggatt taaatccatg     92340
     aagacggctt acgccaccat caaaggtatt gaggtgatgc gtgcactacg caaaggccag     92400
     gcctcagcat tttattatgg tgatcccctg ggcgaaatgc gcctggtaag cagagttttt     92460
     gaaatgtaag gcctttgaat aagacaaaag gctgcctcat cgctaacttt gcaacagtgc     92520
     ctttttgcgc agcacacgca ttcgaccgat ccacggagcg gtgtcgtgcg tcgccatcac     92580
     atgtatgacc agacctttca gcgcgccttc aaacgtgccg tagaacaagc aggcatcacg     92640
     aagcccgcca caccgcacac cctccgccac tcgttcgcga cggccttgct ccgcagcggt     92700
     tacgacattc gaaccgtgca ggatctgctc ggccattccg acgtctctac gacgatgatt     92760
     tacacgcatg tgctgaaagt tggcggtgcc ggagtgcgct caccgcttga tgcgctgccg     92820
     cccctcacta gtgagaggta gggcagcgca agtcaatcct ggcggattca ctacccctgc     92880
     gcgaaggcca tcggtgccgc atcgaacggc cggttgcgga aagtcctccc tgcgtccgct     92940
     gatggccggc agcagcccgt cgttgcctga tggatccaac ccctccgctg ctatagtgca     93000
     gtcggcttct gacgttcagt gcagccgtct tctgaaaacg acactattgg ttaaattaat     93060
     gtatcaaaaa cgatggtttt tgtgacagtc ttgaaaagtc ctgacttctc ccgaaaaatg     93120
     actcccctca tgtaacaaaa ctcgttactg tatcaacata acaataaccc cataactaat     93180
     tagcgagaaa agaatgaaaa tcggctatgc acgtaaatct acgcatcttc aggatgtggc     93240
     gcaccaggtt gacgaactaa caaaagctgg atgtgagcaa atctatcagg atcagacctc     93300
     acgtagcggc ccaaagcgcg acaaaaaagg tgcgctggaa ggcactgttg caaatagtcg     93360
     gtggtgataa acttatcatc cccttttgct gatggagctg cacatgaacc cattcaaagg     93420
     ccggcatttt cagcgtgaca tcattctgtg ggccgtacgc tggtactgca aatacggcat     93480
     cagttaccgt gagctgcagg agatgctggc tgaacgcgga gtgaatgtcg atcactccac     93540
     gatttaccgc tgggttcagc gttatgcgcc tgaaatggaa aaacggctgc gctggtactg     93600
     gcgtaaccct tccgatcttt gcccgtggca catggatgaa acctacgtga aggtcaatgg     93660
     ccgctgggcg tatctgtacc gggccgtcga cagccggggc cgcactgtcg atttttatct     93720
     ctcctcccgt cgtaacagca aagctgcata ccggtttctg ggtaaaatcc tcaacaacgt     93780
     gaagaagtgg cagatcccgc gattcatcaa cacggataaa gcgcccgcct atggtcgcgc     93840
     gcttgctctg ctcaaacgcg aaggccggtg cccgtctgac gttgaacacc gacagattaa     93900
     gtaccggaac aacgtgattg aatgcgatca tggcaaactg aaacggataa tcggcgccac     93960
     gctgggattt aaatccatga agacggctta cgccaccatc aaaggtattg aggtgatgcg     94020
     tgcactacgc aaaggccagg cctcagcatt ttattatggt gatcccctgg gcgaaatgcg     94080
     cctggtaagc agagtttttg aaatgtaagg cctttgaata agacaaaagg ctgcctcatc     94140
     gctaactttg caacagtgcc acgctgggtg cgctggccgt tggcggtaac gagtggcgcc     94200
     gccgccagtt cgcgccgctg ctgatggatg tggtgcgcgt gtcggcctgt aatgagtacc     94260
     gtgaccgtga ggcgggtgaa agccagcagc aatataccga gcgcttactt ggcgaactcg     94320
     aagcggcaat tctggacgcc gggccggaaa aaattatcgg ttttatcgcc gaaacggtgg     94380
     ttggcgcaac cactggcgca atgccgccta cgccgggtta tctgcaaggc gttcgtcggc     94440
     tgtgtgataa atacggcatt ctgtatatcg ccgatgaggt gatgtgcggc atgggccgta     94500
     ccggcacgtt gcacgccttt gaacaggatg gcgttgtccc tgacatcgtg accatcgcaa     94560
     aaggtttagg cgggggttat cagcccattg gcgcagtgct ggccagtgag caaatcgtcg     94620
     ccgcgctgca agccggtagc ggaatgttcc agcatggtca cacctacatc tgccacccga     94680
     cagccgcagc ggctgcgctg gccgtgcagc aggttatcga gcgagatcgt ttgctcgagc     94740
     aggtgcagca gcagggcgcg tatttgcagc aggcgctgca tgatgtgctc ggcggattac     94800
     cgtatgtcgg tgatacgcgc ggtcgcggtt tgttcgccgg cgtggagctg gtatgcgata     94860
     aagagcacaa aacggcattc gatccgctgc tgaagctgca tgcggctatc aaagcgcagt     94920
     gcatggcgca cgggctgctg gtctatccga tgggcggaac cattgatggc cagcggggcg     94980
     atcatattct gattgcgccg ccgtttattg tcagccggtc agaactcgat ttcgtggtgg     95040
     atacactgca caaggtcatc agcgaagaga cgcataaact gatgagacgt cagccatgaa     95100
     ccgtttacct gcactgtcag aacagcagtg gagcgatgaa caacgccagc ttgcggagga     95160
     gattatcaac gggccgcgcg gcgcgctgct gccgccgttt gaaccgttgt tgcgcagccc     95220
     ggaactgatg gcccatgcgc agcgaatggg ggagtatctg cgctaccgta gcgcgctggg     95280
     gcagcggttg tcggaactgg ccatcctgct gaccgcgcgt cactggtcgc agccggttga     95340
     atgggccatt catgcgccaa tagccaggga aaaagggatc ccggcgcagg cggtgcaggc     95400
     aatcaatgaa cggcgtcaac cagaggcgct ggcggctgat gaatgggtgg tttaccattt     95460
     ttgccagcag ctgcatcagc ataaaaaagt cagcgatgat acctggcagc aggcaatcga     95520
     tctctggggg gaaaagggcg ttgtcgatct gattggcgtc aacggttatt acagctttct     95580
     ttcaatgatc atgaacggcg cgcagacgcc agtacccgac accagggatt ttattcttcc     95640
     cgcataaata attcgcacgc cttcattttt atatcgcgtg cgaatgtagg gatactgttt     95700
     ttattctcaa cgccaatatc agttttaggg tattgcgcga aaactcctgt ctgctgtctt     95760
     aattacgctg aggattatta tgtctgcatt attgaaaaaa ttaaagatta ccctgacact     95820
     ggttgcctgt tcggcgagtt ttgccgtcat ggcacaagat aaattattag tcggtgtgga     95880
     taccgccttc gttccctttg aatttaagca aggcaataaa tatgttggtt ttgatatcga     95940
     tttatgggaa gccattgcga agaaaatgaa tgtcagctac gaattacgcc ctatggattt     96000
     tggcggttta attcctgggc tgcaatcgcg taatttagat gtggcaatgg ccgggatcac     96060
     cattaccgat gcccgcaaac aggtcgttga tttcagcgag ggttactacg atgcggatct     96120
     cttaatggcg gtgaaaagtg gtgataattc catcaccaaa ttcagcgaac tggccggtaa     96180
     aaaagtgggg ctgaagcagg gcaccgccgc ggccagtttt atgaaatcca aatataaagc     96240
     caactatgtc gaattcccca atattgataa cgcctatctc gacctgcagg caggcaatct     96300
     ggacgcggtc gttcacgact ccccgaacgt gctctactac gtgaaaaccg caggtggcgg     96360
     taaggttaaa tcgaccgggg aaacggacag cattctgccg cagaaatacg gttttgccct     96420
     gcagaaaaac agcagcctga cgccgaaggt cgatgccgcg ttaaaggcat tacgcgcgga     96480
     tggcacctac gacaagattt atttcaaatg gtttaacaag caacctaaat aatccccgcc     96540
     gggccgggta accccggcca gaaccgagag taatagaccg cattatgaat ttcgaaacga     96600
     aatatatatg ggaatccctg ccgctattat tacaggggct gcagctgaca atattgatct     96660
     ctatggtcgg tttggcgggc ggctttatca tcggtctgct ggcaggaatc tgtcgtgcac     96720
     tgggaggcgg tattgcgaaa acgttatcat taatttttgt cgaattgatt cgcggtacgc     96780
     caattatggt acaggtgatg tttatctatt ttgccttgcc aatgattctg cctgttcgta     96840
     tcgaccctat cacggccgcg atggtcacca ttattattaa ctccggcgcg tatattgcgg     96900
     aaattacgcg cggcgcaatt ttgtccatca atagaggatt taaagaagcc agtctggcga     96960
     tgggattatc gcagcgcgca acgctatggc atgtgattat gccgctggcc ctgcgccgca     97020
     tgatcccggc gttgggcaac cagtggatta tcagcattaa agacacctcg ctgttcattg     97080
     ttatcggtgt cgcggaatta acgcggcagg ggcaggagat catcgccggg aacttccgtg     97140
     cccttgaggt ctggacagcg gtagccctga tttatcttgc cgtcaccctg tgcctgagct     97200
     ttctgctgaa gcaactggag aaaaggatcc atattttatg agcatggttg aatttagcgc     97260
     ggtcgctaaa catttcggca ccacccaggt gctgcacgat atcaatctga aaattgatgc     97320
     cggtgaatac cggctggctg ccgacgatcc ggatgaggag aacaccctcg ccacggcagt     97380
     tttcaccctc gatgccaacc acgtcaggtg gcaaattttc gacattaacc gcgacgatgc     97440
     taaatttcag ggagaagtgc gtgggtgaga tagccggtcg tcagtcataa agggcagggt     97500
     agtaccgttg gcccggcgtt cgatagtacc gtccggatac tgccagatat cggcgtccag     97560
     ggagatgtcc tgaagggcac tgttgcaaag ttagcgatga ggcagccttt tgtcttattc     97620
     aaaggcctta catttcaaaa actctgctta ccaggcgcat ttcgcccagg ggatcaccat     97680
     aataaaatgc tgaggcctgg cctttgcgta gtgcacgcat cacctcaata cctttgatgg     97740
     tggcgtaagc cgtcttcatg gatttaaatc ccagcgtggc gccgattatc cgtttcagtt     97800
     tgccatgatc gcattcaatc acgttgttcc ggtacttaat ctgtcggtgt tcaacgtcag     97860
     acgggcaccg gccttcgcgt ttgagcagag caagcgcgcg accataggcg ggcgctttat     97920
     ccgtgttgat gaatcgcggg atctgccact tcttcacgtt gttgaggatt ttacccagaa     97980
     accggtatgc agctttgctg ttacgacggg aggagagata aaaatcgaca gtgcggcccc     98040
     ggctgtcgac ggcccggtac agatacgccc agcggccatt gaccttcacg taggtttcat     98100
     ccatgtgcca cgggcaaaga tcggaagggt tacgccagta ccagcgcagc cgtttttcca     98160
     tttcaggcgc ataacgctga acccagcggt aaatcgtgga gtgatcgaca ttcactccgc     98220
     gttcagccag catctcctgc agctcacggt aactgatgcc gtatttgcag taccagcgta     98280
     cggcccacag aatgatgtca cgctgaaaat gccggccttt gaatgggttc atgtgcagct     98340
     ccatcagcaa aaggggatga taagtttatc accaccgact atttgcaaca gtgcctgttt     98400
     caattacccc ggaaaacgtc ggatgggtca caaatcagga taaagataaa ttatggccag     98460
     cggcagaacg ccgctggccg ggggattatt tgtcgccgaa gtgaataacg gtgcgaatag     98520
     acttgccttc atgcatcaga tcaaaggctt cgttgatttt ctcaagcggc aggcgatggg     98580
     tgatgaacgg gtccagacgg attttgcccg ccatcgcgtc ttccaccata cctggtaact     98640
     ggctgcgtcc tttcacgccg ccgaatgctg aaccgcgcca tacccggccg gtcaccagtt     98700
     ggaacggacg ggtccggatc tcctggcctg cgccggccac gccgataatg acgctttcgc     98760
     cccagccttt atggcagcat tccagcgccg cacgcatcac gttaacgttg ccgatgcatt     98820
     cgaaactaaa atcaacgccg ccgtcggtga gttcgacaat gacgtcctgg ataggtttgt     98880
     cataatcgtt ggggttaacg aaatccgtcg cgcccatttc accggccagt ttgaattttt     98940
     ccggattggt gtccacagcg atgatgcggc ctgctttcgc ctgggccgcg ccctgaatca     99000
     ccgccagacc gataccgccc agcccaaaga cggccacgct gtcgccctct ttcacttttg     99060
     cggtattgtg caccgcgcca atgccggtgg tcacgccaca gcccagcagg cagactttat     99120
     ccagcggcgc ctgtgggtta acttttgcca gtgaaatttc agcgcagacc gtgtactcac     99180
     tgaaggtact ggtgcccatg tagtgataaa tcggctcgcc gttataagaa aaacgggtgg     99240
     tgccatccgg catcaggcct ttaccctggg tggcgcgcac ggcctggcag aggttagttt     99300
     taccggattt acagaactta cactcgccgc attcggcggt atacagcgga ataacgtgat     99360
     cgcccggctt caggctggtg acgccctcgc cgacttcaac cacaattccg ccgccttcat     99420
     ggcccagcac cgccgggaaa acgccttccg gatcgtcacc cgacaaggta aaggcatcgg     99480
     tatggcatac cccggtgtgg gtgattttga ccagcacttc gcccttctgt ggcggcgcga     99540
     cgtcaatttc cacaatttcc agcggcttgc cagggccaaa tgcgacggct gcacgtgatt     99600
     tcatatcgtc tcttccgttg ttgtaaaaga taagggggag tcgtaactat tattttagat     99660
     aagcccgcag caaatggccg atttcatcca tacgctgcgc acgttgttcg cgggtggttt     99720
     cgccattgac cagttcatca ttgagatgga tttccaccat ctcgcccatc aaaccgttgg     99780
     ccgcgccgcg taccgcggca atttgttgca ggatagcgat gcacggctcg cccgcttcaa     99840
     gcgcgcgctc cagcgcctca acctgacccc ggatccgccg tacccgggtc aatacgcgtt     99900
     ttttatcttc aggtgaatgg ggcatgatcg cctcccgtag atactatagg ggggtatagt     99960
     aacaggatcg ccaaacgttt gtaaaattaa tgggttcgtt tttatttagc aggccagatg    100020
     agagggagat acgccctgtg tccccatctg gcgcaatgcc cggttgtcag gtgctccggc    100080
     tgacagtgag aggaagaaac ggtaatgtgg ataaatgaaa ggaattaact cagaggatta    100140
     ttatcggttg ccctgtccgg gtttttacct gtttgagttg ttctgtgggg ccgctggtgc    100200
     attcgatgcg ctcatactct gtcggtttca tccacgacga ctgagatgtc attcctttgc    100260
     cattgatccg atgaaaatcc caggtcccgt ttgcattttg ccgtaactta tcaagcacca    100320
     tgctggccgt ttttggtttc acattttcat tgttgggcac aggtataaaa gtggagaaac    100380
     ctttacactg aacaggctct tcacttttcg cgcaccccgc cagagttaaa acgcccagta    100440
     agataaaaac gggtctcatg ctacatatcc ttatttttta gattcagcag tcgcatgata    100500
     gcgcgggccg caggggtgag gaagacatgt gctgccgggt tgttcaacgc taatatgatg    100560
     attcataatt gatccgagac cagggtcttc ccgacggcaa tgtttggtaa acaaaaggaa    100620
     tgaacatgga ggtaaccgta gagttatgtc ccccggacga gtgggaatcc atggtaggga    100680
     tttttaccga aatggaagaa cactattatg gcgaaggtat cattcaggaa gcgttgatga    100740
     aggattatct ctgtaaaaag ttattcaacc ggctttccgg taccctggtg atcagagcgc    100800
     gctgcggcaa taacattact ggcctggcat gttgcaatat tctttatccc tcgccccgat    100860
     acagcggtca gctgcatatt aaagagctgt atgtttctca gtgcgatcga aataagggta    100920
     cgggtaaagc gataatgcgc tttatagccc ggcttgcgct tgaacaggaa tgccttagcc    100980
     ttagctggaa cgctgaaaaa tctaaccccg gcgctaaccg tttttatcag gctttgggag    101040
     gcagaataaa tgatcatatc gtcaaatatt acctccacgg ggagagcctg agcaaactgg    101100
     cctcaggcat ttgagaagca cacggtcaca ctgcttccgg tagtcaataa accggtaaac    101160
     cagcaataga cataagcggc tatttaacga ccctgccctg aaccgacgac cgggtcgaat    101220
     ttgctttcga atttctgcca ttcatccgct tatcatcact tattcaggcg tagcaaccag    101280
     gcgtttaagg gcaccaataa ctgccttaaa aaaattacgc cccgccctgc cactcattgc    101340
     agtactgttg taattcatta agcattctgc cgacatggaa gccatcacaa acggcatgat    101400
     gaacctgaat cgccagcggc atcagcacct tgtcgccttg cgtataatat ttgcccatgg    101460
     tgaaaacggg ggcgaagaag ttgtccatat tggccacgtt taaatcaaaa ctggtgaaac    101520
     tcacccaggg attggctgag acgaaaaaca tattctcaat aaacccttta gggaaatagg    101580
     ccaggttttc accgtaacac gccacatctt gcgaatatat gtgtagaaac tgccggaaat    101640
     cgtcgtggta ttcactccag agcgatgaaa acgtttcagt ttgctcatgg aaaacggtgt    101700
     aacaagggtg aatactatcc catatcacca gctcaccgtc tttcattgcc atacggaatt    101760
     ccggatgagc attcatcagg cgggcaagaa tgtgaataaa ggccggataa aacttgtgct    101820
     tatttttctt tacggtcttt aaaaaggccg taatatccag ctgaacggtc tggttatagg    101880
     tacattgagc aactgactga aatgcctcaa aatgttcttt acgatgccat tgggatatat    101940
     caacggtggt atatccagtg atttttttct ccattttagc ttccttagct cctgaaaatc    102000
     tcgataactc aaaaaatacg cccggtagtg atcttatttc attatggtga aagttggaac    102060
     ctcttacgtg ccgatcaacg tctcattttc gccaaaagtt ggcccagggc ttcccggtat    102120
     caacagggac accaggattt attggcactg ttgcaaagtt agcgatgagg cagccttttg    102180
     tcttattcaa aggccttaca tttcaaaaac tctgcttacc aggcgcattt cgcccagggg    102240
     atcaccataa taaaatgctg aggcctggcc tttgcgtagt gcacgcatca cctcaatacc    102300
     tttgatggtg gcgtaagccg tcttcatgga tttaaatccc agcgtggcgc cgattatccg    102360
     tttcagtttg ccatgatcgc attcaatcac gttgttccgg tacttaatct gtcggtgttc    102420
     aacgtcagac gggcaccggc cttcgcgttt gagcagagca agcgcgcgac cataggcggg    102480
     cgctttatcc gtgttgatga atcgcgggat ctgccacttc ttcacgttgt tgaggatttt    102540
     acccagaaac cggtatgcag ctttgctgtt acgacgggag gagagataaa aatcgacagt    102600
     gcggccccgg ctgtcgacgg cccggtacag atacgcccag cggccattga ccttcacgta    102660
     ggtttcatcc atgtgccacg ggcaaagatc ggaagggtta cgccagtacc agcgcagccg    102720
     tttttccatt tcaggcgcat aacgctgaac ccagcggtaa atcgtggagt gatcgacatt    102780
     cactccgcgt tcagccagca tctcctgcag ctcacggtaa ctgatgccgt atttgcagta    102840
     ccagcgtacg gcccacagaa tgatgtcacg ctgaaaatgc cggcctttga atgggttcat    102900
     gtgcagctcc atcagcaaaa ggggatgata agtttatcac caccgactat ttgcaacagt    102960
     gcctcctgaa gcgcggtgtc cggaatttca ggtttgtgtc tctacaaaga ctaactatca    103020
     gaaaaactca tcgagcatca aatgaaactg caatttattc atatcaggat tatcaatacc    103080
     atatttttga aaaagccgtt tctgtaatga aggagaaaac tcaccgaggc agttccatag    103140
     gatggcaaga tcctggtatc ggtctgcgat tccgactcgt ccaacatcaa tacaacctat    103200
     taatttcccc tcgtcaaaaa taaggttatc aagtgagaaa tcaccatgag tgacgactga    103260
     atccggtgag aatggcaaaa gcttatgcat ttctttccag acttgttcaa caggccagcc    103320
     attacgctcg tcatcaaaat cactagcatc aaccaaaccg ttattcattc gtgattgcgc    103380
     ctgagcgaga cgaaatacgc gatcgctgtt aaaaggacaa ttacaaacag gaatcgaatg    103440
     caaccggcgc aggaacactg ccagcgcatc aacaatattt tcacctgaat caggatattc    103500
     ttctaatacc tggaatgctg ttttcccggg gatcgcagtg gtgagtaacc atgcatcatc    103560
     aggagtacgg ataaaatgct tgatggtcgg aagaggcata aatgccgtca gccagtttag    103620
     tctgaccatc tcatctgtaa catcattggc aacgctacct ttgccatgtt tcagaaacaa    103680
     ctctggcgca ttgggcttcc catacaatcg atagattgtc gcacctgatt gcccgacatt    103740
     atcgcgagcc catctatacc catataaatc agcatccagg ttggaattta atcgcggcct    103800
     cgagcaagac gtttcccgtt gaatatggct cataacaccc cttgtattac tgtttatgta    103860
     agcagacagt tttattgttc atgatgatat atttttatct tgtgcaatat aacatgggtt    103920
     ggcactgttg caaatagtcg gtggtgataa acttatcatc cccttttgct gatggagctg    103980
     cacatgaacc cattcaaagg ccggcatttt cagcgtgaca tcattctgtg ggccgtacgc    104040
     tggtactgca aatacggcat cagttaccgt gagctgcagg agatgctggc tgaacgcgga    104100
     gtgaatgtcg atcactccac gatttaccgc tgggttcagc gttatgcgcc tgaaatggaa    104160
     aaacggctgc gctggtactg gcgtaaccct tccgatcttt gcccgtggca catggatgaa    104220
     acctacgtga aggtcaatgg ccgctgggcg tatctgtacc gggccgtcga cagccggggc    104280
     cgcactgtcg atttttatct ctcctcccgt cgtaacagca aagctgcata ccggtttctg    104340
     ggtaaaatcc tcaacaacgt gaagaagtgg cagatcccgc gattcatcaa cacggataaa    104400
     gcgcccgcct atggtcgcgc gcttgctctg ctcaaacgcg aaggccggtg cccgtctgac    104460
     gttgaacacc gacagattaa gtaccggaac aacgtgattg aatgcgatca tggcaaactg    104520
     aaacggataa tcggcgccac gctgggattt aaatccatga agacggctta cgccaccatc    104580
     aaaggtattg aggtgatgcg tgcactacgc aaaggccagg cctcagcatt ttattatggt    104640
     gatcccctgg gcgaaatgcg cctggtaagc agagtttttg aaatgtaagg cctttgaata    104700
     agacaaaagg ctgcctcatc gctaactttg caacagtgcc agtggaccta cctgtaccgg    104760
     gcagtcgaca agcggggcga cacgatcgat ttctacctgt cgccgacccg cagcgccaag    104820
     gcagcgaagc ggttcctggg caaggccctg cgaggcctga agcactggga aaagcctgcc    104880
     acgctcaata ccgacaaagc gccgagctat ggtgcagcga tcaccgaatt gaagcgcgaa    104940
     ggaaagctgg accgggagac ggcccaccgg caggtgaagt atctcaataa cgtgatcgag    105000
     gccgatcacg gaaagctcaa gatactgatc aagccggtgc gcggtttcaa atcgatcccc    105060
     acggcctatg ccacgatcaa gggattcgaa gtcatgcgag ccctgcgcaa aggacaggct    105120
     cgcccctggt gcctgcagcc cggcatcagg ggcgaggtgc gccttgtgga gagagctttt    105180
     ggcattgggc cctcggcgct gacggaggcc atgggcatgc tcaaccacca tttcgcagca    105240
     gccgcctgat cggcgcagag cgacagccta cctctgactg ccgccaatct ttgcaacaga    105300
     gccctcaata acgtgatcga ggccgatcac ggaaagctca agatactgat caagccggtg    105360
     cgcggtttca aatcgatccc cacggcctat gccacgatca agggattcga agtcatgcga    105420
     gccctgcgca aaggacaggc tcgcccctgg tgcctgcagc ccggcatcag gggcgaggtg    105480
     cgccttgtgg agagagcttt tggcattggg ccctcggcgc tgacggaggc catgggcatg    105540
     ctcaaccacc atttcgcagc agccgcctga tcggcgcaga gcgacagcct acctctgact    105600
     gccgccaatc tttgcaacag agcctccgtc gccatgctca cctcgctttg gtgcacacga    105660
     gtattgagca tagtcgagat tggtgcagat cacttctgat attgaactgt caggagctgg    105720
     ctgcacaaca gccattacgc ccaatcaact ggtgcagtcg tcttctgaaa atgacacatg    105780
     gcatctgaca tcaagttagg gtatgcctca atctgacggc tgcgaaccgc cagggacagg    105840
     cgcaatgtca gattctgtcg cggccttggc gcgtgcctgg aagcgttcat agcaatccag    105900
     cccgcagaaa tgttcgacgt attccgcgcc ttccggggtg aaggcggcat cgagcggaat    105960
     ttctttgcag catacgcagc aggtggtgca actggcagtg ttcggggcgt ttgcgttcat    106020
     ggtggtactc ctccagattg gtagcgaagc tcaaagctgc ccactctcgg ctggctggga    106080
     agcggtcatg atcttccctt gaaggcccgc agcagccgcg tcacagacag gacaaacaag    106140
     ccggtcagcg tgagggctgc aataccccag tgctccccga tgaacgcgcc ggccgtcgtg    106200
     ccggctagca caatggcgag aatcggcaaa tggcagggac aggtgagcac ggccagcgcg    106260
     ccccacaagt agccggtgat cggtttgtgc gtctcagacg gcaagtgctc tgggctgttc    106320
     atggcagact ctccgcgtgc tgtgccggtt cggttggcat ggcggccagt tgcatttcga    106380
     ggctggccag ggcctcgcgc cgacgctcga cgagttgccg caacacggca agctgcgcag    106440
     acgcaccgtc accgtccgca gcatccagcg cccggcacag ccgcgccagt gcgtccaggc    106500
     cgatacccgc ttcgaaggca gcccgtacaa agcgcagccg ttgcaacgcg gtgtcatcga    106560
     acaagccgta gccgcccgtg gtgtacgcga ccggccgtag caatccgcgc agcaggtagt    106620
     cgcgcacgat atgcacgctc accccggcat caagggccag ccgggacact gtgtaggcgc    106680
     tcattgaaca cctccttttc ctcatccggc gcagcacgaa agctgcttca cgtccttgct    106740
     gaaggtctgc gccgcgagct tcagcccttc gaccatggtc aggtagggga acaattggtc    106800
     ggccagttcc tgcacggtca tacggttgcg aatggcgagc accgccgtct ggatcagttc    106860
     acccgcttcc ggggccaccg cttgcacgcc gatgagccgt ccgctacctt cctcgatgac    106920
     cagcttgatg aagccgcgtg tgtcgaagtt ggcaagcgca cgcggcacgt tatccagtgt    106980
     tagcaggcga ctgtcggtct cgatcccgtc gtgatgtgct tccgcctcgc tgtagcccac    107040
     ggtggcgacc tgcgggtcgg tgaacaccac ggccggcatt gcggtcaggt ccagggccgc    107100
     atcgccgcca gtcatgttga tcgccgcacg agtgccggcc gctgccgcca catagacgaa    107160
     ctgcggctgg tcggtgcagt cgccggccgc gtagatgttc gggctactgg tgcgcatgcc    107220
     cttgtcgatg acgatggccc cctgcgcatt gacggctacc cccgccgctt ccaatgccag    107280
     gctgcgcgtg ttcggtgtcc ggccggtggc gaccagcagc ttgtcggcgc gcaattcacc    107340
     gtgcgtggtg gtcagcacga attcaccgtc catatgggcg acctggctgg cttgcgtgtg    107400
     ctccagcacc tcgatgccct cggcacggaa agcggctgtc accgcctcgc cgatggccgg    107460
     gtcttcacgg aagaacaagg tattgcgcgc cagggccgtg accttgctgc ccagccgggc    107520
     aaaggcttgc gccagctcca gcgccaccac cgacgagccg attacggcaa ggcgttcggg    107580
     aatggtgtcg ctcgccaggg cctcggtgga agtccagtag ggtgactctt tcaagcccgg    107640
     aatcggcggg accgccgggc tggcacccgt ggcgaccagg cagcggtcga acatcacgac    107700
     gcgctcgcca ccctcgttca aactaacgat aaggctctgg tcgtccttga aacgcgcttc    107760
     accgtgcaga acggtgatgg ctgaattgcc gtccaggatg ccttcgtact tggcatgacg    107820
     gagttcttcg acacgggcct gctgctgggc cagcagccgc tcgcgcaaga tcgtcggcgg    107880
     tgtgggtggc atgccgccgt cgaatgggct ttcccggcgc agatgggcga tgtgggcggc    107940
     gcggatcatg atcttggacg gcacacaacc gacgttgacg caggtgccgc cgatggtgcc    108000
     gcgctcaatc agcgtgacct gcgcgccttg ctcgacggcc ttcagtgctg ccgccatcgc    108060
     ggctccaccg ctaccaatga cgacgacctg caacgggcgt tcgttgccac tgggcttatc    108120
     agcggcccct atccagccgc gcatcttgtc gagcaggccg gcgcggttgt ccgtcggtgg    108180
     cgcatcggca agcgttgcct cgtagcccag tccggccacg gcggtagtca gcgcatccga    108240
     tgacgtgccc gcctcaatgg cgagttgcgc tgtgcccttc ggataggaca ccagcgccga    108300
     ttgcacgccg ggcactttct ccaaggcttc cttgacgtga gccgcgcacg agtcgcaggt    108360
     catcccggtg attttcaggg tggtcatgta tttttccttt tctgtggtgg ctacggctgt    108420
     tgccgtcagc cacgttgttc tggcaattca cagctgtccg gcccgcagcg gcgatgtgct    108480
     ggcgagatga aatcccagac cgacacccca accatcaagg ccaggccgac atagagcagt    108540
     ccaccgctct gccagccgta agcccgcatt aaaaacaccg ctgccagcac caagatcggg    108600
     cctatcgtgc cgagcgccgt gcgtcgccac tgtcgatgat tgagccaagc gatagcattg    108660
     gcgagtaacg cgatgccggc gaacatcggc agcaggatgc caatgaatag cccctcgtac    108720
     tggctcaaga agcccagtcc gatggccgcg ccaaagctgg cgatggcagg aaaacaggcg    108780
     gcgcagccca tcgcggaaac gacgctgccg agcgcgccgg ttttgccagc gatgcgcgtg    108840
     atgagtccca tgtgtcgctc ccgagttcgg ttaacggatc agcgtttgag gctggacgga    108900
     tagcccgcgt cctcggtcgc cttggtcaac ttctggacgt tggtcttggc atcgtcgaag    108960
     gtgacgacgg cctggcgctt gtcgaaactt acgtcggtct tgctcacgcc ctcaaccttg    109020
     gaaagcgcgt gcttgacagt gatcgggcaa gaggcgcagg tcatgccagg cacggacagc    109080
     gtgacggtct gggtggcggc ccacacgggg gcaacaacgg cagcgagggc gagggcggca    109140
     aacagttttt tcatgatgaa ctcctgtgat taatagaaaa atggcatgac gtagggaaat    109200
     ccgagcgaga ccaggaccag cgcggccacg atccagaaaa tgagcttgta agtagctcgc    109260
     acttggggaa tcgcgcagac ctcacccggt ttgcaggctt gcgccgggcg gtagatgcgc    109320
     cgccaggcga aaaacagcgc gaccagcgct gcgccgatga agatcgggcg atagggttcc    109380
     agcaccgtca ggttgccgat ccatgccccg ctgaacccca aggcgatcaa aaccagcggc    109440
     cccaggcagc aggccgacgc aagaatggcg gccagcccac cggcgaagag cgcgccgcgc    109500
     ccgttttgtg gttcagactt ttgtggttca gacatacgct tgtcctttca aatttggttt    109560
     ggatagctta agcttacttc cgtagttatg tacggagtca agcgatatgc aaattaattt    109620
     tgagaatctg accattggcg tttttgccaa ggcggccggg gtcaatgtgg agaccatccg    109680
     gttctaccag cgcaagggcc tgctgccgga gccagacaag ccctatggca gcattcgccg    109740
     ctatggcgag gcggatgtaa cacgagtgcg gttcgtgaaa tcggcccagc ggctgggctt    109800
     tagcctggac gaaatcgccg agctactgcg gctggaggat ggcacccatt gcgaggaagc    109860
     cagcggcctg gccgagcaca agctcaagga tgtgcgcgag aagatggccg acttggcacg    109920
     catggaggcc gtgctgtctg aactggtgtg cgcctgccat gcgcggaaag ggaacgtttc    109980
     ctgcccgctg attgcgtcac tgcaagacgg aacgaagctc gctgcatcgg cgcgggggag    110040
     tcacggggtg actacgcctt agcgtgcttt attttccgaa ttctgagacg acccctgtgt    110100
     gttgaaagac aagatgagaa ccatgatgtg tacgtaggta aattcatcca gttacatgta    110160
     gccgctaata agagccttaa gatcgtcgaa atgggcgatg tgaaactggt ggccataacc    110220
     agctcgattc ctaccacttt taatggtggg ataaagagat acaaaggggt tacgtatgtg    110280
     tcactttccc aaacagctca aaccactatc gacttcccga agcgtatcta caaagagggc    110340
     caggaatgta cttctgtcac cagtcctgac caaggtcctt tcgcccggga tgttaggttg    110400
     aattgctacg ggcgatgtgt tgtcaccggc gtaaggtccc cctggcgtac tgaggccgcg    110460
     cacttaacgc cacgtcatga agaaggcatt cccgacgtaa cgaacggaat tttacttcgc    110520
     cgtgatatcc atacactgtt cgacaatgac cattgcgcca taaaccctga cactatgaaa    110580
     atttacttca gccgggaggc ccgggagttg gatgatgatc tcctgaaatg gcatgggaat    110640
     gagatagaga cgacacgcat gcaggttccg gttaacatcg aaaaccttcg gatacgatgg    110700
     caaaaattta aggctaagga tcgtcagcgt aaataaagcc ataagctgaa ccacggcgag    110760
     gattagtctt gttcactaaa tgacagcgag agattaaatg caaacccaaa aagatattac    110820
     agttggccag atctgggaag aagtggatcc aagactgatc cggaaagtgc gagttgttga    110880
     ggtggcctcg ttagaagggc ccaaaggcat cctaatcgaa aacgtggagt ctggtcgtaa    110940
     gaactgggcg tcgtcatccc gctttaatgg aaagcgtgga gggtatcgtc ttatttcctg    111000
     aaggttttgc caatatggga aactgaagag gttgaaacca tcccggtgag ggagcatatc    111060
     tggtaaagaa gagtctttaa aaaggtttta cgcgacctgg gataataaac gggaaaacga    111120
     tacccaaaaa aagaatacag cgatgataac gataaggaat ggtaagggct tcaatatttt    111180
     gagaaatgac ctggcttcct ttgcatctgc atttctaatc aaactgtcca catagggatc    111240
     acagctctta ggttctgaat ttttcatatg ttctgtacct gaaattgatt ccgtatgaga    111300
     aaaggccacc gaagtggcct ctatcaaaac tggtggcaaa agttagatca ggaaatcatc    111360
     aagactttta ccggctgcaa tttgttctgc cagagctttg ggggtacggc cctgtccagt    111420
     ccacgttttt gtttcgccat tttcatcagt aaatgagtat ttggccgggc gtggttcacg    111480
     gcttttcttg gtagccgtag atttggcctg gaatgagcca agcagctctt ccgggttgat    111540
     accatcttct tccattaact tacgcagggc gtcaagtttc tcctgacgag cttgcagttc    111600
     ggcagctttg gatgattctt cctgacgacg ctcatcaaca atgacattaa gcttttcgag    111660
     gatttcctca agtacttcta aaggcagctc gcggccctgg gcgcgaagag tacgaatatt    111720
     gtttaacgat ttgagtgctt cagacatacg acctcacttt ctaattcttt gataaggatt    111780
     tacttaatca taatacactc tataaggaaa aagatgccag ctttatgtct tcaggtacaa    111840
     agatatcttg ctaagaatac tccttatctt ccttgtgcag actgtttcgt gctttcgatg    111900
     ttgttcatga gtcttaaaat ctgctcactg tttagggtac tcatgctgta aatcatcaag    111960
     aaggaagcgc agaacaacat aagcaatcgg aaaaggaaac catgccagtg acaggccata    112020
     tatggcggag ataaacatag ggtaatttaa ctcacttaca aaattcgctt cattgtattg    112080
     ttgaatcgaa atggcagaag caaaaattat aattaaagta agaaaaatcc actctagcca    112140
     tctcttttta taacaagcat aagcgaaagc tgtagggtaa aaaataaagc aaaaaattcc    112200
     agctgcaatt acgttcataa aagtaacttt cctgatagcg cagttatttt tcgaatgcag    112260
     catcatgaac aactgccata acattgatga ttggctttct ttttctgaag aaccttccgc    112320
     gcggcaaagt ttctcccgct ttgagacgat aaagccagaa aacataagcc ggaggaacat    112380
     tgctgtcaaa aatatctgaa caagtttgaa ctgtgatgcc tactgtattg tctttcctca    112440
     tctctttaaa agtgccttgc aatgcagcgg ataacgtcat ttttaagaaa cctttttctg    112500
     tttgaacgga tagacttgac ttagctggct tgactgtaat gtttgccact aaagatccct    112560
     cgttctgagg atgcaggcac tacaaagtta ccgtcaggtc taatcatacg agtttggatg    112620
     aaatttttgc cggatttggt tttttcaacc tggtgctcga tcttccattc ttctttgacg    112680
     ggaccggatg acaaatgaac tagaaccggt acttttttac gtgttctatc cagaacaata    112740
     caatttgatt tatccgtatc aacgcttccc tgaagagtat tcaaagagca attatcatat    112800
     ccctcaaccg gaactgcatt accttggata tcaattttga atcctccagc tattacaatt    112860
     tcgggtgcat tatcatttaa agtctcgtca taggcagcat caactacatc gcaagcagta    112920
     agagtaagtg acgatgccac agcaagacac aataaagaaa atctgttttt gagcatattt    112980
     gagacctttt ataaaaataa aataacagga gaattgtatc attaacagtc tagttctaac    113040
     gactaccact tttaagtatg tattgagcca gttttatatt caggcacacc atattgcact    113100
     ctagctcttt catcatccta gaagaactct taattaagta ttcttcaagt gggccagcat    113160
     atgcccctga tgtcacgatc gttagttgcg taagaggatg agtcaaactc tcaatgccct    113220
     tcaggatgtc attctggaca gcagaaatat aaacaggcga agccgcaatc aaatattcat    113280
     cattcggact ggactgcatt aactggctta tagttgcgca acggttatgc tttcctagtg    113340
     attttgtgat ggctttccac cagagatcat gcctgaatgg tacttgatga aatgtcgcct    113400
     cgtaagaggg cacccgatct cgactattta aaaaccccat cccggcagag attatccaca    113460
     actccagatt tctggttgag tttaaaattt cctttgccgt agaccagtga ttacctgaat    113520
     acaaggacaa tgccggtacc gcctgattac ttctggcgtc gtctacaatg ttactccagg    113580
     catatgctgc gtcgtccggg gtttgttttg gatctatgtc caatgtcggc cagacgtggc    113640
     cctgatgatt cttgcccttt gtacaggaag tgattaagtg tactgagcgt tcagagaaca    113700
     ttatcttcct tacataccca tagaacagct ttctaagaac ggtgggctcg cctgaaaatt    113760
     acaaatcagc ccctttcacg gcatcatttt gattcttcgc gtctgccccc agtaagatga    113820
     ccggttttct gcatgacagt gttattccta acaaacgcaa cacaaaacca cgccagccag    113880
     agcaaatttt ttcatttgct gcgtaaagcc tattgttttc tcttttaagc ttcgcccact    113940
     cgttacagag ggtaacatca tcaagcgctg ttatatgctt cgcctcacct tcgacgataa    114000
     cggtatggat accgtatgct gtaaatctca tactattttc cagaacccag ttgcggtatt    114060
     cgttgagtcc accttcggaa ccggtagctc tgcgccacat ttcaatttgc ttgtgtgatg    114120
     ggtcaagtgt acttgtcatt gaagcctcgt ctcagcgata acgcttgaaa tagcccgctt    114180
     tggtcaaaat gaaattagcc atctgactgg cgatttgatt gtatcttact catagtgccc    114240
     aacctatagg ttaaaaaggg gcattttcgc tttatagcgt gttcaacatc atcaatcatc    114300
     ccaagaaagg ctggcttatt aagccggtcc atcattttct gtatatctct catcaatttt    114360
     tatatccggc ctgaagtgca ccgttcaagc acaccgatca ggcagttagt cactagttaa    114420
     ctctttacta gagactaaat tccattgatt tacgtgacaa cgtcacgtca ttaaggtttg    114480
     caaatgccta attttcatac tatgggattt aattaggagt aaatcccaca ggtttacata    114540
     aagctgacat ttaaaagtgt taaaaatcaa tcagatagaa agaaaaggct ctccggaaga    114600
     actcttctca ttatttcgcc gcccggggtt attgctgaca gatctgaaag tgctaatatg    114660
     ttagtcatta gtaattagta aagcctttac tatgcgcgtt tctacgtaaa ttctattggt    114720
     tttagagggt cctgtccgag gacaataaag ttgtacacaa agcactaaag ttgtaaccat    114780
     tctcaaaaaa cgacgctaat gttgtatgct tactgaatgt gtggttatag ggttggagac    114840
     tataaaatgc acatataggt acgtatcaat gtcgttttta gggtacgatc atggctaggg    114900
     gtaggcgtct caaatcctat ttggattatg aaaatgcgct aggtgacggc ataggagtgg    114960
     gctatggcca aagttatcag ccctggctta gagctcagga cgttaaatcc cgtggaaacc    115020
     gttcgatagt ctttggcctt aagacgtttc gaaaccatca tctcctttct tctgtcgaaa    115080
     gtaacttttt ctatctggct gagtttaatg actcggtgat tgatatccgg gaacaattcc    115140
     cactctttcc tctccggctt acccaacaaa tagcaaatca tctacatttt caacatccta    115200
     tggtgagggg agtaagagga gtacctgtcg aagttctgaa tgttatgaca accgattttt    115260
     tactgacctt gagaactcct gaaggcggac ttcgatacaa agctatagca gtaaaacata    115320
     acgagagcat acctgaacgc gaagcccaaa aacttgaaat agagaggatg ttttggcagt    115380
     tgattgatgt tgagtttcaa atttatgttg gctcggaact caataacgtc gtcggtaaaa    115440
     acatttgctg ggctacttct gtattaagag atggttctga attttatgat aaatatcctc    115500
     ttgataaaat cctatggaag cttaaaccag atgtttatcc catagtagga ctacgtgcaa    115560
     tgatttcatc aatctttggg gtagatgcac aagaagcgat gatgttattg caggcaatga    115620
     ttggattaaa aatgataaat gttgatttat catatccaat actcgaaacc ggtctgataa    115680
     agataatttc caatgaccac tatataggac tgaacgcaaa tggatattat taggaattca    115740
     gtctggctct ctcaaggcac tgatttgctt gcagagggac tttaccgtgt tttggatttt    115800
     gacagaaagg tcgatttgtt aattttgttt aaaataaaat cagaaagaac gggtaagcca    115860
     atccctttct cattttcaat gtttaaatat tatattgaat caaatagcat aacttgtaaa    115920
     gattatatat atccttcata tatgttagta gatgagaaag aattaacaga taaagacaga    115980
     ggaaggcgag atgaaaatta caatatcatt aaagatcttg tagatgacag aatgtttctg    116040
     ttcgactatg cattacataa aaagtcgcac cttttaatgg attactcaag aaataaaaaa    116100
     atatcacaat atactatcag aacgcttctg gcgttgtatt ggcgacatgg gcaggatatt    116160
     tatgcattgc tacccgcatt ctcgaactgt ggcgccgctg ggaaaagtag aatcaaacat    116220
     gaaattaaac ttgggaattc caaaaaaaac agagcattac ctaatgaacg atcacgtgtt    116280
     ttcattctta atgaaagaga tataaataat attagaaaat ctctcattac gtatcattat    116340
     aaagttaacg gagatacgat aaagaaaaca ttagagagac atattgattt gtattttagg    116400
     gatgaaatta aaacagcaaa cctagaaaat agagctccat atgttccttc tttaaaacaa    116460
     ttttcatact ggaataaaaa actcttcact aaagatttct cgataaataa gaagaacacg    116520
     aaaaaagaaa tagacctcaa aatgcgggcg cttttaggta gtgtggctaa tacaactgtt    116580
     ttgccgggtg atgttttcga aatagactca actgtcgctg atgtacatct tatttcgagt    116640
     ttaaacagac gaaaagtcat tgggcgtcct actatttata cagtggtgga tcgtgcaaca    116700
     agaatgattg ttggccttca tgtttcttta taccatgctt catggcgagc cgcccgacaa    116760
     gcgttagcaa attgctttat gccaaaaaaa gaatattgta gattatttgg aatctctatt    116820
     actgatgatg attggccttg ttctcacatt ccattaacat tgatgtgtga caacggggag    116880
     atgattggtc ttaaacctca ggaagagatg acccccctga caaaacttga gtttgcgcca    116940
     gtcggtagag gcgacagaaa aagcattgtt gaacgctgtt tcggcattct gaatgatgag    117000
     gttattcata ggcttattgg aacaacacga aggggaaaga ttgttaaagg agagccaaca    117060
     ccgcaatcca gggcttgttt aacgattcag gaggtcacgt ctttactgat tcgggagata    117120
     cttgcacata atcagagaac gtatgaggaa ctggcttata tcaatccctt actgattgaa    117180
     aatgatctcg taatatcacc aaaaaatagt tggatgataa gcttaaagca cgggagattc    117240
     agcgcaagag ccgttggggc cgacgaagtg atcgcacgat tgttaatccc tgtgaacgct    117300
     aacattaccg ccggtgggat tcagtacaat aatctttttt atgaatgtga tcctgaaatt    117360
     gcatctggtg tcagagtatt tggaagaacc acttgtgaag caagaataga tgacaattgc    117420
     gtagattata tatatgtaag atttgacaaa aatagcattt tcaaaaaaca ttacctactt    117480
     aagaaaagag atgtatttaa agggaaagct catcttgata cagatgtaat ggctgattgg    117540
     gtagatactc aaaaagaaat taatttattt actctggatt cgctcagcaa tatcaataat    117600
     aaagatgaat ttaacaggaa aggtaacgaa agattaaatg aaatatacga atctcgccgg    117660
     gtacatggta aagatattaa aaagaacagg aaaaatgaac ttgattcatt agggcgaact    117720
     catgttgcta atggaagatc tgaaccccta cttccttcat ccagtaatgt tctgcttttg    117780
     cctggccggg aggagaaaca aagatggtta aaaggtaaga agaagactga ggacgcagaa    117840
     taatgaatct tatacggcgc gtttcagcga tatataaaga acaggagtta cctgagtatc    117900
     gtggcaatcc cttaattgaa gcacttcctg aagcgcttac ggaagatgaa gtacttctgg    117960
     aaatgagtta tttccccgaa attgacgaaa aaatccgctg gactgccccg gcgaatgtta    118020
     gagagcagta tgtcgaacgt ataaagaaat tccgttgccc tcaaaccaat cttatccagg    118080
     cttataagat gatcttacgg gcacttaggg aaagctatgc agctcgtaat cctttaaaaa    118140
     gcggaacaat tcaatatctt cattactatg gaaatgagcg tcctgatatt gagccagaaa    118200
     gtggatattt taaatcccag gctgaaacta ttacgatagt tggaatgagt ggttctggaa    118260
     aaactaccat gattgagcaa gtcatggatc atttccctca gattatagaa cacagcagct    118320
     ataaaggagt ttttcccggc ttcagtaagc aaattgtatg ggtaaagatt aattgtccat    118380
     acaattcaag tgtgagagac ctttgtgaag agattttaca aaaattagat gatgcaattg    118440
     gtattgaacg aactacacct gagattagaa atggtgctct ggctcgccag attgcacaaa    118500
     gaattaaatc atcatttttg ggtatccttg ttattgatga aatgcagagg cttaaatttt    118560
     caagaaccgg gggtgagagt aagttgattg attttttaca tgaaattgta gattccatgg    118620
     gggtatctat ggttttttgt ggaaatcatc cttttgacga gacgctgaca aagaaaatga    118680
     gaattgccag gcgggcagag tctggtggtt acatgaaaat taagaatgtt agatacgatt    118740
     cacaagactg gcaatcgttt attcattatt tatggccatt acaatggaca aatgttgaaa    118800
     ctccattaaa tgatgagtta aacgaaaaat tattcatttt atctaaaggc aatattggat    118860
     tggctcagat gatttatcgg ggggcacaat taaaggttat cggtagcggc aatgaaatca    118920
     tcactggcgc agtcttgtcg gcctctgtac cggtactcgt gagtcatacg gaggaatata    118980
     aggatactcc actcccgggg gccgcgactg aagatgagga agctaaatgg ctctctgcat    119040
     ctaatgaggg tgatgcttcg gctaaaatca tggcagagaa gtccctaaag tctttgatcc    119100
     ctggggatat agacaggcca cagcacaagg aattcgtagg aaaaatagac gaggttttgc    119160
     gcaatttcga cgagaaaata ctgtctcttg accacgatct tgttatcaac agaacagctg    119220
     aaaagaaaaa tacctacgat gctcttcagc gttgcgggct tataaatata gatccactta    119280
     ataaattgta atgaggtaac agttcgtaac ggtcaaagag aggtgtggga aatgagaatg    119340
     ttgcctgttt tgcctgatga atccttgttc agccggtttt gtcggacaac taccgtgtac    119400
     ggtatgtccc catcttctct gttaacgatc attttcaaca aacctgatat gaacgtccat    119460
     ccaattctca attcaggatt aaaggctatt tctcttcata catccgaaag tgcagatcag    119520
     ctctggcatg aacagacttt actccctctt tttgcctggg cactaccaat cagtcgtaat    119580
     gaaattatgg atttcaacac gacccctgcc aggcttaatc gattgtgccg ccttagtaat    119640
     ttttcactag ggcagcgcac actattgaag ttttgcccgg tttgcgctcg tgaagatact    119700
     tttcattatg gtgttactta ttggcatctg gcgcatcagc ttcatggggt tacaacctgc    119760
     catcggcatc cggtagcgct tgaaagcatc catgtccctt cttcaccgca catacgtatt    119820
     ggactgatgc ctcctgtttc gtatacagaa caacttagca atgagataga cttcgatttt    119880
     gctaagtttt gttatgagtc cctaaatata atcagaagaa aagatattac acaccccaat    119940
     tacatggatg tacttaaaaa gttgaattta ttatcattgg atggaaattt aaagaaaaat    120000
     gtattctacg cacatgttta tgctaagtgc cagttatttg gggagggttc atcgggactt    120060
     ataccaacat ccctaactga ttatcattac tgggagccta tactcaaaga caaatgttgt    120120
     cagcatccca caaagcatct tttgctttgt tattgtttgt taaatacttg ctggccaacg    120180
     tatgcaggaa gtcgtactaa taaaaagaaa gaaatcttta aaagtcataa gaaatacagt    120240
     tttcatatag ttgaaaataa tactagtgtt agcaaccttg ggaaggaatt tagtcgcagc    120300
     agatgttaca ttaaaacact tatttataaa aaatacctga gggcgtttaa gcgaaacaca    120360
     aaaattaata tattcactga attgcttatc aagtctatgg ctgtaagggg gtttagtctg    120420
     gcatccatag ctgagaaaaa ctcattatcg gaaggagctg tatcctctgt aatttcatct    120480
     tgttacggtt tatgctcatg gcgtaaaaaa tgtaaaaaag attctttaag acggcgtcat    120540
     aagcagaaaa tattaagatt tatacataat caatccgttt ctataacacg aaagttagtc    120600
     aaagaaagtt gttatgcaag tttctattgg ctaaataaac atgaatgtga ctggcttaat    120660
     tcctgtcttc ctaaaacaat acgatgctat aaaaataaaa gagtagactg gagcgagaga    120720
     gatattatct catcatcatt aataaatgat gttttatctc aggggcagta ctcgatgtca    120780
     cttacaagtc tagatgcttt actgggaggg catggctggc ttttgaaata cagagataaa    120840
     ctaccaatga caatgatact tctcagaaaa atggaactaa ttaaataaga gggagttata    120900
     tggtttacga aaatgaattg tggcacagtt ttcttctgcg ttcacagata atgtataact    120960
     tatccaattg caggaacata atatcaaagc atggcgcact aaggtacgat gcctttcctc    121020
     gtttcgaact gattgatatg tacaaattgc atagcttgca ggatatatat gacattcttg    121080
     ccactagaaa tggttatata ctaacttcca atatagtgtc gttatcttct ggtgtttacg    121140
     ggtattttaa cgctgttgaa gatgcctgtc ggaaaaattt tcacataact aattcatatc    121200
     cattggtaaa catctcaaac attcgttact gtcacaaatg tattgttgaa gatatacact    121260
     ctaaaggcat tggttatctg cgtcatagat ggttgtttga atctaaatgt gcagttcata    121320
     gtaccagttt atatgaggtt tgttttgata actatttgaa tgcagtgaaa ggacttagtg    121380
     acttaattat aagtggaata aatcctcatg gttattgttc ccttgtggtt gacgtttcaa    121440
     accctttcaa aaatccagtg tatatattac catgtgcacg taataaaatt ttaaaatgga    121500
     tttcggacaa taaaaatatg ctgatttact ttctctttga tctcttcaaa tgtaagtcgc    121560
     attcaagttt atctaaggtt atcgaagtca agataatgca tgatagatat atttctgcgg    121620
     tgttcaagat gttaagtgaa gttaattttt gtaatttcaa ctcatttatt tctgatattt    121680
     ttgaggacgt aagttatgcc tctatcggac ttgatgatta ttctgttaat gtgcattttc    121740
     tcaggctaag ggctgcagat tgtaaatttt gccagttgaa tggtaaatat ttttgctcac    121800
     tttacaatgt aaaacttctt cgctaatttc acttcattta taaaatacta agaaagctag    121860
     ttagataagg ttttatattt tgactggggc aggaataaat tatcactcat agagtttccc    121920
     tgggggttac cacctgtgta tgatgccggt tagcaacaac gtctaaaaga cctgcgatca    121980
     cgtgggtccc tctccagcaa aggggcaagg ggtgctatat aacggtgtac tgcttaccca    122040
     atacggcctt gtatttgaaa gatgccgcat cttggcagga ttcgtattac agcctatagt    122100
     ctgttaatga gcattacagc ctatatgctg taaatccctg cgttatgctt gttaactcgt    122160
     cgatacggaa ggtcacttat gaacactcaa tacgctttga agactttgaa tcagttacgt    122220
     cctgttttaa tcggctttcg caaagccaat ggactgacgc aaaaagatgt ttctgaacgt    122280
     ttgggtataa cacagcaaac ttatgcccga ctagaggcca accctgcaag tgcgggtttt    122340
     gagcgtttgt ttagggtgtt cagcgtcctt ggagtggaga tcgtactttc atccagggaa    122400
     ccattgtcag atgcaaagcc cgaatacgga gctatgcaca attattcttc acttccagcc    122460
     aggcgggaga aatggtgacg cctggcgctt cccggtctaa tttttcttca acaagattaa    122520
     ccccttagcg gcctgaagta tcaggttgcg atagagcctt tcatttcttc tgttatgtta    122580
     aatacaccat tttgagctat ttcgctcggc cttaaattat ctcttcattc ttcagtgaaa    122640
     attttatgtc gatcacatta tcgatgaatt taggaaataa tccgtaaatg aaaatctatc    122700
     ttcttttaaa ttcatcagtg tcagtagcaa atattacgca taaaagaatg gttattatta    122760
     tcatttaaat tataaagctc atgagtcaat tccaaaaaat ataataagca ttgaaatcat    122820
     tacccgtgat tctggagttt taactttgcc atgtaaccaa ccacaagtta gtttccggtg    122880
     ttttgagggg cagtaaagtt ctgaaagcgc gaccagatca taatcccgaa atgtcgttaa    122940
     gatattctga ataacggtta tccctgcttg ttggcaggca tttgaaaata tattttgtat    123000
     tcaggttgca gcaaaacgct ttcttacaca caggacttca tatgcggctc agaaaattaa    123060
     aactgaaaaa cttcagaggc tacagaaact ctactgaaat cattattgat gaaagcatga    123120
     cgggtattgt cggtcgtaat gactttggga aatcaacgct tctggaagcg ctggctattt    123180
     tttttgaaac agaaggaatg aaggctgaca agaatgacat gaactgtttc agcctaagag    123240
     aaggggacgg ccgttttgaa atagcctgtg aatttgatga cctgcccgat tttatcatga    123300
     tcgacgacag ggtgcagacc acgctcgcct cagaacatct gctgaatgag gacggcaatt    123360
     ttgaaatcgt caaaacgttt aaagcaacga cctcaggaaa accggagcag acctgcatcc    123420
     gctgcatcca cccggatgag gagcccctga gaaatttact gggcatgaaa atttctgagc    123480
     tcaaggcggt gggaaaagaa gttgaaaaaa atgtggcgga taaacgcact gcatcgttat    123540
     ggcgtcaggc catcagggaa gccgcagccc cctatacctg ttcggaaatt atgctggatg    123600
     tcgataaaga gttcggaacc gacacaaaat cattatgggg taagatcctc gatttgctgc    123660
     ccacgtatgc gattttcaaa gccgacaggg aaagcagcga cggggattcc gaagctaaaa    123720
     accccttaca gcaggccgta aaagacgctc aggctgcgct gcaggacaaa attacagcgc    123780
     tggaaaatga gattcaggac agcgtcctgg atgtcgcaca gagaacgctg gataaattac    123840
     gtgaaatggc ccccgaactc gccagtgaac tgactccacg atttaaggag aaacccaagt    123900
     ggaccttcaa tttcaccctg gacggggaaa atggcatccc catcaataag cgcggcagcg    123960
     ggataaggag gcttatcctg ttgaattttt ttcgggctga ggctgaaaag aatgtcgcgg    124020
     ggacgcccag aaatgtgatt tatgccatag aggagcctga aacgtcacag catccgaact    124080
     atcagatgat gctgatgaaa gcgttactgg cactggcagg ccagccgcac cgtcagatta    124140
     tcgtcaccac ccatgtcccg gcgctggccg gattaatccc tgtcgaaggc gtacgttatg    124200
     ttacccgaaa tgaggcgggt gaacccgtag taaaaatgcc ggatgacgca gtgctgaagg    124260
     aagccactga aagcctgggg gtgctgccag agaccggtat ggaaagggcg caggggattg    124320
     ttctggtaga gggaaagtcg gatgttactt tcctgaggca tgcggccagt tcattaaaac    124380
     agtcaggtgc gctgccagcc tctctggagg acgtgaaaat agtgccagtc ctcataggag    124440
     ggtgtggtag cgtcaaacac tgggttacat tgaatctggc caaagatctg gggcttccct    124500
     ggtgcgtatt tctggactcc gatattgggg gagaccctgc acaggttctg tccatccaga    124560
     agcgtaaaaa agaagtagag gaggccggta aggtattttt cgctacgcgc aaacgtgaga    124620
     tagaaaacta tctgtgcccg gatcttatcg aggaaattac tggtgtagcc gtcacgttta    124680
     cggacacctg tgacgctaaa aaaataatcg gccgggctgt gggaatgaaa cccgataatg    124740
     tactagataa attctggcct cagatgacat cagaaagaat catctcaaga tcaacctatc    124800
     atgacggaac gcaggagaga agcgagctgg ttgagatcct gagcgacatt gtatccatga    124860
     cgagataatg tattaaataa gcatctcagg tgcatatatt ccggtcctca acaaaggacc    124920
     ggagtacaga gtagtaaaaa cccgaaatta atcgggtttg aattatataa agattaaccg    124980
     actcccgcgc ccaggaacga tgtaaaatca cgcttgtcgt gacatttcta caatgtttac    125040
     ttttgactat caagccattt attcatctgc tcaatttcac ctttttgagc tttaatgatg    125100
     tcctgcgcga gctttctcat tttcggatct tttccgtatt tgagctcggt ctcagccatt    125160
     gctattgccc cttcatggtg cgctaccatg cctttcgcaa aagccttgtc gggatcggac    125220
     tcatttacgg cagccatcat tttgtcatgc atgtctttca tgccagccat atattcctgt    125280
     gacgaagccg aggtagacat atcagtcatt ttcatttctg aatgttctgc tgaaatcgct    125340
     ggcagggata acattaatac tgcaaataaa gtgtttctgg ctttcataaa aaatatcctt    125400
     ttagcgttga tgcccgttaa ctgtagcaga atctgataaa aatgccccct gtagggggca    125460
     aagatgttgc catatatccg gttacggaaa aatctatcaa ggaaataagg acagcacaga    125520
     tacttccctc gccgtcagcc tgcactgagc atgcgacgat gcgcttcggc catggcctga    125580
     tgtgggccag actgaccgtt attcataaat tcatgggcaa ctgcagctct ttcatgctca    125640
     ttcattgccg ctaatgactt cgacggcccg gtaggggaaa cggtctgact tcccatcatc    125700
     ctctgatgac tttccaccat tttctggtgc gcatccgccg acccgttcgt catggtttca    125760
     tgagcaataa tggcctgttc atgctggtcc ataccggcca tacgaggtgc agtcccctgg    125820
     atcccgacag gagccgcagc agactgcatc tggtgagcag gtgcctgtgc attgttgacc    125880
     cgctcatgga tattcacggt ttcagtggcc caggccgaag aaattaagcc aaagcccagc    125940
     aaggatgcta atacgatatt tttcatgata actctccatt tcttaattag tgatgtccgg    126000
     gggagtacaa ccggtgtttt cagttccata actgaaacag gttcggaagt gtttatttct    126060
     ccgggagggg actggatatt catttcctgg cgtccactga cgccggatat tgataaagca    126120
     atccagcctt cctgataagt tgcactaatt atatcgaatg gcttctgttt gctgcatgac    126180
     aggctaatga catctttgtc atttaaatct ttattcccag cactgggtgt ccggaatcat    126240
     tttctccagt ctgggcacgg ataagataaa acgcgttgag tgtacgtccg attccacctg    126300
     cactcttccg tgatgtgctt ccacgattga cttcacaatc gcaaggccga tgccgctgcc    126360
     ttctcctttt cgttgtctgg acggatccac ccgataaaaa cggtcaaaca accttgataa    126420
     atgctcttca gggattggtt tccccggatt ttcaatcaca aggtcaaaaa agctctcctg    126480
     ctctcttatt gagacggtga ttgcctgtcc ctccggggta taacgcaggg cattggataa    126540
     cagattattg atcgcccttc tgaacatttg tggatctccc tcaaccaggc agggcatccc    126600
     gttaaatttg agcgtgatat tgcgttcttc ggcccaggct tcgaaaaact cgaagacttt    126660
     catgacttcc gctctgaggt caaacatgac cctgtcaggt atcagctgat tattatctgc    126720
     ctgtgccagg aacagcatat cgctgaccat tttggtcatc cggttatact cttcaagact    126780
     ggaatagagg acatcctcaa gttccctctg tgttcgatcc tgactcagtg cgatttcagt    126840
     ctgcgtcacc agattggtga tgggcgttct gatctcatgc gcgatatcgg cagagaaatt    126900
     ggcctggcgg gtaaagacat cctcaatctt tccaatcata tgattgaacg agataaccag    126960
     ttgctccagc tcaatgggaa cgcgtgtcgg ttccagtcgc gcatcaagat tctcggaggt    127020
     gatgttttta atggcattgc tgacattacg aaggggcagg tgcccctgac ggacagcgat    127080
     tcgaatgatc agaacaatca acaggcttat cacgacggca atcgcaatca ggttcttttt    127140
     cagcgcatcg aggtaatgga gatggaaatt aatggatagg ccagtcagca tgacatagtt    127200
     ctgctgtttg ccctgaaata tcgcctgacc agaggaggcg ataatcctga atgtttccat    127260
     cttcatttcg gacccggtat ccatcggtcc cgcaggatcc tccaccgtcc agagaaagac    127320
     atcccgtgcg cggctgtgct cgctaaaatc tgctgaattc actgccgggc gtagtgccgc    127380
     cccctgagct gagctaaaga gcacttcccc cctgggattg aggagcaaaa gggcaacgtt    127440
     gcggtagctg gcaattgatt cctttatttt gcttattttt ttatcatccg gatccaccgg    127500
     ggactgcagt atacggttca gtgtggtgct gatttgttga agatcgctga catcctgctc    127560
     ggcaaaatga ttttcaacag aatgcagcat aaaccaggtg aatgcgataa aagccagtat    127620
     cgtggacagg ctgataaaaa aggtcagccg cagagcgagt gagaaagggc gtctggaagg    127680
     tttgctatgc atccgggacc tccagcatgt agcccacgcc ccggactgtc tggatcagct    127740
     ttgtctcgta atcgttgtct attttagcgc ggagtcgctt tactgcgaca tcgatcgcat    127800
     tagtgtcgct gtcaaaattc atgtcccaga cctgagaggc aatcagggag cggggaagaa    127860
     cctctccctg atggcgaatg aagaattcca gcaggctgaa ctctttactg gtgagcacaa    127920
     tgcggtttcc ggcgcgactg acttttctgg atacgagatc aatcgagagg tcagccacct    127980
     taaactggct ttccgtgatc atcgtgtttc cccgcctcag aagggttctc acccgggcga    128040
     gcagttcggc aaacgcaaag ggtttaacca gataatcgtc cgcacccagt tccagtcctt    128100
     tgaccctatg ttcgatcgtg ccgagggctg tcagcagtaa gaccggcata ccctttccgg    128160
     cagtgcgcag catgcggatg atatcccagc cgttcacatc aggtagcatg atatccagaa    128220
     tgactaaatc atactcggct gtcatggcga gatgatatcc ggtaagacca ttatcagcgt    128280
     gatccactac gaaccctgcc tctgtaagcc ctttgctgag atattcacct gttttaattt    128340
     cgtcttcgac gatcaatatt ttcatcttgc tccccggctg gctgctaatg tcattctatt    128400
     gcgcccacga tcgttatcaa cggattacag caaaaatgac aacattgtca ttatcctgtc    128460
     acccggcaaa cagagagcgt taggtaaagt acccctatca atactctgga cttcatttga    128520
     accatttacc aggtctgcct ggacgagaag cgttatgttc aaattaaaat tactcagcat    128580
     tagcacgata ttcatcctgg caggctgcgt gtcgcttgcg cctgaatatc agcggcccgc    128640
     agcaccggta ccccagcagt tttcactgtc ccataacagc ctgacgccag cggtaaatgg    128700
     ctatcaggat acgggctggc gtaacttttt tgtcgatccc caggttaccc ggttgatcgg    128760
     tgaagctctg actaataacc gtgatttgag aatggctgcc ctgaaggttg aagaggcccg    128820
     agcccagttc aacgtcacgg atgcagatcg ttatccccag ctgaatgcct catccgggat    128880
     aacatacagc ggtggtctga aaggtgacaa gccgaccaca caggagtacg acgcgagact    128940
     ggagctcagc tatgagctcg attttttcgg caaacttaag aacatgagtg atgctgatcg    129000
     ccagaactac tttgccagcg aagaagcccg tcgggccgta cacatcctgc tggtatccaa    129060
     cgtttcacaa agctatttca gccagcaact ggcgtacgaa caacttcgta ttgcgcggga    129120
     aacgctgaaa aattatcaac agtcctatgc tttcgttgag cagcagctcg tgaccgggag    129180
     tacgaacgtt ctggcacttg aacaggcgcg aggacaaatc gaaagtaccc gcgccgaaat    129240
     agccaaacga gaaggcgatc tggctcaggc aaacaatgcc ctgcaactgg tgctgggaac    129300
     gtaccgcgca cttccgtcag aaaaagggat gaaaggcggg gagatagccc cagtaaaatt    129360
     gccaccaaat ctgtcttcac aaattttgct gcagcgaccg gatattatgg aagcggaata    129420
     tcagctgaaa gcggctgatg ccaatattgg cgcagcgcga gcggcctttt tcccctcaat    129480
     taccctgacc agtggtcttt ccgcaagcag tacggagctg tccagcctgt ttacgtcagg    129540
     aagtggaatg tggaatttta tccctaaaat tgaaattcct atatttaatg ctggcaggaa    129600
     taaagccaat ctgaagctgg ctgaaattcg ccagcaacag tcggtggtta attacgaaca    129660
     aaaaattcag tcagccttta aggatgtttc cgacacgctt gcgctgcgcg acagccttag    129720
     ccagcaactt gagtcacagc agcgttatct tgattcactt cagataactc tccagcgtgc    129780
     cagaggattg tatgcaagtg gtgctgtcag ttacatcgaa gtgctggatg cagaacgttc    129840
     cctcttcgct acccagcaaa ccattctcga tcttacctat tcccggcagg ttaacgaaat    129900
     taatctgttt accgcgctgg gtggcggttg ggtagagtaa atttatttaa ttaatcagga    129960
     aattaaaatg cgtaattcac ttaaagccgt tttatttggt gccttctctg tcatgttttc    130020
     tgccggtctt catgctgaaa cacatcagca tggcgatatg aatactgcca gtgatgcttc    130080
     ggtacagcaa gttatcaagg gcaccggtgt cgttaaagac attgatatga atactaagaa    130140
     aatcaccatt tcgcatgaag caattccagc ggtgggctgg cctgcaatga ccatgcgctt    130200
     tacttttgtt aatgcagacg atgctattaa tgccctgaaa acaggcaacc atgtcgattt    130260
     ctcgtttatt cagcagggca atatctcctt actcaaaagc attaacgtga cgcagtcctg    130320
     attggctgtc cggagcgatt acatcctgtg cgcctgtaca ttcacatagg tatatgtgtg    130380
     agttaaccgt caggcgcata tgccaggtgt tttgattttt tagcggaaaa ttgtatggct    130440
     tctttaaaga taaaatatgc tgcaataatt atcagcagcc tcatagcagg ggggctgata    130500
     tcggttactg cctggcagta tgtaaactca gcacaaaaga cagaaaaaac agaacaaaag    130560
     gcaccggaac gaaaggtgct tttctggtat gacccaatga aaccggatac caaatttgat    130620
     aaacccggaa aatcgccctt tatggatatg gacctggtgc caaaatatgc tgatgacagt    130680
     ggcgataaaa gcagtggcgg gatccgtatc gacccaaccc aggttcagaa tctgggatta    130740
     aaaacgcaaa aagtcacgcg aggaatgctg aattattctc agacaatccc ggctaatgtc    130800
     agctataacg agtatcagtt tgttattgtg caggcgcgtt ctgacgggtt tgtcgaaaaa    130860
     gtctacccca tgacgattgg cgatcatgtg aagaagggga cgccacttat cgatattacc    130920
     attccggact gggtggaagc acagagtgaa ttccttctgt tatccagcac cggtggtact    130980
     tccacgcaaa ttaaaggcgt tctggaacgg cttcgcctgg caggtatgcc ggaagaggat    131040
     attcagagac tgcgttctac ccggagcatt cagacccgtt ttaccattaa agcacctatt    131100
     gatggtgtca ttactgcatt tgacctgcgc accggcatga atatttcgaa agataaggtg    131160
     gtggctcaga ttcagggaat ggacccggtc tggatcagcg ctgcagtgcc agaatctatc    131220
     gcctatctgc tgaaagatac gtcgcagttt gaaatttcgg taccggctta tccggataaa    131280
     acattccatg tcgaaaaatg gaatattctt cccagcgtgg atcagacaac ccgtacgctt    131340
     caggtccgtc tccaggtttc taataaggat gagtttctca agccgggcat gaatgcctat    131400
     ctgaaactga ataccagaag ccaggagatg ctgctgatac caagccaggc cgttatcgat    131460
     accggcaaag aacagcgcgt gattactgtt gatgatgaag gcaagtttgt gccgaaacag    131520
     atccacgttc tgcatgagtc acagcaacag tccggcatcg gctccggcct gaatgaaggc    131580
     gataccgtgg tggtcagtgg cctgttcctc attgactctg aagccaatat tacgggcgca    131640
     ctggaacgta tgcgccaccc tgaaaaaaca gaaagcagta tgccagcaat gtctgaccag    131700
     cctgtaaata tgcattcagg gcactgagga gacgacgatg attgaatgga ttatccggcg    131760
     ctctgtcgcc aaccgtttcc tggtcatgat gggggccctg tttctcagca tctggggcac    131820
     atggacgatt attaacacgc ctgtcgatgc cttgcctgac ctgtcagatg tgcaggtcat    131880
     tatcaaaacc agctatcccg gccaggcccc gcagattgta gaaaaccagg tcacctatcc    131940
     acttaccacc accatgctgt ccgtgcctgg cgcaaaaacc gtgcgtggtt tttcacagtt    132000
     cggtgattcg tatgtgtatg tcatttttga agacggcacc gatctgtact gggcccgttc    132060
     ccgcgtgctg gagtacctga accaggtaca gggaaaactg cccgccggtg tgagttctga    132120
     aatcggtccg gacgccacgg gggtgggctg gatatttgaa tatgcccttg tcgatcgcag    132180
     cggaaaacac gacctttcag aactgcgttc tctgcaggac tggttcctga aatttgagct    132240
     gaaaaccatc ccgaacgtgg ctgaggtcgc ttcggttggc ggcgtggtga aacagtacca    132300
     gattcaggtc aatccggtaa aattgtctca gtatggtatc agcctgcccg aagtgaaaca    132360
     ggcccttgaa tcgtctaacc aggaggccgg tggctcatcc gttgaaatgg ccgaagctga    132420
     gtatatggtc cgtgccagcg gttatcttca gagcattgat gattttaata acatcgtcct    132480
     gaaaacaggc gagaacggcg tgccggttta tctgcgggat gttgcccgcg tgcagaccgg    132540
     gcctgaaatg cggcgtggta ttgccgagct gaacggccag ggcgaagtcg ctggcggcgt    132600
     ggtgatcctg cggtcgggta aaaatgcacg cgacgttatc acggcagtga gggataaact    132660
     tgagacgctg aaggccagcc tgccggaagg cgttgaaatc gtgaccacct acgatcgcag    132720
     ccagctcatc gaccgggcga ttgataacct cagttccaaa cttctggaag agtttatcgt    132780
     ggtggccatc gtctgtgccc tgttcctgtg gcacgtacgt tctgccctgg tggcgattat    132840
     ctctctgccg cttggtctgt gtatcgcctt tatcgtcatg cacttccagg gactgaacgc    132900
     caatatcatg tcgctgggag ggatagcgat tgccgtcggt gcgatggtgg atgccgccat    132960
     tgtgatgatt gagaatgcgc ataagcggct tgaggagtgg gatcatcagc atccgggtga    133020
     gcagattgac aacgccaccc gctggaaggt gattaccgat gcctccgttg aagtgggacc    133080
     cgcactgttt atcagcctgc tgatcatcac cctgtccttt attcctatct ttaccctgga    133140
     aggtcaggaa ggacgtctgt ttggcccgct ggcattcacg aaaacgtact ccatggcggg    133200
     cgcggccgcg ctggccatca tcgtcattcc gattctgatg ggattctgga tccgggggaa    133260
     aattcctgca gagaccagta accccctgaa ccgggtactg atcaaagcgt atcatccatt    133320
     gctgttgcgg gttctccact ggccaaaaac aaccctgctg gttgcggcct tgtccatttt    133380
     caccgttatc tggccgctga gccaggtggg cggtgagttt ctgccgaaga ttaacgaggg    133440
     cgacctgttg tatatgccgt cgaccctgcc gggtgtctct ccggctgaag ctgcagcgct    133500
     cctgcagacg acggacaagt taatcaaaag cgttcctgaa gtggcctctg tatttggcaa    133560
     gaccggtaaa gcagagaccg ccacggattc cgcaccgctc gaaatggttg aaaccacgat    133620
     ccagctcaaa cctgaggatc agtggcgtcc aggcatgacg attgacaaga ttattgaaga    133680
     actcgacagg accgtccgtt taccggggct ggcaaacctc tgggtgccgc caatccgtaa    133740
     ccgtattgat atgctctcaa ccgggatcaa aagcccgata ggtatcaagg tgtccggaac    133800
     ggttctgtcc gatatcgatg caacggcgca gagtatcgaa gcggtcgcca aaaccgtacc    133860
     cggcgtagtg tctgctctcg cagagcgact ggaaggcggg cgctacattg atgtggatat    133920
     caaccgggaa aaagcctccc gctacggaat gacggtgggc gatgtgcagc tgttcatctc    133980
     atcagccatc ggcggcgcga cggtagggga aacggttgaa ggcgtggccc ggtacccgat    134040
     taatatccgc tatccgcagg attaccggaa cagcccgcag gccctgaaac agatgccgat    134100
     cctgaccccg atgaagcagc agatcacgct gggcgatgtt gcggatatta aggtcgtttc    134160
     cgggccgact atgctgaaaa cggaaaatgc ccgtccagcc agctggattt acattgacgc    134220
     gcgcggcagg gatatggtgt cggtggttaa tgacattaaa acggcgatca gtcagaaagt    134280
     gaaactgaga ccgggtacca gcgtgtcatt ctccggacag tttgaactgc ttgagcatgc    134340
     caacaagaaa ctgaagctga tggtgccgat gacggtgatg atcatcttca tcctgttgta    134400
     tctggcattc cgccgggttg atgaagccct gctgatcctg atgagcctgc cgttcgccct    134460
     ggttggcggg atatggttcc tgtactggca gggcttccat atgtctgtcg caaccggaac    134520
     ggggtttatc gctctggccg gggtggcagc agagtttggc gtggtcatgc tgatgtatct    134580
     gcgtcatgcc attgaagcgc acccggaatt gtcccgtaaa gagacgttca caccggaagg    134640
     ccttgatgaa gccctctatc atggtgccgt actgcgtgtc cggccgaaag ccatgaccgt    134700
     ggcggtgatc attgcgggtc tgctgccaat actctgggga accggtgcag gttcagaagt    134760
     catgagccgt atcgcggcac ccatgattgg tgggatgatc acggctccgc tgctgtccct    134820
     gttcattatt cctgccgcct acaaattaat ctggctgcgc agacataaaa aaagcgtgtc    134880
     ctgaacctga aagggcaccc cctgtgggtg tccttcttta ctgattcacc ctgacgtcag    134940
     ggtttaaatc gataatatac agaggtgagt atgaaaaaag tggttctgat ggcgctggct    135000
     ctcggccttt cactgcccgc gatggcgagt gaaaaagtga ttgatatgta caaatctgaa    135060
     aactgtggct gttgttccct gtggggcaag gcgatggaaa aagacgggtt tgaagtacga    135120
     actcacgtca tgaatgatca ggcgctgtca gccctgaaag aaaagcatgc tattcctgca    135180
     ggactgcgaa gttgtcatac cgcggttgcc ggtaatttga tcattgaagg ccatgtgcct    135240
     gcgacaacga tacataaggc aatgcagtct ggttcaggta tatacggtct cgccaccccc    135300
     ggtatgccag caggaagtcc tggaatggag atgggagccc gaaaagaggc ttacgatgtt    135360
     atcgcattct caccggatgg aagtaaaaaa gtcttccagc gaatcgaata gtcagcggaa    135420
     cggctgataa cgggacgccg gtagcaggca ctcctgtgcc ggcgatattc gtggtaatcg    135480
     catccatgac ataccctgaa gacagaagat gcttcggtat gcataaggag agttactgtg    135540
     aaaaatgaca atgcagtgca acacaacaac cagactgctt ctgagcagac attatccccg    135600
     gacgagggcc acgtattgca taaggtgaga gatcccgtgt gcgggatggc catcctgccc    135660
     gacagggcgc acagcagcat tcgataccag gaccatcaac tttatttctg ctccgccagc    135720
     tgtgagagta aatttaaagc ccatcccgat cgttatctta ccgaagatgc cagtgaacat    135780
     tcccatcacc atcaccacga tcatcacgaa gtcagccctg atcagataaa acagcctcac    135840
     caccaggcgg aaaaagagaa ttctgaaggt gtgtggacat gtccgatgca cccggagata    135900
     cgccgcagtg gtcccggaag ctgtcctgtc tgtggaatgg cactggagcc gctcgtagct    135960
     acggcatcca cggggccgag tgatgaactt cacgacatga caagacgctt ctggctgggg    136020
     ttgttgctgg cgtttccggt tctggtactc gaaatgggat ctcatctgtt tcccgagttg    136080
     aggaatacag taccgccaca gtacaacaca tggctgcagc tgcttctggc ctcccctgtc    136140
     gtgttgtggt gtggctggcc attcttcgcc cgggccggaa tgtcgttacg taaccgctcc    136200
     ctgaatatgt ttacccttgt tgcaatgggg accggcgtag cctgggttta cagcgtcatt    136260
     gcaaccgtct tcccctcctg gtttcctgca tcgttcagaa acatggatgg cctggtggcc    136320
     gtttattttg aagccgcagc agttattacg gtgcttgttc tgctgggaca ggttcttgag    136380
     ctgcgggcac gggaacaaac ctcaggcgcc attactgcgc ttctgaacct tgcccccaaa    136440
     accgccagac ggctggatca tgacggtcat gaaacggata ttaatgcgga agatgtcctg    136500
     cctggcgata agctccgcat cagacctgga gagagtattc cggtcgacgg tatcgtgatc    136560
     gaaggcaaaa caaccgttga tgaatcgatg gtgaccgggg aatctatgcc ggttaccaaa    136620
     acggagggtg accctgtcat cggggggacc attaatcaga cagggagtct catcatccgt    136680
     gcagagaaag tcggtgatga aacaatgctc tcacgaattg ttcagatggt cgctgatgca    136740
     cagcgttcgc gtgcccccat ccagagaatg gctgacagcg tttcaggctg gtttgttcct    136800
     ctggtgatac ttatcgcggt tgttgctttc gtgatctggt ctgtctgggg gcccgagccc    136860
     aggatggcgc acggtctcat tgcggctgtg tcggtcctga ttattgcctg tccctgcgcg    136920
     ctggggctgg ccacgccgat gtcgataatg gtgggggtgg gcaaaggagc ccaggccggg    136980
     gtgttaatca ggaatgccga agcccttgag cgtcttgaaa aagtggacac gctggttgtc    137040
     gacaaaacag gcacgctcac ggaaggttcg cctacggtga cagggattat cagtctcaat    137100
     ccgggtgggg aaacatctct tttgcgtgta acagccgcag tggaaaaagg ctcgcagcat    137160
     ccgctgggta tggcagtagt taaagcagca caggaaaagg ggatcgcaat acccgcagtc    137220
     actcatttcg atgcaccgtc gggtaaaggt gtctcaggcg atgtcgaagg tcaacgggtt    137280
     gttattggta atgaactggc tatgcaggaa aacagtatag ttattgataa tcaaaaggcc    137340
     gttgcggata cgttgcggat ggaaggcgct accgttatct atgtggccac agacggggac    137400
     cttgcaggcc tgatagctat ctcggatccc gtgaaaacaa ccacgccgga tgcgcttaaa    137460
     gctttgcgtc aggcggggat ccgcatcgtt atgctcaccg gggataacca gcttactgct    137520
     gaagcagtcg cacggaaact gggaatagat gaggttgaag ccggaattct gccggatggc    137580
     aaaaaagcag tgataacccg actgaaagag tctggccatg tggttgcgat ggccggagac    137640
     ggtgtgaatg atgccccggc gctggcagcg gctgacgtgg gtatagccat gggaacgggt    137700
     acagatgtgg caattgaaag tgccggagtc acccttctca aaggcgactt gatgatactg    137760
     aacagggccc gtcatctgtc agagatcacc atgaaaaata tccgtcagaa tctgtttttt    137820
     gcatttatct acaacgcact tggcgtgcct gtggctgcag gtctgcttta tcctgtgtat    137880
     ggaatactgc tgtcgccagt tattgcggcg gcggccatgg ctctttcctc cgtcagcgtc    137940
     attgtgaatg cgttgcgtct gaaaagtgtc aggctcggga aataacactg agtgaagggt    138000
     cagttacgaa cagaaggagt ccagtatgaa aagtaccacc tatgcgctta ttgctgtcgc    138060
     cgcgatcgcg gcatttgccc tcctgcgcga acactggtca catgtggcag gttactggcc    138120
     atatctgtta ttgctggtct gcccgctaat gcatcttttc cacggccacg gagggcatgg    138180
     agatcatcaa catcacggaa gtgaaaacga taaaaaaaat taatccggca gacggggccg    138240
     cgtcgcggtc ccgttatcag tccaggtatc gttcgtagtc tctggcatgc gcaaaggcat    138300
     gctgttcgag tttgttatca gcgggtgccg ctgcccggaa cgccagagag ttaacagggt    138360
     tgttattgat gaccagctcg taatgcagat gaggaccgga tgaacgtccg ctgttaccgg    138420
     ataacgcaat agcacctccc cgtgtaaccc tggccccttt agtaacgagt attttattga    138480
     ggtggagata gcgagtttta acaccggctt ttcccgttac ttcaacaaaa tatcccatgg    138540
     tactgttgta ttcggcccgg gtgatttttc cgtcgatgac gctgactatt ttcgtgttca    138600
     tgggcatgga ataatcaatg ccattatggg gactcacttt tcccgatacc gggttaagtc    138660
     ttgcaggatt gaaaggcgaa ctgagtcttg ctgtggccgg taacggataa tcgagactgc    138720
     ctttcccgga agtatcggaa aggttataga actttttatc tgatatacga tacgccgtgt    138780
     aattaaatga accggacgta aatttatagg ccacgacacg tgattttccc gctttctttt    138840
     gcagtacgag ttttaatgat tcattttttt tcaaatgccg cagattaaac cgggaaggca    138900
     aggagcgctg aagagtagcg atctcgttcg attccagccc cgagcgggtg gctgaaaggt    138960
     aggcattttc ttttacgaca tcggtagaat acatttactg gaattcgccg ttagcatgaa    139020
     cactgcggcg tatgctaggg gttttcagga ggcgtgtcat ctgtcagtta atcgggagca    139080
     ccgttgatgg tcgtcatttt tgtaacatat cttgtttccc gtttgctcct gaagctctgg    139140
     gaactgtatg accagcccga cggtgatgat taacgggact gaaacaggtt acggcagagc    139200
     aatatggggc tcatgtcctg ctacgtaacc cgtcagtaaa gccctgctgc gcacctgacg    139260
     ctaagcacta acccgcctgc agttacctgg tcgaatacag cccgcgaagc tttcttgcct    139320
     gcgtctgatg tgcttccgca ccggcattat tgacctgctc atgcacgaga gcggcttttt    139380
     ctccggcatt cagttcgtta aaagaagaag acgaggtctt tgaatttgca tcactgccgg    139440
     acagcatttt tttatgttcc tcaatcattt tctgatgcgc ataggacgcg ctgttgttca    139500
     taaatgaatg agcaacaatg gccctttcat gttcattcat ttcagagaat gagggcgtgt    139560
     tgtttttatt aaccctgtcc ggtaagtttt catgcgtcga ggaattcaca tgactgacgg    139620
     ctgaggcatt attaacaaat cgatgtgctt catgggcaat atcactggac tgagcaaaag    139680
     ctgccccaca aaataaagct gtaaacgcag tggtcgtgat taatatattc atgtgtaatt    139740
     accttctgag gtacataaaa gatgtcctta tgatcatata taaaaataat caacctgtgg    139800
     ggaagatgac gtaaatgtaa tacagctatg tacattacac gattgtaatg aatttgtttc    139860
     ttaaggtgtg ctagattcat ttcattgtaa gtggatgaac cagtaattta atttaaatcg    139920
     gttctcgaat tctgtcagta accatacttt aaataaggga atgcgcatgc tgttgaaaac    139980
     gtctcgacga actttcctga aggggttaac cctctctggc gtagccggaa gtcttggcgt    140040
     atggagtttc aatgcgcgtt ccagtctgag cctgccagtt gccgcatccc tgcagggtac    140100
     tcagtttgac ctgaccattg gtgaaacggc cgtcaatatc acgggcagtg agcgtcaggc    140160
     caaaacaatc aatggaggcc tgccggggcc cgttcttcgc tggaaagaag gtgacaccat    140220
     taccctgaag gtcaaaaacc gtcttaatga acagacgtcc attcactggc acggcattat    140280
     tcttccggcc aatatggatg gtgttccggg gctgagtttt atgggcatag agcctgatga    140340
     tacctacgtt tacaccttta aggttaagca gaacgggact tactggtacc acagccattc    140400
     cggtctgcag gaacaggagg gggtatacgg tgccattatc atcgatgccg gggagccaga    140460
     accgtttact tacgatcgtg agcatgtggt catgttgtct gactggaccg atgaaaatcc    140520
     tcacagcctg ctgaaaaaat taaaaaaaca gtcggattac tacaatttca ataaaccaac    140580
     cgttggctct tttttccgcg acgtgaatac cagggggctg tcagccacca ttgccgatcg    140640
     gaaaatgtgg gctgaaatga aaatgaatcc gactgacctc gcggatgtca gtggctacac    140700
     ctacacctat ctcatgaacg ggcaggcccc gctgaaaaac tggaccggac tgttccgtcc    140760
     cggtgaaaag atacgcttac ggtttatcaa cggctcggca atgacctatt tcgatatccg    140820
     tatccccggg ctgaaaatga cggtcgtggc tgcagatggc cagtatgtaa acccggttac    140880
     cgttgacgaa ttcaggattg ccgttgccga aacctatgat gtcattgtgg agcctcaggg    140940
     tgaggcctat accatcttcg cacaatccat ggacaggacc ggttacgctc gagggacact    141000
     ggccacgaga gaggggttaa gtgctgccgt tccccccctc gatccccgtc ctctgttgac    141060
     catggaagat atgggtatgg ggggaatggg acatgatatg gcaggaatgg accacagcca    141120
     gatgggaggc atggataaca gcggagagat gatgtctatg gacggtgctg accttccgga    141180
     tagcgggaca tcctccgcgc ccatggatca cagcagcatg gccggtatgg atcattcccg    141240
     gatggccgga atgccgggta tgcaaagtca tcctgcgtca gaaacggata acccactggt    141300
     tgatatgcag gcgatgagcg tctctccgaa attaaatgat ccgggtattg gtcttcgaaa    141360
     taacggaaga aaggttctca cgtacgcgga tttgaaaagc cgctttgagg atcctgacgg    141420
     acgtgaacct ggccgtacca tagaactgca tttaaccggc cacatggaaa agtttgcctg    141480
     gtcatttaac ggaatcaagt tttcagatgc cgcaccggtg ctgctgaaat acggtgagcg    141540
     gctcaggatc acgctgatca acgataccat gatgactcac cccattcacc tgcatggtat    141600
     gtggagcgat ctggaagatg aaaacggtaa tttcatggtt cgtaaacaca caatagatgt    141660
     tccccctggt acaaaacgca gttacagagt gacagcagat gcgcttggcc gctgggcgta    141720
     tcactgccat ttgctctatc acatggaaat gggaatgttt cgtgaagtcc gggtggagga    141780
     atgatgcgaa tgaagagaaa tttgaaggcc atacctgttc tggtcgccgg tttgtttacc    141840
     tcacagcttt ctattgcggc gggctccgtc tctgcagatc cccacgccgg gcacgacatg    141900
     tctgccatgc agatgccagc agatgagaat ttcactgaga tgacgtcaat ggagcccatt    141960
     gtaactgaga gcagaacgcc aattccgcct gttaccgatg ccgaccggaa ggctgcattc    142020
     ggcaatttac aggggcatgc gattcacgac agtgcgatta attatctggt tctgctggat    142080
     caactggaat ggcaacggtc ggataacacc aacaatttca gctggagtgt taacagctgg    142140
     attggaggcg acacagatcg gatttggcta aagagtgaag gtgaacgaag caatggggaa    142200
     acggaggcgg ctgaagcgca gttactctgg ggacatgcgg ttggcccatg gtgggatttg    142260
     gttgcgggtg tcaggcagga tttcagacct gcttctgccc ggacctgggc tgctgtcggt    142320
     tttcaggggc tggcactcta taattttgag tctgaaatta cgggttttgt cagtaatggc    142380
     ggaaaagcag cccttcgtct gggaggagaa tacgacgttt tactgactaa ccggctcata    142440
     ctccagccat cctatgaggt gaatttctac agtcaggatg atgaatcgcg gggtcgcggc    142500
     aggggactga ctgacacaga gctggggctc cggctgcgct atgaaatacg ccgtgagttt    142560
     gcaccctata taggcgtttc ctggaatcaa ctttacggga aaacatccga tatggcgaaa    142620
     agagaaggtg agaaagacca tcaggtagta ttcctggcgg gagccagaat ctggttttaa    142680
     cgcactgata taaaacactc aactaaacag gtaaataaaa tgtcgatttt aaataaagcc    142740
     attcttacag gtggcctcgt tatgggcgtt gctttctctg ctatggccca tccggaatta    142800
     aaaagctctg tgccacaggc tgattcagcc gtagcggccc cggaaaagat tcagcttaat    142860
     ttctcggaaa atctgaccgt gaaattctca ggtgcaaaat taacgatgac gggtatgaaa    142920
     ggcatgtcat cacattctcc gatgccggtc gcggcaaaag tggcgccagg cgctgaccct    142980
     aaatcgatgg tcattattcc gcgagagcct ttacccgctg gcacttatcg tgttgactgg    143040
     cgcgcggttt cttcagatac gcaccctatt accggtaatt acacctttac agtgaagtaa    143100
     tattatgaac gacctgatta tgattgttat tcgttttctt ctttatctgg atttgatggt    143160
     aatatttgga ttgccatttt ttcagatata tggaataagc ggtgtcagac atgaaaccta    143220
     taacctgact aatttcaggt cgtttataac ttttgctgtt gttacaggca tcattcttac    143280
     tggcattaat atgctcctgg tatctaatgc catgagtgga gtaactgacc tcagagaatt    143340
     atccatccat gttatcgaga tggtgataga agaaactgat gtgggtatta gctggattgt    143400
     caggctctgt gccctgttta ccacactcgg tgctttgttc ctttacacta ataagagagt    143460
     attgtcctgc ctgctgatga cgatgagtgg gggcgtggcg ctggctacac ttgcctgggg    143520
     aggacacgcc gttatgcatg acggtctgca ttactatctc catttactga gcgatctgac    143580
     ccatctcggc gctgcaggtg cctggacagg tgctctggtt gcatttgcta tcctgctgat    143640
     gcgcagaaac gagcataatg cacagagcgt cattgtgata tctgactccc tggcaaaatt    143700
     tgccacggca ggaacggtga ttgttgtagc cctgatcctg agtgcgctgg tcaactatct    143760
     gtatattgct gagggtaact taactccctt attcaacagt tcctggggga ggatattgct    143820
     tgccaagacg gctctgtttg ttctgatgct tcttctggct gcagcaaacc ggtttcacct    143880
     gggtccccgg cttgaagtta tggtcaggga agggaattat gatcgcagcg ttgccctgat    143940
     gcgaaacagc atcctgacag aattcgttgt tgcgattatc attctgggcg ccgtagcgtg    144000
     gctcggaatg cttgctccgt ctcaggtcag ctaggggaca gccaaagctc atgcgtgaga    144060
     tttttacttt catatcagcg agttgaccat gcagcgtatt ttaatcgttg aagacgaaca    144120
     aaaaacaggt cgttacctgc agcagggact ggttgaggaa ggctatcagg ccgatctctt    144180
     taataatggc cgcgatggtc tcggggccgc gtcgaaggga cagtatgatt tgataatact    144240
     ggacgtgatg ctgcctttcc tcgacgggtg gcaaatcatc agcgcactga gggagtccgg    144300
     gcacgaagaa ccggtcctgt ttttaaccgc aaaggacaac gtgcgggaca aagtgaaagg    144360
     actggagctt ggcgcagatg actacctgat taagcccttt gattttacgg agctggttgc    144420
     acgtgtaaga accctactgc gccgggcacg ctcgcaggcc gcaacagtct gcaccatcgc    144480
     cgatatgacc gttgatatgg tgcgccggac cgtgatccgt tcggggaaga agatccatct    144540
     caccggtaaa gaatacgttc tgcttgagtt gctgctgcaa cgcaccggag aagtgttacc    144600
     caggagtctt atctcgtccc tggtctggaa catgaatttt gacagtgata cgaatgtgat    144660
     tgatgtcgcc gtgagacgtc tgagaagtaa aattgatgat gactttgagc caaaactgat    144720
     ccataccgtt cgcggtgccg gatatgtcct ggagatcaga gaagagtgag gttcaaaatt    144780
     tccctgacca cacgcctgag cctgattttt tctgcggtga tgcttacggt atggtggtta    144840
     tcaagtttta tcctgattag cacccttaat ggctatttcg ataatcagga ccgcgatttt    144900
     ctgacaggta aacttcagct caccgaagag tttcttaaaa cagagacgtt caggaacaaa    144960
     acggatatta agtcattatc agaaaaaata aacgatgcga tggtggggca caatggctta    145020
     ttcatttcta taaaaaacat ggaaaatgaa aaaattgttg aactctatgc caaaaattct    145080
     gttgttccag cgatcctgct taataagtcg ggtgatattc tcgactatat gatccagacg    145140
     gaagaaaata acaccgtgta ccgcagtatc tcgcggcggg ttgccgtgac gccggaacag    145200
     ggtaaaagca aacatgtcat cattacggtt gccacggata ctgggtatca caccctgttt    145260
     atggacaaac tcagtacctg gctgttctgg ttcaatatcg gtctggtctt tatttctgtt    145320
     tttctgggct ggctgaccac acgtattggt ctgaaaccgc tacgggaaat gaccagtctg    145380
     gcttcctcca tgaccgtaca cagcctggat cagcgtctaa atcccgatct ggctccgccg    145440
     gaaatctctg agaccatgca ggagttcaat aatatgtttg atcgcctgga gggggcattc    145500
     cggaaactgt cagatttctc gtctgacatc gcgcatgagc tgcgcacacc agtcagtaat    145560
     ctgatgatgc agacgcagtt tgcactggct aaggaaaggg atgtttcgca ttaccgcgaa    145620
     attttattcg ctaacctgga agaactgaaa aggttgtcac gaatgaccag tgacatgctt    145680
     tttctggcac gttcagagca tggtctgctg cggctggata aacatgatgt ggatctggca    145740
     gccgaactga atgaattacg tgagttgttc gagcccctgg cagacgaaac aggaaagaca    145800
     atcacggttg aaggagaggg cgttgttgcc ggagacagcg atatgctccg acgtgctttc    145860
     agtaacctgc tttccaatgc aatcaagtat tctcccgata acacctgtac agcgatacac    145920
     cttgagcgtg acagtgactg tgtgaacgtg atgattacga atacgatgtc cggccaggtt    145980
     cccgctaatc tggaacgttt gtttgaccgg ttctatcgcg cagactcatc aaggttctac    146040
     aacacggaag gcgcggggct gggattatca attacaaggt cgatcattca tgctcacggc    146100
     ggcgagctgt cagcagaaca gcaggggcgt gaaattgtgt tcaaagtgcg cctgttaatg    146160
     gattaatccc gttgttcagg agaaacctgg aaggtgacaa aattgtcatc attcagtcac    146220
     gcgataaaca gaggcggttt tttataatta ttcataaatc aggagcagcg tgataacaca    146280
     atcacctggt tcctggagtg atgattaacc cgccctgaga tcaactgctt tctctgttat    146340
     aagccattga ttgtttgggt atgtaaacac cggagaccca accatgaaaa agattctcgt    146400
     atcatttgtt gccattatgg ctgccgcttc atctgccatg gctgcagaga caatgaacat    146460
     gcatgaccag gtaaataatg cacaggcacc tgcccaccag atgcagtcat ctgctgaaaa    146520
     aagtgcaatt cagggagaca gcatgacaat gatggatatg agcagtcacg atcaggccgc    146580
     aatgtcccat gacatgatgc aaaacagcaa ttctgctgcc caccaggaca tggctgaaat    146640
     gcataaaaaa atgatgaaag ctaaacccgg agctaccaac gaaacagcaa agtcattttc    146700
     tgaaatgagc gagcatgaga aggccgcagc tgtacatgag aaggcgaata atggtcagtc    146760
     ttccgttgtt caccagcagc aggctgataa gcatcgcagt cagatcaccc agaattaacc    146820
     cgcagctcca cttgttagac cctcatttga cgccgaagtc actggcttac gctcccgtcc    146880
     gggagcgttt tttttcccat atatcaaact ttaactctga agaggtggaa gtatctgacc    146940
     aacactgtca cgtaacgcca gataactaca aaaacacctt tttcctcctg taaattgcag    147000
     ttcctgcaag aacatcaagg cataatgttg gaacagcgtg tgatacacac ttagcatcat    147060
     gttttgtatg tgttttttta aaactttaca actttaaagt ctttttcagg ttaaaggata    147120
     caactttaat gtctctacac aggtcctacc tttgctcaaa tcaaaatgtt ctgacatacc    147180
     aaaatggagt gtaaaatgac tcaaaaccag ggttctgagc cagtaccggc gagccggaca    147240
     gggcagctca tcagcgcccg ggatatggcc atgcagaaat tcgaagaagg gatgcggtta    147300
     atctcggaag cgtcggaact gtgcggtctc tctctcttca ccagcagaat tatgcagccc    147360
     aacgcatttg gtcttccgtc gtcactggat cgcaccatcg aggaggggcg taaggaaatt    147420
     gaccgtaaaa cgtggaaaag gctctttgaa gaaacaggta tggaccggta ctggaaccat    147480
     aagcaaaaag aagcctttaa cgaatcccta cgtacggatc cgcccgtcgc ttccctggag    147540
     attgttaagg gaacattaca gcatgcactg gctaacagac gagacacgct tgcagaaggt    147600
     ttcgttgatg ttctcaacaa gcttgaccga agttttaaaa gcaatgcacg gcaatataca    147660
     atgccgaaaa agcttgttct tcgggggatt tttcctggtg tgaacgtact gaggtacaac    147720
     ggtttctcgc aggacaatca cttttgttta cgcgactttg agaatattgt atgcatctgt    147780
     tctgatactc caacacctgc aaccggcggt gggctgagta tggtcgacag gctgacggcc    147840
     atgagaaata cagatttcac aggcgaggtc tgcgatgaga atggctggcg gtgtcgcctg    147900
     tttgagaatg gaaacgttca tatttgtatc gacagtatct cgcttctgaa tgctctgaac    147960
     gatcttatca gcatatattt tgcaaaccag cttccggccg caggaaaaaa atgatgatcg    148020
     aaaacgataa agaaaaaagc ctgaacgatg ctacctcgcc agaggtgcag aatgacatcc    148080
     gcagcgaatc cacagaaaaa tcaaaggaaa tgggtcgttc aaggtactca tctattgcga    148140
     tgatcgatta cttcaatgca atcgaacgtc tgtgcgaaga gaaaaaaatt aacccggaaa    148200
     atatcgatct gagcttcaaa gttcactggc tcagaaacgc tgttggcggc tcgtttgcaa    148260
     ggtcacagga gatgttcgct gagtaccaga agtatgttaa agaggttcct gaagaggccc    148320
     gttacctgga tatacccgat gaggtgaagg ttgcactcgg cgatattatc tcgtacatca    148380
     cctggcacta ccgtagaagc tataccgcaa tacagagtga tagtgttaaa aaagctgaag    148440
     cacgtagcat gcagctggag gaggaggtaa cgcagctttt acagcggctt gagcaaagcg    148500
     ctaccgatat ggatgagctg aaacttgaga atcaggcgct acagggtcga ttagagatcc    148560
     gggacagtac cgtcaaggag ttagaaacaa ggctgaatgt tgccgaagca gaactagaaa    148620
     cctgccatca ccagttagat agcacacggc atgaattaag cctcgcacag cagtcaaatg    148680
     actcactctc ccagcaactg gctgaacgta aaacagagat cgctggtcac cttgaatatc    148740
     aaaaaaagct gaacgaagag atcaacactc agcgttctga taatgccggt ctttccagac    148800
     aatgcgacca gttaagtcag actgtgtcag atacaaaggc agagagggac aggtttgaac    148860
     aggaattgat tgctgcacag aacctctgtg ctgagctgaa aagtgcactg tccgggaagg    148920
     agggtgacct ggtggcggtg aatgccgagc ttactgaact ccataaacta aacgagtcgc    148980
     tgagcgccga cctgaaaaaa gtaactttgg tcagccaggg ctatgaagcg gaagtggctg    149040
     aacaaagcag tgaattaaaa acgctccagt ccaaagtaat gaagctggaa gctaccctgg    149100
     aggcagagaa aacaatctca gaatccctga aaggcaccat tgatacattg actggtgcaa    149160
     tggcaggggg aggtactgga aagtcaaaac agccgcgtag tagaaaaaca tcatgataaa    149220
     tgaagccagg ttgatagact tctctgcatc ccctggcaca gtagaccttc tgcggacatt    149280
     cagcccgtcc gcaggagttt tcgtccttca gtcaacaaat gcactacctt ttttgagtct    149340
     ccactttcca gtgcagaaaa cacgttaccg attttaccaa cagcttgtat ctgagtgata    149400
     accccagtct tgtaatcatc aaggatccct gacaggaaag cgttcagttt tgtctgttcg    149460
     cttagtgaaa gcatgtatga cattttttct ccattttaag caggtgtgcc agttgaaaga    149520
     ggtttacgtg attctggaaa atgaggcagc accatagttt cagatgctgt ggtcgcatcc    149580
     cagtgccacc atccataagg cccatattca cggttgtaat aatctttttt gagttgcttt    149640
     cgggccagat aagcaggagt ggccatacca aatacttcca tcgggaacgg cttatcgctt    149700
     tttgtgtcga gcaggtagaa gtcagggaac acctcactaa tactcgcatc ataacgcatg    149760
     ggcttaacgt actgccggtg ctctgcatcc agcttttctg caacaaccgc ctcataggag    149820
     gagtccagag gtatccagtt ctcgctaacg tgcatcagca caatttgatg agctcttaca    149880
     gaagggcctc tgccggttac cgcagctggt gacgtcaacg caaagacaac tattttcgcc    149940
     ccggatttcc atgctgcgta ctccgatgaa aatcgtttct ttacgctatc ccaatggcct    150000
     tctgaattga aaaaaatcag cggtagcccc ccaaaattcc gcaggggtaa aaatttaagt    150060
     ggcttctcat gcttttcagc atcgtagcga ggtaaaactg acaggagcat gagacgttta    150120
     tcactcatcg cctgtgatga aagacgctga atttgcgact gagcgacagg ttgtttcggg    150180
     tcaggtacac caatgaataa atggtcacct atgcaggctc tgccggtacg aatttgttta    150240
     gcggtttcaa gcagacgata ccgtaccagt gaatcgttac gtttccctgc cattttcggg    150300
     taccagacat tcagaccaga ctctgtccac aaaagactaa gcaagcccag gagggtcatt    150360
     gaggcctgac ctccttctgg tcgctgaaca tggggcaggg gaggcacttc tgatttttca    150420
     ggaggatctt tctctgtcat accgataccg agccttacag ccatatcacc ttcggttgta    150480
     atccggacca caccactcgc atatcctttc aggccggtat gccgggcatc aagggagaag    150540
     aatacacagg aaggatcatg ctcaatgccc gtgttagcgg ctttgacgag aataaaggca    150600
     tcaccgttcg gtaaagcacg aacataaagt cgcttttctc cttttccacg acatccgcag    150660
     gtgatgactg atttttgacc tgaggtgtgg tgtgcctttt taagagccga ctgccaccct    150720
     ttagcaaact catcctgcgt ttgaaagtca ggtgaatacc ttttgacgtt tggatcgtcg    150780
     tcgtaagcaa tcatcactgc gaatttttgg ctcatagtag tctcctaaac aggaagttta    150840
     atatcccaac caaagcaaca cttcctgagc gtcatactgt tcctttacgc ccatgtcgct    150900
     aaagaattct tcgaaatctg tttcgggaac gcaatgcctg gacagttctt gtaatgctcg    150960
     ttctttagat accgtctcac cttcagctga ttcgaaatac gtcatggttg acctctgaca    151020
     ttattacaac aatcttaagc atttaaattg atgaaggagc tcaggtcagc tgacttcgtc    151080
     gtaaaactgc cgcaagcgct gggaggctgc aaattcaatt cgagacttca gcagtttggc    151140
     gacggccgca aagacatcaa cgaccacgga gttcccaaac tgtctgtaag cctgtgtatt    151200
     ggacacaggg atacggaaaa cactttcccc gggtttatcg aagcccatta gcctgctgca    151260
     ttcacgtggc gttagcatgc gtggccgacg gtccatgttg tatgtgttat ggaaatcagt    151320
     ttctcccagc tcatgagacc agccccgatc aataagaatt tcagatccgt ctttcatata    151380
     gcggcttgag agggttctgg tgacactatt aacattggaa ggatctacta gtccaaaacc    151440
     aaaaccattg ccttttgccg catgtttctt tgcatagttg tataagtact cccagagttt    151500
     aggggagagg atgtatttac tatctacgct cggatccagt aaatctgaga gagaagggcg    151560
     cttgtccgga taaaagtctt taatgtctct cagagtaaaa ccgtctttca gacgtaggtc    151620
     gcggcgaaaa ccaataagga cgatacgttc acggtgctgg ggtcggaaat gacggccatc    151680
     gatgacttta ggatcatccg cgcccgtgct ttcgctgttt gcgacgtcgt agccaagctc    151740
     atcgagcgtt ttcatgatga tgttaaaggt attaccctta tcgtgactct tcagattttt    151800
     tacgttttcc agaacaaaaa ttgcaggttg ttttgcccgg atgatcctgg ccacatcaaa    151860
     gaagagcgta ccctgagtgt cgcactcgaa accgtgtttg cgacccatag agttcttttt    151920
     actgacaccg gcgatgctga atggctggca tggaaatccc gcaagaagaa catcatgatc    151980
     cgggatagag gcatcgataa atttgtatgc ctcgtcatca gtaacctcgg gccggttgct    152040
     aagagtgatg tcacggatgt ctgaattgaa gcggtgctcg ttctcatcgc aataccagtt    152100
     cgcccggtaa gtacggctgg aataagtatt ccattcgctc gtgaaaagac atttaccacc    152160
     gatggcatca aatccgcttc gcagtccacc tatccctgca aacagatcga taaagctaaa    152220
     gtgcctgtcc tcataatcag caggtcgtga aggtattaaa gtctgtagat agcgtccatc    152280
     tgcgatactc agatcacaat gctcaggtat gcatgtaacc tgacgtttaa gggatgcacg    152340
     ggaccaatta ctgccatttt catcatttaa tacctgagcc agatatttca ggtcataaat    152400
     agtcgaagct gttaacaaag ttttgtggat cagagatggt gttttatcca catcattcag    152460
     gtctgtctca agatcatgag tgtaacgttt catccaaact ctctcaggaa taatatcttt    152520
     gagatagatt aacacgctta atttggatta ttttttggtt caggttctaa atttattgtg    152580
     attattctgc ctttaagttg caaaaagatt ggttttaagc ccgcccatga aataatgact    152640
     tgttaaaata ctgcctgtaa ataggcttgt ggatacatgt ctgtactcaa caaatccagg    152700
     tgaaatgatg ttttttttta caaagttact tttgcccatc atgattgttg tattcccagt    152760
     ggcgtcctgg gggaactcaa caacttttga ggcaaaggtg gttaagattg ttgacggtga    152820
     caccataact gcgttggatg ctcaaaacac aaccatcaaa atacggatgt atggtataga    152880
     cgctcctgaa tctaaacagg cttttggcca aaaagcaaaa caggccttaa ccacagctat    152940
     agcaactaaa atcgttaccg tgatagacca tggtacggat atctatggcc gtatgttagg    153000
     taccatctgg ttagatggat atgatatcaa tgcctctatg gtggacagtg gatatgcgtg    153060
     ggtttatcgg ttcgaagata acgccattgt ccctggctat atcaaatatg aatccgcagc    153120
     acaaaaggag gcaaaagggt tatgggcaga caccaaccct gtcccaccat ggcagtggag    153180
     acaggcaaac gaaaagccca gaaaggtgaa agagaagaaa taaccatgat gaaagagcct    153240
     catccgttac ttcagttggt actaaacgat tccggtcgtc taaccatgcc tgtttattat    153300
     agagatcaac agtattgccc gacttgcctt acaaaggtgt tgaagagtga ggatggaagt    153360
     ttggcgcacc tcggggaaat aaatcaaaat acatgtagac cttctatttc agtagttgtg    153420
     acaaaagcaa ttattgaaat gttatgtgac ggggaaaaaa tatttgtaaa tccaatacga    153480
     taccgaggcc gggtgctggc accctcagta attttttctc ccgacactca cactttcaaa    153540
     ccgtttataa atacagacta tcagcctgtg ggagcaaact ggaaaagtga aaagggatat    153600
     aaactcggtc tgttttatct caaagatcga gccaactcta tcaataaaga ggaatttgat    153660
     ttcattgccg ttatagaccc taaggcaatg cagaaagaat ttatttcggc ctggtctgag    153720
     gttgatgaaa aaaatccatt ggaaacgctg aagcagatct tacgatctaa aaacaactct    153780
     tctttatggg taaaatggcc tggcaaaatt gagcatgcgc aaaaaggaaa ttgcaacgaa    153840
     aattactggt tcgattatca atctgataat caggaagtga actgtacggt ctctgttgta    153900
     ggtatcgaag gtaacagttc cggtgagaca atttatagat tgcaaacttt gctaaagcgt    153960
     aagctcaatg aatatcaact ggttcggtct ttagggacta ttatgcttct tgataatacc    154020
     gggaatatga ttccatcaaa ccatccttat tttgaagtca tctcaaaagc atgtataaat    154080
     ggagtgcgtg actttgttcg tcaaaacccg tgggtagtct gacggtcaac tataaagcat    154140
     aatataatta gtaataacaa ggaacagaca tgaatgaaaa ctcagtaatc ttaataagtt    154200
     tattttggtt tttttttgga tcgagtgttg tagctggttt tatggatgca tcattatatt    154260
     gctggatttt tgcagccata agcgcattgt ttcttctttc ggtgatacaa acaccaaagg    154320
     agttaacggt atctattctt cttgcggtac ttatggcaag ctccgcaggt gttttcattc    154380
     tggcttataa agtcaaaacg aatgtcgttt caccaatcta tctcttaaaa aagcctactg    154440
     catacatggc tgaaatagat aaccgaagga ttcatggtta ctaaatattt tgcaattgca    154500
     tcatttgacg gtccgggttt atttacccac agcatcgact aattcaagag gttacatatg    154560
     atagtttcag aagcaatttt ttattcttct attatttcct gggttcttta ttggtggttt    154620
     attggaaata ttactaaaaa ggtagggatg cttgttgttc cactcacgct taccttcgga    154680
     tgttacattt atgcaattca ttgggatgat tccgaacagc aaaccaattt aggttgggag    154740
     cagatcggtt ttattacctt tataattgtg ataatgtggg caggaaagtt tgtgatgaaa    154800
     agactatctg aatgatgatc taatccacac ttttcgatat cttagaaaag taactttgtg    154860
     agcaaacagt catatgacat gcaaaacgct gatctcaaag acagatgatg gatacacatt    154920
     tagcatttca ccttacgaag acgggtaccg cttatcagtc tcgcctgaaa atcgtcacaa    154980
     tggtacccaa agctttgacg gctggttccc acgttttttt tccgaaccac agtatgccaa    155040
     atcatcttta actaagtttc tcggtgagtc cttagtatgg gaagaagatt caagtaatgc    155100
     tctatgagat tacttattat aaatttttct attaatctcc atggagtgat atatgaattt    155160
     ggcctatttt ttatttttgt ctataactgt tatgcttacg agctttatta ttaaatcact    155220
     tgtcgtattg gtaaagttca aattacttcg tgatgaacgt ctcgaatata ccagcaataa    155280
     aaatattgat gagatgtacg atttaatgaa tgcgaaggaa gaaatcctca taaggcatca    155340
     taagcagatg ttggcattgc atctttcact attaatattc gttctattta ttgcttacat    155400
     ttactaaaaa taattttatt caacatttca acaaagggtt ttcaatggaa agcttcgaaa    155460
     ctgaacaaat gattcaatat gctttctaca taaatatcgt aataacgact ggtttggcat    155520
     ggttttgctt gcggtcagga ttgcattaca attttttcag aaaagcagag agtgccagaa    155580
     caaaagggct gagtagtacc tctactgaac acggtccagc aattgtgaga ataaagaagc    155640
     tacaagcatt agtagatttt attagtaact gtgcttttct aatcctttca attggcacag    155700
     cttatatttt gtatttttgg atccacagtt aactcataca aggtaacttc ggcaaataac    155760
     aacttctaat gcaggacttt aataactata acggatgcta catgaaaaac gacagtttaa    155820
     ttacgcggta taaaatactt aaaggcgaac gcgatgagtc tatcttcacc ataataatcg    155880
     cgctagtagt aaagctgggg ctggtagccc tggcattcta tctgttgctt ggttccacga    155940
     ttgattggtc aagctggaaa acctatgccg ccatgttgat ctttggagca tttctctaaa    156000
     aggatgacca cggcaatacc aggtcagaca acaaggtcgt tagcatgatc gttggaagca    156060
     acggaagcac cttgaaaaag gtcggcagca ctataaaatc catcagcaat gcacacaaat    156120
     aaactactgg tatcttaaaa tgaaagtgaa agagttgatc gccatgctga acgaaagaga    156180
     ccctgaggca attgttctga tttccggcta tgaaacgatc ggcggcacgg aagtcgcaga    156240
     agctgatttg ctcattgata tgcagtcaat atgcttagaa caggctgata atctcacagg    156300
     aaaccgtaaa gttgtttctt ccggtggtga agattcagtt tggttaggct ggaaagatga    156360
     ttaccgtaca aaggtgtttt tagaagatgc ccaaattcct gatcaagatg aatgacggtc    156420
     agcgttggct tcaaaggcaa tctatcagta cgtgaaacgt aaatgttaaa aaataaccat    156480
     atatgaatca ataacttatg tcaaagctaa gtagagatgt ccggggtggg gcaaagttca    156540
     aatgtccttt gataatattg aattcctgga taaaaatcgc atcttaacct cttcgtttga    156600
     gtaccttgtt gggttgaccc cgtattcgct ttatttgtag tattgggctg ctttgaagtg    156660
     tttcatgttc aaacgcgacg tgttctgtaa gttcttcctg acaacagagc cgacaatata    156720
     tacacatccg ctatggagaa tctgacaacc gctatgcgta ttacgccacc ctgagttttt    156780
     ccttcctctg tcgtactgag caagcctcag cacgcactca ataacatccc gtctgcggat    156840
     gtgctttacc gtacgtaaaa atgtagccct ccagggctga ctgtatctaa aaactgagaa    156900
     attactatgt tgctgtcctc gacgcgtaag gactggctgg gtaacgtccg tggtgacgtt    156960
     ctggccggta ttgttgtcgc gctcgcactc attccagaag cgatcgcctt ttccattatc    157020
     gccggtgttg atccccaggt gggcctctac tcggcgttct gtattcctct cgttatggcc    157080
     ttctttggcg gacgtccggc gatgatttcg tcctccaccg gtgcaatggc tctcctgatg    157140
     gtgacgctgg tgaaagatca tggcttacag tatttactgg ctgcctccat actgaccggg    157200
     gtattccagc tgatagccgg atatctgaag cttggcgggc tgatgcgttt tgtttcacgc    157260
     tcagtggtca cggggtttgt taatgcactg gcaatactga tttttatggc ccagttgcct    157320
     gagctgacca atgtgacatg gcatgtttat gccatgactg cggcagggct ggggatcatc    157380
     tatctcttcc cttatatcaa caaaaccatt ccttcaccgc ttgtgtgcat cgtggtgctg    157440
     actgggattg ccatgtggct gcatctggat gtgcgaaccg tcggggatat ggggaaactt    157500
     cccgacagtc tgccggtctt cctgctcccg gacgtgcctt taaatcttca gacgctgctc    157560
     atcatcctgc catattctgc ggggcttgcg gtggttggcc tgcttgagtc gatgatgacc    157620
     gccactatcg tggatgacat gaccgacacg ccaagcgaca aaaacaggga gtgcaaagct    157680
     cagggcatcg cgaacatctg cacatccttt atcggaggaa tggcaggctg cgcgatgatt    157740
     gggcaatctg ttatcaacgt aaaatccggt ggacgcggac gactttcaac cctcacggcg    157800
     ggcgtggtgc tgctttgcct gattgtgttc ctgcgcaact gggtctccca aattccgatg    157860
     gcagcgctgg tcgcggtgat gattatggtt tccatcggga cattctcctg gcgctccatt    157920
     gccaacctgc ggacacaccc cctttcaacc agcgtggtca tgcttgccac cgtcgcggtt    157980
     gtggtggcaa cacataatct ggccttcggt gtgctgaccg gtgtactgat tgcttcgctc    158040
     aattttgcca ctaaagtatc ccggttcatg cgtgtaacct cagttctgga ggggacgagc    158100
     cggacgtata ccgtcaccgg ccaggtattc tttgcatcag cagaccgctt tacgagccac    158160
     tttgatttcc gtgaagcgat tgagaatgtg gtgatagacg tttcacatgc ccatttctgg    158220
     gacatcacgt ccgtcagcgc cctggataag gtggtcatta agttccgcag agagggcgcc    158280
     ggggttgaaa tacgtgggat gaatgaagcc acccgcacca tcgttgaccg gtttggtgtt    158340
     cacgataaac ctgaagaagt cgaaaaactg atgggcggtc attaacagac tggagggaaa    158400
     actatgaata atactgttac agcctgtgtg gacggttcac tttcaacgcg gtcagtgtgt    158460
     gaatatgcgg cgtgggcagc ccgcactttg caatcacagc tagcactgtt gcacgttatc    158520
     gaaaaagaca gcaccccggt agtgtcagac ctgaccggca ctctcggcat agacagtcag    158580
     caattgctga ccgatgagct ggtagaaatt gaagggcaac gtaatcgcct gctgatggcc    158640
     caggggaaag caatactgga aagttgtgct gaactgcttc aaaaacaggg aagcccggat    158700
     gtgcttttga tgcaaaaaca cggtacaccg gatgaagttc tggcagagct gagcgacctt    158760
     cgtctcatgg tgctggggcg tcggggtagc cagcatccgg taggctctca tctggaaagc    158820
     gttattcgtc tgcaaaagaa acccctactg gttgttccgg agaactactc agtgccttcc    158880
     agagtcatgc tggcttatga tggcagtgaa gaaagcagga gtaacctgga acgtctgacg    158940
     atgagtccct tactcagggg gctggagtgc caccttgtca tggtaaacgg taagaaggaa    159000
     gagctgctga ccgcacagca aattttacgt gacgcggata tagaaaacag cacaacacat    159060
     cttaccgggc aatcagtcgg ggacgcgctt attcgttacg ccgaggaaaa tgctgtcgat    159120
     ctgatagtga tgggggccta cggtcattcc aggttgcggc agttctttat cggtagtcat    159180
     acctccgaaa tgctgcaaaa gacgcaacaa ccgcttctta tcctccgtta gcactgatta    159240
     tcttaaataa aaaagggcga gttctctcgc ccttcgtcac aagaacacgt ttagttcagc    159300
     cggttacctt tttcatcaac taccttctca ccgtcctctt tcgtgaacgc gcttttctgc    159360
     gcatcgtaaa gaatatccag cacgacttca gaagggcggc atagccgggt acccagcggc    159420
     gttaccacga tagggcgatt gatcagaaca gggtgctgca acataaaatc gattaactgc    159480
     tcgtcagtaa agcggtcttc cgccagccct aacgcttcaa aaggttcgac attcttacgc    159540
     agcagcgctc gtaccgtgat ccccatatcc gcaatgagtt ttaccagctc agctcgtgat    159600
     ggtggggttt caagataatg aataacggtc ggctctgtac cgctgttgcg gatcatttca    159660
     agggtattgc gtgacgtgcc gcaggccggg ttgtgataaa tggtaatgtt gctcatatca    159720
     gtatctcatt acaaagtgaa agacagacga agcgccagtg ctgcaagcgt gacaaacagc    159780
     acggggattg tcatgacaat gcccacccgg aagtaatatc cccaggtaat tttgatattt    159840
     ttctgcgaca gaacgtgcag ccacagtaac gttgccagac tgccgatagg ggtaattttt    159900
     ggccccaggt cgctgccgat gacgttggcg taaatcatcg cttctttgat aacaccggtc    159960
     gcagtgctgc catcaatcga cagcgccccg accagcacgg tcggcatatt gttcatcact    160020
     gatgacagga aggccgtcag gaagcccgta cccagcgttg ccgcccacaa tccctgctct    160080
     gccagctgat tcagcaagga agagagatag tgggtcagac cggcatttcg taagccgtag    160140
     accaccaggt acatccccag cgagaagata acgatttgcc agggcgcacc acgcagcacc    160200
     ttaccggtgt taatggcatg cccttttttc gcaacagcaa acagaagcaa tgcaccagcg    160260
     gctgcgacca aactgaccgg tacgcccagc ggctccagtc cgaagaatcc caccagaagc    160320
     aacaccagaa ccagccagcc ggttttaaag gtattcacat cacgtatagc gtctttcggt    160380
     tctttcaaca gagaaacgtc gtaaacggcg ggaatgtcct tacggaaaaa cagatgcagc    160440
     atcaccagcg tagccgcaat cgcggccagg ttaaccggga ccatcacggc ggcatattct    160500
     gagaaaccaa gcttaaagaa atccgccgag acgatattca ccaggtttga gacaatcagt    160560
     ggcaggcttg ccgtgtcagc gataaaccct gcggccatga taaacgctaa ggttgccccc    160620
     cggctgaatc ccagcgccag cagcatcgcg ataacgatag gtgtcaggat cagtgccgca    160680
     ccgtcgttgg caaacagtgc cgcaaccatc gcaccaagca ggacgatcca ggtgaagagc    160740
     agccgccccc ggccattccc ccaacgggca acgtgcagcg cggcccattc aaagaagccg    160800
     gattcgtcga gcagaagact gatgatgatc acggcgataa aggtggcggt cgcattccac    160860
     actatctgcc agaccaccgg aatatccccc agatgaacga cgccagtcag caatgccaga    160920
     attgcgccca gtgaggcact ccagccaatc cccagccctc tgggttgcca gataaccagg    160980
     acgagcgtga ataaaaagat agcaccagcc agtaacatca gaaactccat tcacatttgt    161040
     ttattcggat atatatatcg ccatcagcag gagacagatg ccacgctact gagcttgttg    161100
     cgtatgtttt ctcgttcaca gttccaggct gtatcaataa tacccgcagc ccatgctggc    161160
     atgtgtggcg acagtcggta atgcacccat tttccttcgc gacggtcgat gaccagctcg    161220
     gcttcacgta aaagggccat atggcgagaa atttttggct gagactctgc ggttgccgca    161280
     cagatgtcac agacgcacat ttcaccggac tccctgagaa gcatcacgat agttgaacgg    161340
     gtctcgtcgg cgagcagttt aaaaagctga acaggctgta gcatgcttaa cctcgtaaaa    161400
     aaataacaat acatatggta tttcatatgt gataactttt aaagcatagc ttatgaaatg    161460
     gagatttttt atgaccgact taccagcaat cgaaccggct tattttgatg atgcgcttgc    161520
     cagcaaactt acgggcaaca acgaaaccat gccgcgaatt ctcatcctgt acggttcagt    161580
     acgagagcgg tcctacagtc gttttgcagc ggaagaggcc gggcggttgc tggcaaagat    161640
     gggggctgag gtgaaaatat ttaacccatc cggtctgccg ttacccgatg atgcgcccga    161700
     aagtcacccc aaagtgcttg aactccgcga gctggtcagg tggtgtgacg gaatggtctg    161760
     gagttctccg gaaagacatg gcgccatgag ctcggtgatg aaggcccaga ttgactggat    161820
     acccctgagt gaaggtgctg ttcgtccttc ccagggtaaa acgctggccg tcatgcaggt    161880
     ttgtggtggt tcacagtcgt ttaacacggt caatcagatg cggatacttg gccgctggat    161940
     gcggatgttc accatcccca atcagtcgtc agtgccaaag gcatggcagg aatttgatga    162000
     tgaagggcgc atgaaaccct caccctggta tgacaggatt gtcgacgtta ccgaagagtt    162060
     gttcaaaatg acgttactcc tgaaagggca cacagcctac ctgtccgacc gctacagcga    162120
     aaggaaagag agtcatcagg agctcgcggc acgggtcaat caggccaaaa tctgacagcc    162180
     aggcatgccc ggatggatta ccgggcttta aatcggtttc ttcccaaata tctcttcaga    162240
     gcgtgactga agtttcacca gggcattgaa catatcgtcc tgatccaggg aacgctggga    162300
     tttcttcgtc gtgggagctt tacgcctgcg agaagggccg tctccggatg gtacggattg    162360
     cgaccggtta ttatcccgct cggcctggac cagctgcgcc atttccaggg cccgccccag    162420
     acgtttgtta tccacaatgg ccccctgatc gatttcagaa agcttgtcat aggtggagta    162480
     gggaagtgat acgccattaa gccggagctc tttatgtcca tccgggtaat gccagacatc    162540
     gatgtattta ccaatcgccc gacgactgaa ttcgctgtct tcaatcagat aaaggacttt    162600
     gtcgtattgc actgtgagtg atttcgacac tttacgagct tcacgccagt taaataccat    162660
     atcaagatcg tcatcgacat ccagttcccg atgaacatca aactcctggc gaggcgcttt    162720
     tgcgaaacga cggttgtaat cgttcatgaa ctcttcggca aatgcgttcg cagcttccat    162780
     ggaactgatg ccctggagcc tgagctcctt gaccagtcgg tcctgaagcg tcaggtgcgc    162840
     ccgttcaacg cggcctttgg cagcactggt ttctgcacaa atggtctgaa tgttcagttc    162900
     atgcatcgca cggccaaact gggtatcgcc gtcgccgccg gttgcatttt tattgttgat    162960
     cctgaatacg ctggctttgt cgctgtacag cgcaagcggt ttgccatgtt tttcaatata    163020
     gccccgggtc gcttcaaaat aggtgaaagt agactcagat ttcacgaaaa gaagctgcat    163080
     taaacgactg gttgcgtcat caacgtaaac cagtgccgta cacttaggtc cccgattttc    163140
     aaaccagtgg tggtcgcagc cgtcgatttg tatgagttca ccggcacagg cacggcggta    163200
     acgaggttgc tgaatttttg gcgcacgttg cttacgtggg acccacagac tggcctgagt    163260
     catcagctta cggacggttt ctttggaaag atgaacaccg tgcacctcag acagtttttc    163320
     acaggccagc gtcggaccga aatcgttata gcgttcgcga ataatgttca gcgcgtatgc    163380
     ggccagtccc tgaggcaact ggttgttact ggatttacca cgacggcggc tggtcatgcc    163440
     aatcggacca tcttcacgat aacgcgcaag cagacgacgg cactgacggt cggagatacc    163500
     aagccgctga gctgccattt gtgttgtcag acgccggtcg atgacatcct gaatgatttt    163560
     gagtcggtta acttcatcca atgtgaaaaa ctccgctgcg agagccgtca tggtaatcct    163620
     tacttgatta tacacgccgg acatcttaac ttagccatta tcggacatta caacttttct    163680
     actacaactt aagtgcgcat aacgaggatt atgtaagatc cgcgttaagt agtcgattta    163740
     tttgaaagtg acgtcgtctt taagttaaaa tcacctataa tcaataccta ctggagcagc    163800
     tcatggctga cacctacctc cccccgggct ttaaaaaatg caaatcatgt cagcaagtta    163860
     aaccctttga acagtttgga aaagagctca agggcaagtt tggcctcaag agtaaatgcc    163920
     gagcgtgtat tagcgagaaa aacaaaacgt acgcagcagg cccaggggcc gaagtaaaga    163980
     cgcaaaataa taggacctac caggcagaaa acaagactga gctcgcggag aaaatgcgcg    164040
     ttaagcgtgc gaaagaaaaa tttggtgatc gctataattc ctacctcgct tctttagagt    164100
     ccatgaaaaa actcaaataa tgtaatcgcc aacggaggaa taatgaatgt acatctgaaa    164160
     tatgatacga taaagcacta tcactttgat tggctaacgc ctgctggcga ctatcctaat    164220
     tcagcggtta tgctcgtagg tttccgtgat gggcgctgga ttattgttca agagttcgga    164280
     aatgattata gctgcttcga gggcgttctg aagaatggtg atgatcttaa tacggagcct    164340
     aaattctatt ccgacttaga aagcgtagcg gttgctgctt ttggcatgat gaagcagata    164400
     tatccccagt accaagatag cacgttagaa gaattcctcg ctggataaaa tattctagaa    164460
     accaaactcg ccttattcga aggaaactga ctatgtatag aaaggtttta gctctttcag    164520
     ccttactgat ttctgcttgt tccaccgata atcctcataa acaaagtatg caccacaatg    164580
     attttgagct ttcggactca gctgtaaaaa ttcaaatcaa gtctggaaat aagacaatct    164640
     ccggctcagg tacttggatc gatgaacaac atattcttac agcttcacat ttatggcttg    164700
     atgcaagcaa ggattatagt ctaagtataa taacaaggaa tgggagccaa ccagcaacag    164760
     ttatcaatat tgatgatcct aagaaccggg acctcgctct tttaaaagta gaaaaaaata    164820
     ctattgtcaa agccccacct aattggaagc ttccagtatg tgataatgtt ctagctccag    164880
     gtgagtctgt ttgggttcta tcgggaatgt ataatacgct ttcaaatacg tatgcttccc    164940
     ccgactcaac ctactattat aaaggaatag ttggttctga tggtttgact gctttttatc    165000
     aaaatggagt tagtggaagc gctgtgttaa accaatctaa gagttgctta tatggtgttg    165060
     tgagtcaaca agacattaaa aagatcaatg tctatcagat atatattacg aagattacta    165120
     caaatgaaat tatacgcgga ttcataggtt ataaaaataa ttaaatgagc gtaatcttac    165180
     aacaggcaat tccgacgtta tctgcgttgg tctacctatc tgaaccttta aaaggaacgt    165240
     ctatcatgta taaactttta cccgcaatac tagtctttct ttcggtgttc cttggactaa    165300
     tcgctctact cagtgctatc aaaaatggtt ctgatgaatt ggcggtattc ctcattacac    165360
     tttcggcgtg gttcgctgct ttaagtaagt tttattcact taaactgtat aaaaatagtt    165420
     agcctgtgaa tccaaataca gttgacaagt atccagcact gcccccgtga tttattcagg    165480
     ttagaatcat tcccggagtg caggctggga ttagaaaagt tacttttctt acgatgtacc    165540
     aaccaatagg gcacgactta tcgtaatgcc taattacata ttacctgttt aagtcgatct    165600
     aataatttca ttggagcaga catgtccccg gaattggtat caggcattgc acgagtggcg    165660
     catgaaaagc tactttcagt tttgacggag tgcggcacaa agaagacgaa aggcacatgc    165720
     ctttttgcaa gctatcttgt atgttattta gcaaaaacta aaggtctaga tgctgttgtt    165780
     cgtgggggta acggtgcaga tgatggcggt atatttacag agagtggtgg ctttggccat    165840
     tattggtgtg aattgaactt cgaagaagtg caatattata ttgacatcac ttccgagcag    165900
     tttgggtttc atccatactt agtgaaacgc gtcaacgata taacaggatg gccacgatat    165960
     attcctggtg atcaggaaac ggtcgatagt catttagaac aattattacg cgacggctat    166020
     acagaatagg ctgcgtatac actatcgcag cctttcaggc tcttaaccct tgtgaccagt    166080
     taacggaacc actcaggatg acgctgccga tcaacgttga taacctgcga attaaattca    166140
     acgacatccg ctggagtaag cattaattca tcaggattta caataaatgg tcttaaaacc    166200
     acttcgccac cgtcttcttt tgcaccgtag atattaataa gaaagtgcag tcgttgattt    166260
     ccgtcagcat tgcgttgcca ttctctaaaa gtcaaagtct gtttaatata gtttgttaaa    166320
     agaaatgcga attcagattc ttccgtttgt gagataccgt ttttgttaga catttttttt    166380
     agtatctttc cgagcatgga tacacaggca tctagactta acgatgttaa aattttggtt    166440
     gtattaaaat cctcctgcga aagtgaaatc atccatgtat tatctttatg atagtcggtg    166500
     atataaataa aatgagatgt aaaaggcgtt gagtgattga actctcctaa gttccatcca    166560
     tactgtctca ctgtatttga gctaagttct ttgtcggtaa tgttcataat tcataccttt    166620
     cgataaagtc tgtaatgata attagctatc tcaaaggccc agaacaactc ttgaaataac    166680
     ctcactcgaa gaatttatca tattgaacac ccctacctaa taaccttgcc gacttaataa    166740
     atcacaatag ccctcccctg tcattttaaa atgctacttg aatttttgat agcttatagt    166800
     tgttttacgt tctttgtgat actcatatgt catcttctct ttccagtacc aatcttgtaa    166860
     atcctgcaag tctagcccat ttttctcacg tatgctttcg tgtaattcgc taagcgcgag    166920
     tttatcatta ggtttataaa tggctaattt ttcttcaaat aaatccagcc aacgtttccc    166980
     catctttcga cgcaaaacaa acaccatcgt gataattgta ctgaaatgca cagcaattag    167040
     ttccaactta tgcgattgct gaccagataa aattactatt gtaacaacag ggatggccgt    167100
     atataaagca atcaaagcga ccataagttg atatggtttt tcccgtatta ccatgtccat    167160
     gggtaaacca gaggacgcta ctaatggctt tttgtttgat gttttgatgg cacctgcccc    167220
     cgcgttttac catgaccgaa gtacatagcg gctcacacct tctgctggct gttgccactc    167280
     gctattctcc gttgacggtc tgaggcgcgt cgagccccgg gagatgtttt tcatcgcctg    167340
     ctcaagagtg tccatcctgt aggttttgat gttcacccct tcttcagaaa taggccccag    167400
     cagttccgta acctcacgct caccctgata aatatcgacc cactgtgtaa tattcacctt    167460
     atcaccattc gcatcaatgc cacgtcggtt aaagtggtca atttcaaact cacacacggt    167520
     taccggtacc agcccctccg ggcgcggata cccgagtatt tcatcaaaac caggttcccc    167580
     ttcatcagtg accagatcag gcgtcaaata gagttttccg ttacgggaaa aatgcgcaac    167640
     atggcaggac cactggtcat ttaacatcgt tggcatgctt gtgaacattc ctgaatacca    167700
     ccgtctggca ttatcaactg atttggtgac gaggatttca tctggtactt ccccgttgtc    167760
     catggtgtaa aaactgagag acagagcggt atttctgcgt gaaagtagct tttctttatt    167820
     gacctcttta ttttcaaatt tggacaggta ttcctcaagg aacagcgcct gcaactcggg    167880
     tgtcggcgct ttctgataaa accagtcggc caggtcttta gtgccaatat agatgaggct    167940
     ggctttacct ttttcgctct tgaccgcaac aggagccatt aggcttactt gctgtacgta    168000
     ctcactggtt tcattgatac tttcataggc ctcaatccac tggccaagca gattggtgta    168060
     aatcaccgga tcgttcagct ttaaaaactg cttaagagcc tgagcgccac gggagcatgt    168120
     atcaaaataa cgctgcttct cttcgaagct tttgaaagca gtctttttgc ccgaccatgt    168180
     ggccaccagc tgttcatctt cgaacagggt gttttcagct ggtaagaagt gtttcatttt    168240
     cgcaaaacgt tgatgagtga cgtttaagcc atttcgggat gtagcaagta ccattcgatg    168300
     aacccaggca tgcccttcca tccggttgtc gcattcaaaa tttgctggtg cggcatatgc    168360
     aacaagtttc cctgaagcat ttaccgataa cctgaccagc tcatagcctt tgctgctaat    168420
     aaaattacga accccgggaa gatgtttgag ccccacatca gcgagcatat agagctggtt    168480
     caggagctct ttggagccct tctctgtact catggcagct tccagcgtcg cccccctgtt    168540
     atcagctcgc caggctacaa tgcatcgatc tatcaactct gatctcagat taggctggcc    168600
     aatatttcca tcggccagag cctggctcag catctgccgg taaggttctt ctgcctcacg    168660
     ctcggcacga atataattta aagccatctt gaagaagcga atgtaaaaca ggtgattaga    168720
     cctgaattta cgtctgtgaa tgtaccattc gagctcctcc gctttaatgg tatccatgca    168780
     caggaaaccc agttcagcat cattcctgct ggactcctta aataaagaca aattcacctt    168840
     acaattgaaa tctcgatccg ttgagtatct gtttactgtt gcgttgacac agatatcgtc    168900
     tccctgacgg aatgcaataa ccggctcata gtttttatgg gttctcccaa gccatttata    168960
     gccagagtag ctgttgtctt cctgaactgc tcctggtgct gtcactgggt tcatcaacga    169020
     atcccagttg cacattaccc gggatccgga ctgaaggcat gagtttgcct gttcaagata    169080
     actttgcaga gacggccgtg tctcagccat acccaaaagg ccagaaccgt ctttgtcgtg    169140
     cagaaattgg aagtaccgtt cctggaactc aaggctcaga aaactgtaag gggtattggt    169200
     atcatagaaa tcaccaaata gtttgagccg gtgatcgagg ccgcagataa ggatcaggaa    169260
     acgacggtag tgaagtgcca taagatcatg ctgcttcagt cggtcggtat aactgacgtc    169320
     ctcaaacttt atggtgctgc catcaatccc ctggaaatgt gcttcctgtt cgctggcgga    169380
     agggaatagc tgcgaagccc caagatggct ttctaccgaa gagtaaacct gatgaatatt    169440
     ttgaccgtcc cggaccagaa ggaatacaac ccagttcctg tcattgcgga catgattttc    169500
     ccagggatcg cggtaatcga tataacgtcg tgttgtggcc atacatacga tggaacgttc    169560
     ggacggaaaa atctgctcca ccagcccggg gctggttcgt aaagtttcat gaaatttttc    169620
     catatcagag aagtcgaacc agctatcgag atcgcaccat acggccagct cttcatccac    169680
     catcagcttt gcctgaacga cctggagcgg gaggtgtgat ggagcggatt cacccttcac    169740
     gatattcact acctcaacgt ctttgccggt atacagttcc agactgccaa cgccatcgtg    169800
     gattttcttc acatattcca tggcttcttc tgtagtggcc agacttgccg ctgcaacttc    169860
     ctcgaaatag ggcagcattc ttttgctggc attagcgatt gcctgcgttc gttgtgtgat    169920
     gattttgctg atggctgtgc tgatctgccc ttcttttaag gccgcttctc tgatttgttc    169980
     aatgcgggta tctgaaatac cagaggacag agcattttga actgatccaa tcgccagtga    170040
     ggttaccgcc tgctgctctt gtgggggcac taacgcaacg ctaaggcccg tcacagggtt    170100
     ttcacggtca tctgtaccta attgctcaat cgcaaggtca cggagcccct gagcatcgct    170160
     cacgagggct gtaagcgatg cctgtaggct attcacttct tcctgagctt gtctgagttc    170220
     agcatcccgg attaccttat ggtcgggttc aaatacaaaa ctggacagaa aatccttaac    170280
     caggaagcga tgctctcgca tttctttgcc acgttcccta cggttgccgc tgctgtcttc    170340
     agtgacaata gctacagtct gaccgtaaac gcggggatgg gcgcgtagaa tcactgtgtg    170400
     cagcttatct tcaacgtaac gcaaagacgt aatgagcagc gtatcccctg ccacaatacc    170460
     ctcttcaggg atgctgtcag tggacgtcca gtactgaccc gccagcaaag aatgaaatcg    170520
     ctctaaacgg tcaatgttat ttttgctgac caggtcaccc atataccttt ccttccagat    170580
     tcgtatgtta ggtgaatcat accagattgc acttaccgtc taataactca aaaaacacca    170640
     acttaggcat tcactagaaa tgaatccgtc cactattatt cattaattaa atagattctt    170700
     agatatgaat agcgcattgc ttttaaagca ggtttcgcaa agggttaaaa aaggcttctt    170760
     aagtgaagcc tttaataata aatgctactt atcttcagag ggatacattt cccagtattt    170820
     attacgtaca ttaacaaggc aatggtctgc tgtttctgaa gcgcctttgt cgcggtttac    170880
     aaaggcttct gcaacttcat ccaacttatc cggtaccgta tttaatggta atgcctgctt    170940
     caggttggtg gttaccagtt cctttgcttt atcatgatta agttcagttc ggatgcttgc    171000
     atctttacaa atatcatcaa ccttaccatc aagaataatg tttgggatag gttcgttttc    171060
     aactttatgt gtagtattag cagaggagcc aaaagcgact gacatcatcg cacacagcag    171120
     aatatttttt aatttcatag ttcactccat tatgactatt gatatctact tatgaagtat    171180
     tagttatatc atgtttgccg tcaaaacata gaacccactg ttttgacttt aaacatatca    171240
     tgctacaacg tttttttgca cgtgacttta gtaggcatga tttatgaggt ttcagcagga    171300
     cgtcagattg ttgtcgatcc agtattgatg caagcctacc gtccatttct tcgataaggc    171360
     cgaaagtaaa agcgctaaac cacagcagtt accaggagta aaaattcgta tgggatctgg    171420
     agaaccgact ttaacactca taatgaactc cagaatgttg ccatggcata gactatttct    171480
     aagcctgacg atatctgctt caggtttttt accagcgtct atctttgcca acatattctt    171540
     ctcggctgga aatgacagta attctatcgg catcccttcc tgcttagcct ttcgcattaa    171600
     agcgttactc attactgacg taccatctaa gtccaccagt acaggaactg actgctgaac    171660
     gttaacagtt gatttcaact tcagcgtaac cctgagtgat gtttcgatcc cattcagaaa    171720
     gctcgtacag gccggtaacc atagaccatg atgcagcgcc tcggttgctt gtttaaaaaa    171780
     ccagtcaatc acggggacag tgcaatgctc ataatagtga tttacctcgc tgaaccttgc    171840
     catataagca tcgtactcag cctggtcttc aggagataaa aaatttggtg ggaggagcat    171900
     cagaatcctt tcatcctagc ttgtatacct tcttcgtagg ccagctcgcc attatcggta    171960
     aaagatggtt tttgatgttt atgataaagc ttaatttttc gtcaggcttg atagcgttac    172020
     cggagagatt tgatcttttc tcttcaactc gcaatgtcgc ggtagggata cccgttaccg    172080
     gatacccccc gcacagatcc cggcgtgcgc gatttacgca ccgggctcct gcctcgggtg    172140
     tctggcggtg aaccgctcca caggccatgg atgaagaacc cgaacccttg gtagccatgc    172200
     ggctgccagt ttgtttgctt tcgtccaggt cgtatcatcc ttctggctcc tgcgcctgag    172260
     cgcccggcgc cagaggtttg ttacgtgtgt cctgaacttc tgcatggtgg ggaagttgcc    172320
     cggtaccgag tgatagttca ggtatccctg aaccactctc ctgagccatt ttccctgttc    172380
     ggggattgag taatgccagc gccttcgcag accgtctttg atggctttca gagttgccgt    172440
     catccgatcc cggcgggtct ttcgtatcag catgaacctg ccgttgcgat ctttcccgct    172500
     gatgtgcgtg aacccgagga agttgaacgt ttctggtttg ccttttcccc tgatggcacg    172560
     gttttcggca gcgaagcggc cgaactccat cagacgggtt ttctccgggt gaaccgtgag    172620
     tccgaactcc ctcagtctgc gctgcatggc tatacggaag cgccgggcat cgtatcgttt    172680
     gtcgaacccg atgacgatgt catcggcgta tctgaccatt accacattgc ctgtggcata    172740
     gcgacgtcgc cactgatgcg cccacagatc gaagacgtag tggaggtata tgtttgccag    172800
     cagcggtgag atgaccgcac cctgtggggt gccttcctcc gttgctcgcc attgaccctc    172860
     ctccgacgtc ccggctgtga gccacttacg tatgagcctg attaccctcc ggtcgccgat    172920
     ccgatgctct gtgaacctga tcagccattc gtggctcacc ctgtcgaaga actgactgat    172980
     gtcggcatcc agtacccagt ttacgttagt gcgtaccagc cctgtggcca gtgcgtccag    173040
     tgcatcgtgc tggcttcgcc cgggtctgaa cccgtatgag aaccccataa agtcgttttc    173100
     atagactgcg ttcaggattt tcaccagcgc atactggacg atcttgtcct ccagcgaggc    173160
     gatgccgagc gggcgttgtt ttccatccgc ttttgggatg tagtgacgcc tgccgggctg    173220
     cgccctgtag ctgccctgat gtagcctccg gtgcagatct gttatgttgt tcttcatgtt    173280
     tccggcgtag tccatccacc tgatgccatc cactccggcg gccgctttcc tgctcaggga    173340
     gaggaatgcg gcttccagtg cttcgactgt cagcaggtgg aacaatgctg taaaccgttc    173400
     tttcttccgc tgcttcgcag cttcccgcac gcgtgacagc ctctgtgaca tgctttcccg    173460
     gctctgtgtc cggcgcatgt gtggctgttc cgcgttcccc ttggccccgc tccttcgctc    173520
     cactgactcc gctcctttcg ggttgttcgc ctgcttcgcc gctactatga gcgagtccga    173580
     cttctcctct ccgtacatca ccggctatga ctcctcgtct tcccggtgcg ggccatctcc    173640
     gacactggca gatggtcaga ggggagatct cccggttccc gcgtagagat cgtattgaca    173700
     tgccagggtc tcagaccccg ccgggtccat gtggcactcg cagtatcgca ccctatgatg    173760
     ttgccttccg ttaacagtac aacgtcggca cccggtaatt taatatacat ttcgtggctc    173820
     aatggctggc ctgtcaacac ccctgtcaac gcttcgcccc atacctcgcg gtatgcaacg    173880
     catgactcgg ggaccttgtg gattgctggt ccttcaatgg tcggggactt tcaccccttg    173940
     atctctaccg gtctcccggc gcacactgtt tatacataca gtacaagaat tcgagtgtag    174000
     ctatgtctgt tatccttgag cacattagca acaagcctta cgaaatggca ccttttttca    174060
     gtgatttact aagctgtgga gtgatgagtc cgtgcgccgg gcatgaagat aatgaattaa    174120
     atttgcatga atatgtagtc cgcaaccgcc cctcaacctt ctttgtcagg gcggcgggcc    174180
     tcagtatgat caatgccggt atcaatgatg gagcaatact ggttgtggat cggtctttaa    174240
     cagcacgaca cggctctatc gtcgttgcgc tggtggatgg agagtttacg gtaaagatct    174300
     tacacacgta tcctgagctg cttttgatgc cttctaatcc agcctataag ccgatacgtg    174360
     taaatcctga atcccttgag atatggggcg tcgtcacctt tgcactgaat cagttcagcc    174420
     atgtacatgc acgttgatat taacggagcc tatgcggcat ttgagtgtgc gatggatccc    174480
     aagctgtcaa aaaagccgct catcatagcc agcaataacg attcgtccgt cattgcaatg    174540
     aataaactgg ctaaaagcgt tggtattaag cgtgggaccc caatttttaa gtgcagggat    174600
     ttgattcagc aacaccggat cgaagtccgg agctctaact ttactttgta tgaagactac    174660
     tcaaatcgct tccatgaaac gctggaaagc ttcgcgcctc aatcgagtcg atatagcata    174720
     gatgaaaatt tcatgttatt gaaaaacatg aacaagataa tagattatga agattacggc    174780
     cggttgatca gaagtacact tcttcataat ctgtccctta cctgtggtgt gggttgttca    174840
     agcaccaaaa ccctcgctaa attatgcacc tatgcgagca aacgatgggc agctacaggc    174900
     ggggttgtag ttttgactga tcaggccagg atcaggaagc tcctgagcct gatcagtacc    174960
     agagaaatat ggggtattgg tcgaaagatt agtgaacgcc tgtcggcttt cgggatcatc    175020
     actgccggtg atttttataa tagcgacgtt cgctttttac gtaaaagctt tggcgttgaa    175080
     atcgagcgta cctggcggga actgcatggc gaaccatgtt tccggctgca cgagtctcct    175140
     cctgtcaggc aacagattat cgtttccaga agttttggtc agcgccttaa tgagataggc    175200
     aagctacatg aggcagtttc attttttacc gcccgggcgg cagagcagct gcgcaaggat    175260
     ggctcgtgga cccgtcaaat cacagtcttc attcagagta gcaattatgc gcaaggtgaa    175320
     aaccgctaca gcaattgtgg tatcgagccg cttaccgcta cacaggacac ccgcgatctg    175380
     gttgatgcag ccatgaccat cctgaaccgc atttacagac ccgggatagc gtatgcgaaa    175440
     gcaggggtaa tgctctccgc tatgactgac ggcacagagc aactcagcct gtttgatact    175500
     cgcccggcca ggcctggcag tcaggcactg atgaaagtta tggaccggtt caataaagaa    175560
     aagcgcggag ctctgttttt actgggggaa ggcattcaac aggattttcg tatgaagcag    175620
     gccatgctat caccgagata tacgacccgc tgggatgaat tactcgttgt aaaagcgtag    175680
     cggccatgac cggcatggcc gtactcatca aatgtgaaag taactttagg ccccgcgagc    175740
     tttttcgatt gcgccctgca aagttgctgc gtccatagcc ccggggataa atgtggtagt    175800
     cgccgcattc ggctttttca tattcataat gatgaaaccg ggtgtgccgg tgatcccgag    175860
     cgcttcgccc agctgcatat tgccggagat cacgttttca taccggtttt tttccctgtc    175920
     agaaaacgtg ctgttaaacc ctgacttttc caccacagta ttaaagtcag tgagttcgaa    175980
     tttgcgttga gaggtcatga aggtatgagc cacagccatc aggttgttgt ggtacttacg    176040
     ataggcttca gcaccgaaat tctgatagac gtgcagaccc gtagcggccc ccatggcaga    176100
     tacaggtttt gaaccggcaa aaatcgggaa ttctttaaag aagaatttta catctttgct    176160
     ctgattcatt accgattcaa caacaggtgt aacccgcatg cagtaaatac actgatagtc    176220
     gaagaactcg attaccgcga cgtcggcgtc atcagggccg atgtttggcg tctccttggt    176280
     atccagcaga gctggcgcat atggaattat tcgttccact gaggcactca cgttctgatt    176340
     ttccagcgcc ttacctgctt ccactaaata atggggattt tttaccaggt aagtagcggc    176400
     aattttgcca atttcttcct cactgagcac cttcggttta aaataagttg ccgtgattaa    176460
     cgccgaggca gcggtagcaa taaccgcaga aattaaaatc gtggccatcg gttttaaata    176520
     aaattcttta gacatagcta cctttatgct tttcagcctg ttagttatta acctgcgatg    176580
     gattatactg gcccggtaaa tcggaattat tcgtgaaaca atgctttttg gagattaaag    176640
     gatgattagg cagggcttta tactcacaac cgcaatgctt ttgagtggat gcggatatca    176700
     tttcgcaaac caggtagatg cgtacgatct aatgcctcgt cctgttacaa ataaaaggtt    176760
     tcagatagtc cctccggacg aaagtattca gtccagaatg ttttcaggcc gttttgctga    176820
     tggattagca aaaaaaggag tcattatttc cactcaccag ccagattatg tgctcaggtt    176880
     ccgaatcagc agctcacagg agaacatgca gtatagcgag cagcttctta ctggggtgac    176940
     aggctacgtt gtagataaaa agacaacgag aactgacaag catggcgaat tgcatactga    177000
     ctatgactac aagccagtcg atggggtaat aggcactgag acgatgtcgc agatgcacta    177060
     tatgcgacag ctggatgtcg aggtataccc gtcagcgaaa ggagcaaagc aggttctgaa    177120
     agtgagtatg caaagcaatg cacctgtgcc gtcagacagc attgcttatt cagcaatgat    177180
     cgacgccttt actgataaat ttgatgcgcc gctgcgttcc ggaaattatg ttgcagtgat    177240
     cccctggaac tgaaagcaga cggcgggaag agaatgttca aaagtgactt ttggacacgc    177300
     acattaacgt ggctatcgcc ctcccccatt aaaatcataa agtcggtaaa gatcgcccat    177360
     cgtgatggaa ttgggcttat taatgaacag atactgtaac tgttctttat gttgagtact    177420
     ggcagctgca ttcataagca cttccaggta gaacttgtag cctatgcttc gctctgaata    177480
     catatactgg aactgcatca gtaaaatgcc tgacataaca tacaacagca gcagactgag    177540
     taatacagtg ctatcaggct gttccagtgc catactgaca taccctgaac ccagaatgca    177600
     cagaagccac cccgtcatta gagcaggcac cctacgactc agacgtttat aacaacgttt    177660
     tattacggga tcccggagat actttttgtc aggtatcccc gttgctctga tgacgaagct    177720
     actgagtatc gacatctttt ttccttctgg acgctctcag tcaataaatc aggccaggcg    177780
     ctcattgaaa gctaccacga gctgcgaatc gggatttttt accagttcgg gccggataac    177840
     ttttagttgc ctcgttgggg cgagctcatc tgtaggcctg atggtggtat tacccggccc    177900
     cttgcgggta ctgtcggtgt ttaccttgag ctttttattt cccaggtagc tttccatctt    177960
     tttagagatg gtgtcacctg tggtcgcaac accagagagt tcctttagat gttcaccttt    178020
     atccatttgt accgatgaca tcagaaatcc gattccggga tcgttttccg ttccacaggc    178080
     tccgtactga cattgtgcag cgaaaacggg ctgtacacct acagcaacca gcattaacgt    178140
     actcagtaaa gtagatttca tacacacctc ttacagtcgg aaaagttact tttgcgcagc    178200
     gcccatttgg gtcaccaggt tttccgggct cagccacccc gtaaataact gcggtttgcc    178260
     gcttagtgtc accatggtag gagtaccttg cagcgggatt gttgaggcca cctggaaatg    178320
     cgatttgata atgtttaagc aagcctcatc aggacgtcct tccgggatag ttgaaaccgg    178380
     attcatcgct gcatccagag cttcgtttgg ctttgctgaa caccagattt tggccatgtt    178440
     cccggctact accgagttca gtcctgcacg tgggaatgca agaaacttaa tcgaaatacc    178500
     ggcatcaaga taagacttca gatcatgatg cagtttttgg cagtatccac aggttatatc    178560
     ggtaaagata gcaagccggt atttttcgtt tggtgatttg tagtcgatgg attttgtttt    178620
     ggatgcgaat tcccggacgc ccattaaaat ggcctgctca gtggtgttta ccacatcttt    178680
     acctttcacg tggaataagc ttccggtaaa aatgtaatct ccgtctttgc tcacgtaact    178740
     taccccctcc ctggaaatca ccgtaaaaat atcttttact ggcgagggtt cgacgtgctc    178800
     gattgaaagc ccaatggctt tgagcttatc ccgggctgca tctggcagta ccattgtatt    178860
     aaccggctcg gcattcatcg tgaaggcggt acttaatgaa agaagtaata ccgatgcctt    178920
     aataattttt ttcatttccg ctccttaaat cgagcactaa tattatcacg ccccaaaatt    178980
     ccagaatttt gcttaaacgc ttaaatcaac gggtaaagcc gaaagaaagt cgatagatat    179040
     atgggagaat agataaaacg tagattcagt ggagaaatcg ttgtgtttac accaccagca    179100
     gatgatgtga aacctattcc cgttcctgat gagatttaca ctcagtgcat tacggatgcc    179160
     gcccgctact tcggaattga tgctgaactg gtttttacgt tgtttgacaa tgaaggcggt    179220
     aaggttggta ctttcagcag gaatactaac ggcacttatg atattggccc aatgcagatc    179280
     aactcatcca atctacctga aataaaaaag catttcccga cggtaacgtg gcgggttctg    179340
     gcttacgatg cttgcgcaag tttctgggtt ggaacatggt ggctctatag aaaaattgtt    179400
     gatcgcaagg gcaatgtgtt tgaagggatt gcagattaca acagcaaaac cccaaaggta    179460
     cgtgcaaagt acatatttaa cttcatggta aagtacaatc gccggatcca gcagcgtaac    179520
     gggatgggtg agctttatca atggacccag caacctcctc gatacaatgg ccatatagct    179580
     aaaaatgtcc cggagcaaaa cccgactcct gttgttaaat aaatacaacc cgatattaca    179640
     gaagatcatc gagtggcttg ggtaaaccac cacaaatatt tcacactgac tcaggagtaa    179700
     tatattgtct tcttctgcaa gaaatttatt taagattctc tcttctttct tgatccagaa    179760
     aaaccctcat catgaagaag tatgtgttca tgaagaaaca acagctggtt tatgggcccc    179820
     tctccctgat tcgcatgtcg tgcttttctt agatttcgat ggggtttgcc acaggtgtaa    179880
     aaatgaaacc tttgagcgaa tgccactgtt agagaaattg ctggataact gccctgccat    179940
     ggtgattgtt atctccagct catggcgtga gtgcgctaat acaagttatc tgaaatctct    180000
     gttccgggtg ccttatagag acaaaatcat aggtgcaacc ggttcggtat atttaaaaca    180060
     cggacagact ggtgtgcggg ctgccgagtg tgaggacttt gtcttttcac atcgagttaa    180120
     agcatttatc tgccttgatg acgacgaatc attatttccg gccggttatc cgcatttgca    180180
     caaaaccgat tattacacgg gcctcaccga atctgacctt gcagctctta acgcaaggta    180240
     ccatcagctc atgggacgct gatgaacaaa gtaactttcc ttttaccctg tcactgctga    180300
     tctcgtacgc ccatccactt taggattgat tgttttatac catacgcaat aatgtctcat    180360
     atgaattcga caagaaaggg acattatgct gcatcactgt caggctaagt cactggatga    180420
     catatacctt gaggatattc cccacatcat acatccggcc acggcggtac atgacctcga    180480
     agataccgcc ctgccaaacc ggattattca ggaatggaat ttaccgcagg gatatacaca    180540
     gtttgtcagc cggtatcacc agttccacca tcaacgcccc tggctcgctt accgcgatac    180600
     gcttgacgac atcagatacg gtaagatcgt tctgcttaga aaagacataa ccggcaatgc    180660
     cgggccgggg gttatatcaa atggcaacct acgcaatgac ctgcccctgt ccctctttac    180720
     ccgtctgcgc gatatcatct ctcgtcagtt gaaacgcccg gggtattacg ttcgatcaac    180780
     gacaccagca cagcacgccc aatcaacaaa aaccattaat tccaaagcgg ctggtcgtct    180840
     tctcgcagct ggcgggcttt ataatggaaa tgtggaggga tttcgacata cggctgaaca    180900
     acttggcggc gaagctgttg aaggctatga ccaggtattg aacgaaacaa cttcaggtat    180960
     gctggttgca gcggcttcac ttctggttat ccgaaatcca aggtctgcgg atgaattgac    181020
     aagttatctc ggcaagtaca aaaaagcaca cgttttgctc gatgatatga atgttagcga    181080
     attgaactac atgcgccgag acagagctga atatttagct ctccgtggac aattcaacaa    181140
     tactgtacgc cctaacttcc ttaaatcact ttcagaccac ccagatgccc tggctacgtt    181200
     tgaacctaac gatttgatga aacttgcaac aggcaaggtc ccctctgggt ggcaggttca    181260
     ccacaagatc cctcttgatg atggtggcac aaacgctata gacaacctgg tacttactca    181320
     gaattcacca taccattcag cactgtcgaa agcacaatcc atcattacga aggatctacc    181380
     gtataattca agcaccaaag ttctatggcc atcgccgaac ggtgttatct acccggtagg    181440
     aaagtaagag gcgctcatga aagatttaac tcaactactc agcagcttaa agaggttgat    181500
     ggttgcagat cactaccctt tagccagccc ggtagccccg gaagtcttga aagacttaat    181560
     ctgcaatccg cctccagtgg agtgggcaga tcacaaaaag agcgcctata tagatataca    181620
     gaaactcatt aaaaccaggc ttgattatgc ccaagtgttt aatgctatgg atggttttga    181680
     gtacaacgga cttacgtttt ataaccttgt tcaggcagag aacgaaaatc tattgtggtc    181740
     aaatatttac atacgcaact ttgaagcacg agacaatgaa atctacgttg acccaaatct    181800
     cactgataag gtgttaatcg gagaagatgg catgtcactt ttcgcttata gttttgcaga    181860
     cgactgcttt cagataagag acaaagcatc tactgattat gttattgaat ctcatacaga    181920
     gtttgataga tttttgtctt cactgattca aaccgtcagt tgaatgttcc gcaagagcgg    181980
     tacttctgaa aaaaaggccg caaacacata ctttgcggcc ttaattgttt agcagtaatt    182040
     tacaatctat tgatagtcat ttcaggaggt tatattcaac ctcccttatt ttttattttc    182100
     attaagccac tgatccgctt tatcgacacg tgactggtaa ggctcatttg tgttgctcag    182160
     ctctgacttc atgtactgaa tgaattcatc tgctttctga ggcccaaagc gtgggtcatc    182220
     cgtcaattgc tgccggatag ccctttcaga gttctgcgct gcattcgcat aagtcgaaac    182280
     gccgtcgctg ctaatactct gataccggtc acttacagct gcgacgccat cagacatctg    182340
     catgtgatta aggactttac cctggagaga atcaggcata tttgcagggt tagaggcatc    182400
     atttgctatc gatgtctggg tttgaaggat gcccgctccc gtaagcatct catttaccgg    182460
     tttcgcccca acgctggtta gcgtatccga aacaaattgc tggcccccga gtagcgcacc    182520
     agaaatcgcg ccccgctcag tgttggcctc tatcttttcc ccaaccaagc gatctgtgac    182580
     ggtctgagtg cggttaccaa cgagaccacc gcccgaccca ccttctccca ggtttgcccg    182640
     tacgactgac tcaagtgaac catcagctct gttatgagtg ttgaaactgc tatggatgct    182700
     cttaacgtca ttcatactcc agttaacgtt atagttaccc agttcattaa ggatcttctg    182760
     ggtatccgct ttgagctgct ctctttcggc accggtagcc atggtgctgg caccataggt    182820
     aaagacagct tgctgtgcca attcagctcg cttatcgtcc cggcttaagt tcgggttgtt    182880
     ggcaacacga ctaaagtagt tatcagtgtt attagataag ccacgaactt gcccgctctg    182940
     atacatactg ttcaaagcag tggctcgttg atccattcca tcaccaacca cccgacctcc    183000
     aaccttttcc agatcgttaa atgtgccttc tgcatttctg acatcctgac ccgaattgac    183060
     gactttctct acaccctgat tattcagtac aggtccattc ttttcgagag aattaagcac    183120
     attcctttct tcatcagaat aagtgcggcc cacgttgttg ttatgtattc cctgaatatc    183180
     gcctttgccc gcgttatcaa ggttatacgg agtaaagcca gcttcacttt ttccagggac    183240
     acgctgtgtc gcgtcctgag cgttggagga aagaccgagt ttagcctgcg aatctacact    183300
     tccacccagt tcccctacgc gtgacgcact catcacgcca gacgtattta cgctgtcagg    183360
     agttctatcc tgtgcctgag tgatagtatt aattcctgac ccgtcacctg aaattctgtc    183420
     gagctgattg gtgataggta gcagctgctg tgcattacca ccgaagtcgg aaaccagact    183480
     tttaagcagg ctggaggttt cacggagatc ctgtttatta ctttcggccg tctctccccg    183540
     ggcggtatca atcgcaattt tttgctcact gaaatctcgt gttgcagcca caagcgcgtc    183600
     agtacgttga agctgcgatc caagctgatt actggccttg aaggtatcgt tataggagtt    183660
     gaatttctcc ataaacgcat tctcatccag cccattctta cgagcaaaat tccttacatc    183720
     atcatcactg aagtttttgt tgcgaataga atcggagaac ctgtccaggt taatgctttg    183780
     tttagaatca aggctcattc cactattgga gcttgcgtta gtcgaaaccg atgtagaaat    183840
     attttgcgcc atcgtctgtg tcgcctggtt cattttcgac gatgcttctt taaacgcatt    183900
     agtattggat atctgatcgc tgcttacctg agacgccgct ttactgaact ggtcagttaa    183960
     cgcagaatcc tggctaagct gattcgtgat tgcttttgaa aggtcatttg aaagcgagtc    184020
     actgcctgta ttggtcttag atgcaccgct actcaattgc cctgctacag ccgctttcag    184080
     cccggctcca ttgccagttc caacacctcc attaagccca gcgttgagaa taacatttga    184140
     agcaatgctg gccatctgag acgcactcac cccatgtttc gttgcaatac cttctgctac    184200
     agaggcacca atcttatccg agatctgctt cattgtttgc aggttggttg agaactgctg    184260
     gctcgactgt cctgaccttc caatttcgct catctgactg taaccagcct ggaatgaatt    184320
     acttgccgca ctcataactg atgaggttac agctgatcct tgtccctggc tgttagcgat    184380
     acttgaacca gcattccaca ttccaagacg gaaattactt gaatcaactg cgccgccatc    184440
     gctgtatccc tgaccggtac tggttaaggc ggttcgtgtc acgtcaccaa atgaagattt    184500
     accgctgtta gggccatccc atactttggg cgttacatga ccagtatcca ccggcgcatc    184560
     gggggtcact cccttaaccg cattcatcat cgggtgaatc gactgtgtca tcaggaataa    184620
     tgtgagtacc ggaatcagag catagagggc ggaagcaaca gacaggtatg aactgtatgt    184680
     ttccgcaagc cctgggagtc ccatccacgt gacggcatta ttctggctgt tgagggtgct    184740
     ccaggtatcc aagtcggccg tcgcgacttt cttcacatac gcgttgacca ttactgccgt    184800
     aagcggccac atattcacga agaggataag ttgcaaatat ttcgccgcag cggcaacacc    184860
     attaccacct aacgccagca gcataagcaa agcaaatgga gcaaccatat aagcaaacat    184920
     ttcaaggaat gcgattgctg ctcccgacag ttgtaaccac aactggccct gtgaagccat    184980
     tgtgttggtt cgcttcagag aagcctcaaa caactgcata tcggaagcca gaccgagtgg    185040
     ggtcttatat ttgcttgcgc catttctgag ctcattcata atgaacaggt tcagggtggc    185100
     gtcatacgaa ccaatagcct taccgtacat accatttgct gacgccataa catcagtaaa    185160
     gcttgcgccg gtaggtgcac catttgcttc gtctggagta aggatgccgt ttgtctgtcc    185220
     tataagggaa atagtctggc gagcttcagc tgtactggta acctgtttca cagttgacca    185280
     gacctcatca cacgtaccag attttgaacc gttagcgcca acaatactgg cagaggcatt    185340
     cttcagtgcg cctttcatcg cctgattaat ccggtccatg ctatctgcca gattagctga    185400
     gaaaatatcg ttaaaaatag tttctttacc ggcaatattt gcgcttgagt tttgggtagc    185460
     cttcaggcag ttgtatgcaa gagactgaac ggtagcacat acgttcattg gccctagccc    185520
     gctggccggt tcaggaaatg cggaacagta gccctggcta tcgccgcccc attgcaaaaa    185580
     cttcacgaat cggatcatcg gaccgagggt gatgtcatcg tccagagttg ttgcagacag    185640
     gtccaccgga gaaagcggat caaacgctgt tttataatcc ttcagcaaac cctggcttaa    185700
     gttagtggtg acggttgcca tcgcagcaat aaaaattgga attccgtcga cgtttctgac    185760
     ctctcccgac tttacagatt caatagttac atccactcga accattgcca tcatgaaaag    185820
     gatcaacccc aaaaaccagg agaaaaacgg taattcattt ttggtcggag cctgaagcca    185880
     tagccacgtt ttatagaata ggctcacacc tgctacaacg gcggccgtgg tcaggaactc    185940
     ttttacacca gtatattgag aaaagatcag ggcaataccg gtaaaagccg accagacaaa    186000
     atcaatatca cccagggtat atatgttgta atccatgtca gacctcagtt acgtgtgcca    186060
     cgaatacttt cagtgaaagc cttccgttgc aggcgacggt tatcccaggt tgaaatgacg    186120
     tccgagctgg taccgacctg gctgtgcgat agctcatagg cggctttaac ctgttttgag    186180
     agattgtctg ttaatcggtt gagatcatcc cttttacccg acagcgactc actcggtatg    186240
     ctcatggttg aaattttggc ctcaacctgg cgcaacatgt tgattacgag gctcgtcgca    186300
     gcaatagtgc tgatgtcctg aatgtatgcg tacccttccg gtgcttcgaa tgtttgcaaa    186360
     gagtcgataa tggtcgggat gccgatatag gagataatgc gtaattcatc atctgaaaca    186420
     cgaacgtcgt tgatgatttt tttctgtacg tttaaaagaa gatcagaaat ggtatccttc    186480
     aatcccttaa aaccaccgtc attaacttct gacatgacaa ggcactgagc ctttcgtggg    186540
     gatgatggat ctggtgccgg agaacacttg agcattttaa ttgatccgcc agctggtggc    186600
     cccatgatgt aatccgtgac agtcatggta gacgggcgga cttccattcc cgctttttcg    186660
     cctttgctat cccagttgat aatgacagta cctacgagag acataagttg ttctgccagt    186720
     ttataaccgg ataactccgt tacccctccg atgttcatcg ttcccttatc aatatccatg    186780
     aacgacatat agaagaggtt accactgaat ttttcagcga actcttcggg atcctttgct    186840
     ttaacctgag aagtgacagc ttcaggtgac tttgtcatcg atgagccaaa atcaggaata    186900
     agaccattaa tcgatcccag aattgaggct ggtccagagc taactgagtt agcgaactgg    186960
     cttggcgtac ccacgttttc agaaaggaaa gagtaagttg cattgcatga atctttcgca    187020
     aatttattta gcgcttgcag tttgttttgg atgtcattaa tcgttgcagc acagtcagca    187080
     caaatagctg aaacagcaac gttaaaagca tagatagccg caccctgggc aataccacgg    187140
     gccacctgca caagctggtc cccgttgatc atgctgaagg acccaagaaa aacgtcaata    187200
     ccgttacaac cgacagaagc ttttggaaac gacatggaaa caaggttggt attaacgttt    187260
     gttgttcggt aagacattga cccgccaact atgcctgtac gggttgctgt ggaaaaggtg    187320
     gccgggctgg tagacgtcat catgccattg aaaatgttac gcattgcgtt gtctgcattt    187380
     gcagtcgggg ctaaaattgc agcacaaaca gaaagagaca aaagtaactt tttgaagttg    187440
     aaaacggcat tactgcgcat aagtgcctcc aaaactgccg ccagcattga gataattgac    187500
     cggatcggcc gtaggcatgt catagccttc gagtttttgg tccattattt tttgaagtag    187560
     gaatgggtct gattccattt cggatttatt aacggtaata acgccatcat cgccgatggt    187620
     atattgcctt ttaatatcta gagttgactg gaacgaagcg tcatcgatca gattcatgcc    187680
     cttcgcggca agtataatag tgttctttaa ttcatcagcg gagatcatgc cttcactaat    187740
     gcgctgagct gatgtcccat cctttgaaac caggaaaatt gtaggtacct ctcgaatttt    187800
     aaattgatca ataatttgtg cgttggggat gttaaaatcc tgaaaaaggc cattatgcaa    187860
     tggccttcca tccatactga ttggaagaat atctaccgaa taatagttct gcataaattg    187920
     aagtatttgg ctttcttcgt ggcaaaactg gcaagtactc tggaaaaaga aaaataaacc    187980
     tgacttagta aagatatctt tcattaccgt ttgctgattt ttttcaacaa cagtgcggtg    188040
     agcatccagt gccacctttt ccactggttg cctgcgtttt tcagacatca tcgggttttt    188100
     aagaaaataa tcttttgatt tgtcagaaaa acgcgtactg atatccagca ttaacctttg    188160
     cgccgtgtaa taacgtgata gattttctgc ggtagggtta tccattgcct gcgttaacag    188220
     tcgaggcata ttctctttta gccattttga atttaaatct accatttcct cttttgaagg    188280
     cgagctagca gcaccggttg gtggcaaaac ctcttcttct tcagcttcgc tttttttagc    188340
     aggatcgtca taccagaaga aacccttctt ataagcctgg ccagatacaa agggcgtatc    188400
     ttttattagg ggttgctcag ggctggcgtg ggcaccagta attaccaaag acataagcaa    188460
     aaccatcttt gaaggcgcta atgcaatacg agtcatagac cgttctcctt ttctgatgcg    188520
     gttatgatgg catacaaaaa aaaggttaga gctcgtatag catggtcgtt tttatgttga    188580
     aaaggacgga aaaggagtgc tgactaagaa gatagtctcg gtgatggaaa gatcatccat    188640
     cttgcacgtt gtcaaaaatc cggtgtaaca aaaacatggt tttatcgaat atctaaaagc    188700
     aaatattgct ttgaaaacag gtgtatttag agctgaaaaa aatcatcaca agtaatgctg    188760
     tttctatatt tcaaaaaagg aatagctaag gatcaaagaa gcgaacttag acaagaatat    188820
     aaaatatatt aattgaaagc gattaagaag tcgtcatgca tagaaggttt tgagaaccta    188880
     agtagtttta cgttttcaac agaaaaaaag gtgcacattt ttggaacgaa gaaaaactga    188940
     ataaagaaaa atcaaattat atctttactt gtcaagagtt gatatttaag ttgtaactaa    189000
     tatttgattg taaagcaaac aacagaattt gacttaagtc aatatttaga ttcagacaag    189060
     gcaagtttcg cgatatcttt tttaaattta atctaattct tcttgagaat acctctctat    189120
     ggctgaagca gttgaagata atctgcaacg tggacaatga gcatcatttg tcactggcac    189180
     aatgtatggg cgtttacatt tttcgcaggc acctagttct tcaatttctt tcatagaagt    189240
     aaggatttct attattttat taacttccgg tgcgcataca aagtatccca gattatgaag    189300
     gacactcatt attcggttga agtcaatttg ccgaaaactc gcttccggat ttattggatc    189360
     aaaaccaaaa tagttaactg cgacatcaat aacagcagaa aaggctcggc ggttatctgt    189420
     gcgtttgctc cagccccgga tacctttttt gagttttgtt tttgcaccag gctcaaaatc    189480
     gatattttca gcaacatgat taccgtacaa aattcgtatt gtatttttat ttgccccaag    189540
     cgacatagtt cttgctgctc gcaatagagc attagctttt gtttgatcga cctttgccat    189600
     atcaataatc ctttaacata actttatttg ttaaagtgtt gaacacatcc tgacggtgac    189660
     tggtgaacat agtgtcataa cgtaatagtt ccatcaaatc atcactaact tttcctaacc    189720
     ggatgtcagc agacaattca taagcccagg caaaaacttt cgttttaagt gaaacactct    189780
     cttcaatatg cccttgtgag aaagcaattg tacgtgggaa aagaacgaca tcgttaattg    189840
     tttttaacga tgaataacca atgtctttaa tagcatcagc tgtagttggt tttaaaccaa    189900
     agaaaatact tacaaactct ggtgcgagca ttgagataaa gaacacctgc ataaagtagt    189960
     cattctgtat atcaacacat ttagaacgca actcatgaat cttcttggga ttatagatat    190020
     ccactgtacc attcagaaaa gtcacttttt caccggcatc gtaaatacca tagtcaatat    190080
     catttgtatc atattcacga attacattgg aatcaccgtc caagaccgca gaaaaaaacc    190140
     tctcccatgt aatttccttt ccgagtgtac gcggaaccaa aaaactacct ggacgtgttt    190200
     ccacttcaaa agctaaatca gcggctgtac taaatccttt cccaaatagg cgacgctgga    190260
     gaagaggagt cccagtttga tatgcagaag atccatgcac aggcaataac attaaaaatg    190320
     cacggtaact acgaataagc gaaatctcag tgcggaaaag tttaccgagt aagctacgag    190380
     ttaaattatc agattctgac atgtgctgat tgtccttgcg ccattacaat tgttcaaatc    190440
     ttcaacatgg attttttgtt aggtgttcgg tagggtgaaa agtaactttt agtattttct    190500
     taaggcttga ataagcctta aatctatccc ttcaaccaca ccgcttactt gtaacacttt    190560
     ttaaccaaac taaccagaat tttatcaaaa attcctgcgc atgctaacga aatgtgaagc    190620
     gattaaaaaa aaacctaaat ccagcccctc ccaacgttgg attagaataa cgacgtcttt    190680
     cactgaccgt cataaactga catttttact tttcatcaac ctcatgctta cataggatca    190740
     ctaaacaaag aaaagtgacc ctatgaatgc ctcacatagg gtcacttatg tttgaaaagt    190800
     gaccctatgt aatgtcgtca tagggtcact ttttataaaa gtgtcactat ggacaaagtt    190860
     ccatagggtc attttttttg gaaaagtggc actagatata tgtataactt taatagagca    190920
     atgcacatta tcaaaagcaa taatccacaa tggtcattct gtcaaaagta actttagggg    190980
     gtagcgatgg aagtgaggct aaactcgctg ttactgtttc tgaaggcccc tcccgaatgg    191040
     gggaaacagc gagtgcatta catctgttca attccctcat caaagagcat tcaaaaatct    191100
     tctgttcgtg aaaaaaaacg gaaatttcct ccggtatagt aatttcacat caggaggcgt    191160
     catgagtaat tcaaatctta taagttctat agagctaaca cgtaaaaatt tacgtgctca    191220
     gattgaaggt ttgcgtgttg aggctgaaga tctcattaca aaatactgga tcaagtggaa    191280
     ggaacgaaac caccaagaga ttaaccttac ccgacatagc aaagttccaa agagggagta    191340
     cctgggttct tacgcaccaa aagttgagct aattggtaat gccagaaaag taacgatcac    191400
     ttggcatcag ttcagccctt ataaaacaag agcgcctagc cacatgtcaa aacgggtgca    191460
     accaatgaaa agtggaaaat attctaagaa ctgttttgta aaccatgcca gctgggaata    191520
     cgaaatgatt tctgaaacgg aagcattgct ggagccttac agagaaatgc ttgagctcta    191580
     tcattcagca tatatcgaac ttggacgaaa aatccgtcaa tactcaaaaa ctaaggtggc    191640
     acaatgaccg acgcaattat cacggacaat gagcgtatta acattgaacc aaaagatgta    191700
     atggtaaaag gttcaaataa aaagcaaggc gtaaacgctc aaacttctac tcaacgtaga    191760
     ccagagcacc agggtatggc caaagttatt attaaccccg gcaccccaga ctttaaccgg    191820
     tttttaactg ccagaaatgg agcagttatc agaggttttg atgatgtgag tatcgctatt    191880
     tcctctctct ttaaaacggt tgatgcagtt aaacatcctg accttgttca ggctatccag    191940
     gattggttca acgagctgca tgaagaaaac aataagatga aagaaaatct tgttgcttat    192000
     attaagtcaa ttgagttcga caagaatgac tcattcatgt catcaactca gtttgtacct    192060
     ttcagttttg aaccagtaca actcaacttc aataaccaca acaccatgag gttttacaag    192120
     tacatcttcg agatgaacca gctcatgaac acaatgtatg agtacaactc attgggttta    192180
     ctggctgtaa gcgactatcc ggttatgtct cacaacatta taaagagtat taatttatat    192240
     gttgagaatg tgaaaaagac tctgaatgtt tctcgccgta aggatgggcc atacagtcca    192300
     gcagagttca tcaccaaagt aatgcaatat aaaagtgtgc aggcatacat tgcagccgaa    192360
     ctgtcaggca aacgtcgata aggtatgatg atgaatttca gggcgctgta tttatgtatt    192420
     aaacggattt tggggatatt ctcatctcag gagaatgatg caacctctgt aatgattgag    192480
     gatatatcaa gcctctctcc ttttgcgcag attctaggag atcagaagta cactgttcct    192540
     gatcatccaa atccagaagt cctgaaattc atcgagtatc caactcgtcc gacgggcata    192600
     cagacattta atgaacagtc aatcctgtct ctgtatcggg aaaagctgca ctcaatttca    192660
     atgatgttag ctatcagcga tagcgacatc agggacgatg catatacatt tactaattta    192720
     gttttaaagc ccttggttga atatgttcgc tggatacatc ttttgccagc ttccgaaaat    192780
     catcatcata atggtattgg tgggttactt tctcacagcc tggaagtggc catactctct    192840
     ttaaaaaatg cgcatcactc agaactgaga ccaatcggat atcaagatga agaagtagtc    192900
     cgtagaaaag tatatctcta tgctgcgttt atctgtggtt tagtccatga tgccggaaag    192960
     gtttacgatc tcgacattgt aagcctgaat ttagctagtc cgatcatttg gacgccaagc    193020
     tcacaaagtc ttcttgactg ggcacgtgaa aatgacgtgg ttgaatacga aatccactgg    193080
     cgaaagcgta ttcataatca acataatatc tggtccagcg ttttccttga gcgaatccta    193140
     aacccggtat gtcttgcatt tttggatcgg gtaaataaag aacgtgttta ttcaaaaatg    193200
     atcaccgccc taaacgttta tactgatggg aatgactttt tgtctaaatg cgtgaggacc    193260
     gctgatttct attctactgg tacagacctt aatgttttac gtgaccctat catgggtctg    193320
     cgttctaatg atgcagcagc aagggccatt agtaccatca agcacaactt taccagtatc    193380
     aatatcaaca attacaatgc taagcctatg cacatcatta tcgtaaatgg tgaggtatac    193440
     cttaacgaga acgcattcct tgattttgtt ctcaatgatt tcgaattaca taaatataac    193500
     ttccctcagg gagaggctgg taagaccgta ttggtagaat ccctagttca acgtggttac    193560
     gtcgagccct atgatgatga gcgtgtcgtt cactacttca ttccgggtat ctattcggaa    193620
     aacgaaatat caaacatctt tagaaatggg atagggaaac tagaattcta taaccttctt    193680
     aagctaaggt ggattggttt aatctttgat tcctataaaa tccctgactc agtgccgggt    193740
     ctttttagcg ttaatgccaa taaagacttt atttacattg acgagcaaaa aacagttact    193800
     gaatacagaa gaccagtgcc cggtcgggac gttataacta aaattactga tactgttgag    193860
     acggctgttc ttaaggttaa tgatttaggc cgctcctctg cctctattga tgttgatata    193920
     cattctaaga aaaatgaagg ctcatccgac gattttgaga agaaagccga aagtgataat    193980
     gaaattgata atgacacgca gatagttaaa tctgagggtg aggaagcagc tgatcctgtc    194040
     attcctgata tagaagaaag tgaagatgaa tcggcaaagg acacggaatc ccatgtcctg    194100
     gtcaaccaac ttcatgaact ccttttaagc gctccacttt ccaatgacta tatagtgtgt    194160
     gttgatgctg tcccctacct caacatagat accactatgg cattgctgcc gggattagat    194220
     gaaaaagcat tcagtgaaga gccctatttc caactgacat tcagagaagg ctctctcgat    194280
     ggaatgtgga tagtaaggga cattgacgat ctgcgtttag tccagctcgg cgataactgc    194340
     gccgggttcc agctcaccta tcatgagcca agaaggccaa caactttaaa gtcacttttc    194400
     aatacttcta tgtatcaggc attagtgatt aatgatgagt cttctgttga aaactctgcc    194460
     ccacgtccaa agcaaacgct tgagctgcct cccccacgtg taaatgcagt cgaagaacat    194520
     tctggcgacg tggaatatca tggaaccgat agtgcatccg cgactggtcc gctgaaaact    194580
     gaggctgtgg aatatgaaca ttatcaacat ctttttgaga aagaagatga agagcatgag    194640
     atcattgatt ataccgattt ctcacagctt agtgtttctc ggccagaagt cggtagttgt    194700
     gcaacaagct cttcggtcca taatgaaaag cttctctccg agccgtcaga attaccagaa    194760
     cttaaccgag aacagaacgc tgatccccag ggtacgaatg aacgctctat ggatgtttct    194820
     gtaggacaag aaaactcaga accagatact gagggtaact gcccaccacc agctgaagtt    194880
     gtgtattccc agaccgaagc aaccgcaacc agtgtgatgg caagtgaaga gcccgcctta    194940
     cctcctgtac ttgaagaatc aaatggagag catgcgccca cagacgctaa ggggcatcat    195000
     ctttcgccag cactggccag actgttcgcc ccaacagcac cggtagaaaa acaaaatccc    195060
     aagcgcaacc ggaataaatc atcggacaaa gcagaagtac aaaaaccagc atcacctgtt    195120
     tctggtcaca atctgaacag taaagtcttt gcatctactg aatcagacca aaatggtgaa    195180
     ttctcgctta taagcgaagg tgacgttaca gagcttgaat ttgtagaaat tgcgttagta    195240
     ctgcatcaaa ttctgtccaa aatggaggtg gcgtttaaaa gaaagcgcaa aaacagattt    195300
     atggtaagta ctcctaatac tctctatctg acccaatctt gcgtggaaaa atttgggtcg    195360
     cagttagagg ctcaagatct tttcaataag cttcctcagt acctcgttaa ttctggtgct    195420
     gtgatcaata caaaatgcca tgcatttaac atgcctactt tgctggccgc atcagaccgg    195480
     gcgaaagtgg acattgaacg aattatcaat aacctgaaag aggctgggaa cctataatgt    195540
     cagattcgaa gaggactaac ctccatgcac aagagaattt ttatcggcct attcttgagt    195600
     atcgtagtgc ctcaatactt ttgatttgtt cggtttctat gctttatatg ggactttctt    195660
     cagacggact ggacatcgcc ccaatagttc tgttcacctc aatattgctt tttttgctgt    195720
     gcctttatcg ttgcaaaaca gcagcgccat ttttgatggc tcattggcgt gtattcaagc    195780
     gacatttcat gttcgttagt cttgattcac tgcgtgtaat taacaaaagt aactttttct    195840
     ccaatgagcg aaagtatcgt caactggttc aggattatca aaataaaaat aaggatatac    195900
     ccgagcgaaa gtcctatttt tgtgatgggt ttgagtgggg tccggaacat gcggatcggg    195960
     catatcaaat agctaacctc tccagtgata aacgtgagat cgagttgcca ttcgtcttca    196020
     acccaattaa gagacatttt gacgcaatgg ctcgtaagat gggcggcagc aatgcaattt    196080
     ttgctgtgga acgtagggaa cccatatttg taactgaaga caattggttt ggtcatactc    196140
     tgataaccgg aaacgtgggt accgggaaaa cggtgctaca gcgtttacta agcattagca    196200
     tgcttcatct tggtcatgtt gttgttgtca tagatccaaa gaacgatgca gagtggcgag    196260
     aatctctaat ggaagaggct aagaccctcg gtcttccttt ctataaattt catcctggcc    196320
     agccagcatc ttcggtctgt attgatgtct gcaacaccta tactaatgtt tctgacctaa    196380
     catctcgtct tttgagcttg gtgacagttc ccggtgaggt taacccattc gttcagtatg    196440
     ccaaggctct cgtttccaat gtgatttccg ggctttctta catagagaaa aagccttcta    196500
     tttatctgat tcacaagaac atgaaaagcc acatgtctat tgtgaatctt acagtcaagg    196560
     taatggagtc atgttacgcg agatattatg gttacgatgt ctggaccgaa aaagttaagt    196620
     acgtcgctaa cgataccttg ccggtacgtt tcaagcgtct cgctgaatgg tttacggctc    196680
     atttcatgaa ttacgagggg tccgaacaaa tagactggtt agatactgtt tcccagctta    196740
     ttgattactc aatgtccgac ccagagcata tggctaaaat gaccgcaggt attatgcctg    196800
     ttttcgatat gctcattgaa aaacctttaa atgagctttt atctcctaac ccgaactcag    196860
     tatcatcaag agaaattgta acaagcgaag ggatgttcag cactggcggg gtgctataca    196920
     tttcgcttga tggcctttca aaccccgata cagcagctgc tatttctcaa ttaataatgt    196980
     cagatctgac ctcctgtgcc ggtagtcgct acaacgctca agatggtgat atgtcagcta    197040
     attccaggat aagtattttt gttgatgagg cacactcagc cattaacaac cctatgatta    197100
     accttctggc gcagggtcgt gcagcgaaaa ttgcactgtt tatttgcacc caaaccatct    197160
     ccgactttat tgctgcggca agtgttgaaa ctgccaatcg aattacgggg ctctgcaaca    197220
     attatataag cttgcgagtc aacgatactc ctactcagac gcttgttgta gagaactttg    197280
     gtaagagtgc gataagcaca aatatggtca cttatacgac cggttcagaa acatctttgc    197340
     cgcataataa cttctcaggt tcaatctcag aaagaaagca gacaacttta gaagagagta    197400
     ttccaaagga tctcttgggt caggtcccta tgtttcacat agttgccagg cttcaagatg    197460
     gcaggaaggt tgtaggccaa atccctattg ctgttgctga gaaacaaatg aagccaaaca    197520
     caactctgtc ggaaatgctt ttcaagaagg ccggaaaagt tactttgcgt caaaatctcg    197580
     atatcaaaaa tcttaataaa tttctaagga agttgcattg atggatgaaa aaattgtcct    197640
     gacgcgccag caaattttaa gctctgcact aaaagtcagc aaatgtcgct cgctcgtaaa    197700
     aaggcgcttt cagtctttgg gtttaaagta cgcagattct caggaagttc gagatcggct    197760
     aactaagata gaaaaaaacg cgtttcatca tttgggaaaa ttttgtcaga gcaacgatat    197820
     cgattcccta ttctccatgg caaataccct gtctgagctt ttccttttaa agggagagtt    197880
     gatcacgact gatccctttg gggaccgtga aaccagctac tggtcggtac cacaaggatc    197940
     atgccatgaa tggattcaat cgctgaccac cagcgaaggt cctgaacgta aattcgttag    198000
     tttccgtatt tctttcgata acaatgacga acggtgtgat cttgtaaaaa agaatgcccg    198060
     tatgcttggt tgttatcttt tgccttattt cgtcgattta acacgcacgg tgggcgcatt    198120
     cattaatttg ccaggtagtg tctcttttaa acaagtacag cgcatcaaac cccagattca    198180
     tccagaaaca acacatagtc atatagttac tattgaggac tctccctttc tttctcggtt    198240
     aaaatttaaa atcattactg ccatagatca gcttcctgac cctaatggcc tttatacaaa    198300
     cacctttaac agcattattg accgtgcact gctgactcat ctcaaaaccg aacaggaaaa    198360
     aatagatagt ccaagagtct gcaaaaatgt gatttcggct tttgccgact caactctttc    198420
     tctgccggtg tttaacatcg gcctaaacga gcagtacaga tactggacgc cgtggggcat    198480
     caactttata gaattttccc gccaggccgc aaaagcaagg accgctgtat ttgttcctga    198540
     tgtgggacag atcgagtgga aaagcgcaga gcataaagaa ctggcggagt taagcctcat    198600
     cgaccaaatc atacctaaac agtaccactg gctcctgggt atcccgacga tgtggcgtaa    198660
     caactattgc aatcacgatc agaggctagc tctttttcgt gaatggaggg aaagcaatgg    198720
     ctgcggataa tacaagcagg gcagcagtgc tcagaacaat gttttttttt ggcatggtca    198780
     tttattttgg ttacagcttg gctttccaga atactgagga gctcaaatat cagattactc    198840
     aggaggttaa tgcaagccgg tccatcatat caaatgaccg ttggaagtct gttattgcaa    198900
     atagtgaagc gactttaaat tggttggtac atgactataa gttaattgac tatctgaata    198960
     ctattctgat ccctgacacc aaaaaaccag ccagaggtat taacattgtt gctgaaaaat    199020
     ttacctctat taattacact atggccaaaa acatacccct cttactttat cagtccattt    199080
     tccggtggaa cttaatcctg gggtggctaa tcgtttttct gccctatcta tttgccatgc    199140
     tagcagatgg aatgtaccag tggaaattga agaggtacgt atttggtaag gttacagttc    199200
     agttttatcg tatttggttt cgagcatttt gggtgatcag tgctttaacg atggtctacc    199260
     tggtcatgcc aaatatgtca ctatttaaca atatcgctca acttttccca ccagtcgctt    199320
     tattgatact gggaattgca ttgaatcgct tgtggtctaa ctttcaaaaa ctcatgtaaa    199380
     ggtggtcaga tgttaagcag taaaaaaagg aagtccccta caaatatcaa agaatcgctc    199440
     aatgataacg ctgaccgttt ttataagatg tttcgcattc ataccacggc aaaagttgct    199500
     atgtcgctaa ttgccatgac cgctgtaggg ttttctttct acaatcttta cgaacaatgg    199560
     caggacgctg aagggaagaa agaccatata gctgtaatac ggatttctgg cgagatgggt    199620
     accggctcgg aaacgggcga tggaacagtg atcgcaacag ctcttgccaa agcttacaat    199680
     aatccccatg ccaaagcagt tattatcgag gcagagtcag gtggtggtgg tccctctgac    199740
     gccatcatta tttaccgcca gataaacgcg cttaaaaacc accagccaca gattgaacgc    199800
     gtatcagatg ccggtggctc tctttcatct gtagccgctg acaagagtaa caaaaccggg    199860
     agcacagaac gtggcgatga agcacggtcg aagcaaaact ccctcgaagt actctccagc    199920
     ggtaccggtc gttttttctc tgatatcgca gactcatata aaccaatcat cgttagtgtg    199980
     aaaggcatat gcgcatccgc atgctattac gcggtatcgc ccgctgatgc aatttatgcc    200040
     gacagtaatg ccctgatcgg ttctatcggt gtgcgtatgg accactggaa tctgtcagag    200100
     atcatgagca cagtaggcgt caagaatgag ccccttacgg ccggtgagtt caaagatgct    200160
     cttgacccct tccacccatt gtccgattca acgagggagt tcatgcagaa ggagatcctg    200220
     aacacgatgc atgaaaaatt tataactgat gttgaacttg gacggggtaa aaagcttctc    200280
     tcgcgtcatg atgccgatgc tgtttctctc tattcaggcc gtgtatggcc aacacctcag    200340
     gcagttaagt acggcctggt ggatggagat cttacgtcag tagagatccg tacacgtctt    200400
     tcaaaaatgt actccactga cacgttcaaa aactacaatg agcctcatcg taatctccgt    200460
     tctgcactcg gcatgctgat gagcctgtct tcaaatattg agagccttac cggtaccact    200520
     acccgcttgg tagaatctgt taatgccacc agctacccct ctgtgaggta acatggatgc    200580
     tttcaatctg ctgtggagca ttacgggggt agctttcatt atccttattt tcgtcgtgtt    200640
     gctgtgtctg ttgggattta tgacctctgc catagcggaa cggcggactg caaaggcaat    200700
     tgaatctggg cttcctgaag aagctcaggg gctacttagt gatctcacct ttcagttgtc    200760
     ggctcatagc actacgcagg ttgatcacat tctcgtagcc ccacatggta tatacgtcat    200820
     agagcagaaa aactacgtag gcaagctcta cggtactctg gaggaaagcc actggcggaa    200880
     atggactcag tcccgaaccc tcaagttgca gaacccgttt aagcaaaacc aggggcacat    200940
     cagggctatt cagtctgctc ttaaggctag agaactggaa tgtatcaatg tcgtcatcat    201000
     aaacggacgt tgtaagtttg atggcatcaa gccggaatgg ttatgtatgg ggatggacga    201060
     ttttatccat aaagtcaaac aacgacgagg gctacggttg ttcacaccgg agtctgttca    201120
     gcacatctgt tcggtgttga agtcaacaag gaagtcgcca gggctctata cggaccttac    201180
     tcatattcat aacataacga caaagtacaa agccccgatg aaattcgagc aacgagtaac    201240
     atacattctg ctcaacttta tccattatct gtgggcaagt ctgttcacta agcagaagcc    201300
     ttagcgctct atcattggta aggctgtaaa atgtctgcaa aaggccccat cggtaaattg    201360
     ttggggcttt ttctttgcgt agttctgata cggtttatcc tgtggagcat tatggccacc    201420
     agccagctgg tgactggcca acgctttgta tgacgtagcc tactcagggc aggctatttt    201480
     agagggaccg atttttatcc gggctaattt agaaagagat aatttgaact taggcgggct    201540
     gaccaccagc agagaggtaa atcactagcc ggtgatattg acagaagtcg tcaggggttt    201600
     aacgccggaa tattttgcca ggcctcctgc aaggtctgca agacttctac aagtgatagt    201660
     gacggccaca ggactgtttc cgtcattatc actccaggtg gctcgcactc tactggtacc    201720
     agaattaaaa caacacgagt tccttttacc tggtaggcaa ggtttactgc cggttggcgg    201780
     taggaggcca gtacaccctc accatattga gcagggttac ttgcccagtt ccgcaccatt    201840
     gcatacacct gaggcatata ccgactatcc agatcccctt tgggccgtct gaacggcacg    201900
     atttcttctg agcggtaggt ggtcgttgtt gtattggttg tcatctttgt cacctcccct    201960
     gttcgtccat ttagagtttt aagctgcttt acacatcaca ctcaactgat tatttaagct    202020
     ggtcatcgtc tctggccagc atagcccaac cattcgcctg gttttcgcgg gagtaaggat    202080
     tcatttcaaa ataactatct accgcgtcgc tgtccgcaac agaactgttg ttagctctct    202140
     ttgaaccctg aaccactaca gcatcaacct ctgcggcttt cccgttgcgc tgtaccagga    202200
     ttttaaccgt attgggcttg cgtcttgcga gcagtttgtt ggcgataaaa agcacaacaa    202260
     tccaggccaa aagcacgtat aaaaatgtat tcataatgcc ctcctttgta tgtgattatt    202320
     atacctgctt ccattgcagg ccaaacaggt tcggtgcatg aaaaatagac ttctctccgg    202380
     cgtatagcaa tctacttact gatctgtttt cgtatcaaac tgtatggcat aaccgagggg    202440
     cgtacgtggt gagtcagaaa gttacttttc cgtaatagtt aatttcagat ccttcttcca    202500
     gttacgcttc agtataaaac cgataccctc taattcagca tccttcacgt ttaatacgct    202560
     tcactttaag gcagggcttt tcggttgaaa tgaattcttt ttccggttgc tggacatggg    202620
     tttcatcctg atagttaaag ttgcaggcta tcagtcacca ccaccacctc cgtcacctcc    202680
     tccaccgcca ccatcacaac caccagctat gctattttca ccattacaat cacctccgag    202740
     ggggttcaaa tggctgctcc cctgtagatg gtgtccttgc cagatcgaac ccgaaccagc    202800
     gcctcctgag cgctgatgaa tcccctaatg attttggtaa aaatcattaa gttaaggtgg    202860
     atacacatct tgtcatatga tcaaatggtt tcgcgaaaaa tcaataatca gacaacaaga    202920
     tgtgcgaact cgatatttta cacgactctc tttaccaatt ctgccccgaa ttacacttaa    202980
     aacgactcaa cagcttaacg ttggcttgcc acgcattact tgactgtaaa actctcactc    203040
     ttaccgaact tggccgtaac ctgccaacca aagcgagaac aaaacataac atcaaacgaa    203100
     tcgaccgatt gttaggtaat cgtcacctcc acaaagagcg actcgctgta taccgttggc    203160
     atgctagctt tatctgttcg ggcaatacga tgcccattgt acttgttgac tggtctgata    203220
     ttcgtgagca aaaacgactt atggtattgc gagcttcagt cgcactacac ggtcgttctg    203280
     ttactcttta tgagaaagcg ttcccgcttt cagagcaatg ttcaaagaaa gctcatgacc    203340
     aatttctagc cgaccttgcg agcattctac cgagtaacac cacaccgctc attgtcagtg    203400
     atgctggctt taaagtgcca tggtataaat ccgttgagaa gctgggttgg tactggttaa    203460
     gtcgagtaag aggaaaagta caatatgcag acctaggagc ggaaaactgg aaacctatca    203520
     gcaacttaca tgatatgtca tctagtcact caaagacttt aggctataag aggctgacta    203580
     aaagcaatcc aatctcatgc caaattctat tgtataaatc tcgctctaaa ggccgaaaaa    203640
     atcagcgctc gacacggact cattgtcacc acccgtcacc taaaatctac tcagcgtcgg    203700
     caaaggagcc atgggttcta gcaactaact tacctgttga aattcgaaca cccaaacaac    203760
     ttgttaatat ctattcgaag cgaatgcaga ttgaagaaac cttccgagac ttgaaaagtc    203820
     ctgcctacgg actaggccta cgccatagcc gaacgagcag ctcagagcgt tttgatatca    203880
     tgctgctaat cgccctgatg cttcaactaa catgttggct tgcgggcgtt catgctcaga    203940
     aacaaggttg ggacaagcac ttccaggcta acacagtcag aaatcgaaac gtactctcaa    204000
     cagttcgctt aggcatggaa gttttgcggc attctggcta cacaataaca agggaagact    204060
     tactcgtggc tgcaacccta ctagctcaaa atttattcac acatggttac gctttgggga    204120
     aattatgagg ggatctctca gtgcattgcc tccaattccc ataatttatt acgccgataa    204180
     taacttggtg taaccttaaa aatgtactta aatcgacgtg taaaagattg ttgggaatca    204240
     aattgatatt ttaatgcgat ctcaaggata gtttttttcg tcaacctcaa ctcaacagcc    204300
     gctttcgtca aacgacgagc acgaatatag ctagccagtg tgacccctgt tacttttttg    204360
     aacagccgct gaaaatacca cttggtataa cccgctttat tcgccacatc atcaagcagt    204420
     aaagactgat ctaaattatg ttcaatccat aatagaacat ctttgataac cgttgtatga    204480
     aactgcttat catcatatct taattggatg ttattagctt tattttgata gcgagaatgc    204540
     tgttcaatat acataaaata acctaaatgt tcttaagatt gtcacgacca catcatcatg    204600
     ataccataaa catactgacg gtatgttatt ttaaatctat catggaaaat aaaaatcatc    204660
     aacaagaaaa ttttaagagt acctatcaat cactggttaa ctcagcacga atattgtttg    204720
     ttgaaaaagg ctatcaagct gtttcaatag atgagatctc gggaaaagcg ttggtgacca    204780
     aaggtgcctt ttatcatcac tttaaaaata aaaaacaatt actcagtgcc tgttataagc    204840
     agcaattaat tatgattgat gcctacatca caacaaaaac tgatttaaca aatggttggt    204900
     ctgccttaga aagtatattt gaacattatc ttgattatat tattgataat aataaaaacc    204960
     ttatccctat ccaagaagtg atgcctatca ttggttggaa tgaacttgaa aaaattagcc    205020
     ttgaatacat tactggtaag gtaaacgcca ttgtcagcaa attgatccaa gagaaccaac    205080
     ttaaagctta tgatgatgat gtgcttaaaa acttactcaa tggctggttt atgcatatcg    205140
     caatacatgc gaaaaaccta aaagagcttg ccgataaaaa aggccaattt attgctattt    205200
     accgcggctt tttattgagc ttgaaagata aataaaatag ataggtttta tttgaagcta    205260
     aatcttcttt atcgtaaaaa atgccctctt gggttatcaa gagggtcatt atatttcgcg    205320
     gaataacatc atttggtgac gaaataacta agcacttgtc tcctgtttac tcccctgagc    205380
     ttgaggggtt aacatgaagg tcatcgatag caggataata atacagtaaa acgctaaacc    205440
     aataatccaa atccagccat cccaaattgg tagtgaatga ttataaataa cagcaaacag    205500
     taatgggcca ataacaccgg ttgcattggt aaggctcacc aataatccct gtaaagcacc    205560
     ttgctgatga ctctttgttt ggatagacat cactccctgt aatgcaggta aagcgatccc    205620
     accaccagcc aataaaatta aaacagggaa aactaaccaa ccttcagata taaacgctaa    205680
     aaaggcaaat gcactactat ctgcaataaa tccgagcagt actgccgttt tttcgcccca    205740
     tttagtggct attcttcctg ccacaaaggc ttggaatact gagtgtaaaa gaccaagacc    205800
     cgctaatgaa aagccaacca tcatgctatt ccatccaaaa cgattttcgg taaatagcac    205860
     ccacaccgtt gcgggaattt ggcctatcaa ttgcgctgaa aaataaataa tcaacaaaat    205920
     gggcatcgtt ttaaataaag tgatgtatac cgaattcgat tgcgtctcaa cccctacttc    205980
     ggtatctgta ttatcacgtg tatttttggt ttcacggaac caaaacataa ccacaaggaa    206040
     agtgacaata tttagcaacg cagcgataaa aaagggacta tgcggtgaaa tctctcctgc    206100
     aaaaccacca ataataggcc ccgctattaa accaagccca aaacttgccc ctaaccaacc    206160
     gaaccacttc acgcgttgag aagctgaggt ggtatcggca atgaccgatg ccgcgacagc    206220
     cccagtagct cctgtgatcc ctgaaagcaa acggcctaaa tacagcatcc aaagcgcact    206280
     tgaaaaagcc agcaataagt aatccagcga tgcgcctatt aatgacaaca acagcactgg    206340
     gcgccgacca aatcggtcag acatttttcc aagccaagga gcaaagataa cctgcattaa    206400
     cgcataaagt gcaagcaata cgccaaagtg gttagcgata tcttccgaag caataaattc    206460
     acgtaataac gttggcaaga ctggcatgat aaggccaatc cccatggcat cgagtaacgt    206520
     aattaccaat gcgatctttg tcgaactatt catttcactt ttctctatca ctgataggga    206580
     gtggtaaaat aactctatca atgatagagt gtcaacaaaa attaggaatt aatgatgtct    206640
     agattagata aaagtaaagt gattaacagc gcattagagc tgcttaatga ggtcggaatc    206700
     gaaggtttaa caacccgtaa actcgcccag aagctaggtg tagagcagcc tacattgtat    206760
     tggcatgtaa aaaataagcg ggctttgctc gacgccttag ccattgagat gttagatagg    206820
     caccatactc acttttgccc tttagaaggg gaaagctggc aagatttttt acgtaataac    206880
     gctaaaagtt ttagatgtgc tttactaagt catcgcgatg gagcaaaagt acatttaggt    206940
     acacggccta cagaaaaaca gtatgaaact ctcgaaaatc aattagcctt tttatgccaa    207000
     caaggttttt cactagagaa tgcattatat gcactcagcg ctgtggggca ttttacttta    207060
     ggttgcgtat tggaagatca agagcatcaa gtcgctaaag aagaaaggga aacacctact    207120
     actgatagta tgccgccatt attacgacaa gctatcgaat tatttgatca ccaaggtgca    207180
     gagccagcct tcttattcgg ccttgaattg atcatatgcg gattagaaaa acaacttaaa    207240
     tgtgaaagtg ggtcttaaaa gcagcataac ctttttccgt gatggtaact tcacggtaac    207300
     caagatgtcg agttaaccac cctttagatt cataaagcga aaataatgcg gctccaacgt    207360
     acccacctaa atggaaacgg cgttcactcc aatctaaaca cgcacaacag attttacgtg    207420
     aatgtttgga aggaacgtca attcccattt catgaaaata ttgaatacca cttaatgtga    207480
     tcattgaacc attttcagtg atccattgct gttgacaaag ggaatcatag atcttaacgg    207540
     caacttcgcc agctaaatga tcatagcaag tacgtgcttt tcgtaaatgc actggcgtgg    207600
     aaactttggc atgtacgcca tggtttaagg agatccccat catactttcc atcaattcag    207660
     caatatcttt tcctgctagc cgaaaataac gatgcttgcc ttgagctact actgtgatta    207720
     gctggcaatc taataattta gataaatgac tgctcgccgt tgaagctgat atattcgcca    207780
     cagaacttag ctcagtggcc gtccaagctc gcccatccat caaagcactg agtattttaa    207840
     ctcgtgaaat gtcagacata gccgccccta tcgcggctat tgaggactca aaggtaacct    207900
     cttttcgtat taaattagcc atcgcaagtt cactttattg cccaagggag cgtaacagat    207960
     gcagccatac tatcattgtc cgttattaat atcagttggt tagcatggtc actgtattgc    208020
     actaaaatat taatgttatt ctccgccaat actcgtgcta tttcgccaag ttcccccggt    208080
     ttttcctgtt ttaacttacg aattaatggt gtccggatcg caagtactaa cagtccagct    208140
     tgctctagcg ctattttagc ttcctttcct tgttcaacaa gaaaatgagc atggcattca    208200
     tcaccaaccg taaatatccc tcccccttcc aatccaatac ctttattacc taatgttttt    208260
     cctagtaatg ctaattgtcc tatttgatta tctaaaacaa cgtgaacatc aaacattatc    208320
     cttgtccttt ttaaatgaat attcgcgagt aatatgagca atactaattt tgtaaaaatc    208380
     aaatattgac tctcgccctt cttgttgagc tttcgcatgt aaaacatgat ttttccattg    208440
     cagaactgcg tattcgtttt cccaccaaga tagcgataac atttttcctt ctgtagctag    208500
     actttgaaaa cgttcaattg aaataaaacc agctacatga cttaatagtg gtcttaactc    208560
     ctcagctaaa gtcaaatagc gagtttgttg gtcgggttgt atttgcacct caaatattac    208620
     agcaatcata tttttctccg ttattaatca acaaacagag taatccaccc gaaaattaac    208680
     acttcgataa gcaacgaaat atagaaaggt catgctgctg ttttatgttg tatatcacac    208740
     ttctttaaat tgctcggcct gcgcttatca tgttctcctt ctcttataat tttgtttatt    208800
     atttatactt ttttattttt tgctatcacc gaaaatagtg cggatcccgc atggtattta    208860
     ggtttaccca tcattaaata ccattgttgt tattttaatc tttttaatat ttcatgatta    208920
     agatcacact aaaattatga ccctattaac taaaagttat ggatacccta ataaaactca    208980
     ttgttaaaga ttagttaacc aaagtaactt catttttcac tattgttaaa ttgttatagt    209040
     gaaaattctg gtaaactaat agaggtaaaa aaatgatcct agatgccagt tatacattat    209100
     tagtcgcatg tatcgcgcta ctcataggaa tgtttgtcgt aaaatttacc ccgttcctac    209160
     aaaaaaacca cataccagaa gccgtcgttg gtggctttat tgttgcaatt gttctgttaa    209220
     ttattgataa aacatcaggt tattcgttta cttttgatgc ttcattgcaa agtttattaa    209280
     tgctcacatt cttttcctct atcgggctaa gttctgactt ttctcgactg attaaaggag    209340
     gaaagccgtt agttctatta actattgcag taacgatcct aatcgccatt caaaatactg    209400
     tcggcatgag tatggctgtc atgatgaatg aaagtccatt tattggctta attgcaggtt    209460
     caattactct aacaggtggt catggtaatg ccggagcatg gggccctatt ctcgctgata    209520
     aatatggtgt aacaggcgcc gttgaattag cgatggcttg tgcaacactt ggattagtgt    209580
     tgggtggttt agttggcggc cctgttgccc gtcatctttt gaaaaaggtc tctattccta    209640
     aaacaaccga gcaagagcgc gacactatcg ttgaagcttt tgagcaacca agcgtcaaaa    209700
     gaaaaatcaa tgcaaataac gttattgaaa ccatttcaat gctgattatc tgtattgttg    209760
     ttggtggcta tatcagtgca ttgtttaaag atacttttct gcaactgcct acttttgtct    209820
     ggtgtttatt tgtcggtatt attatccgta atacactgac tcatgtattt aaacacgaag    209880
     tgtttgagcc gaccgtcgat gtattaggta gcgttgcttt atcgcttttc ttggcaatgg    209940
     cgttaatgtc attaaaattt ggtcaattgg caagcatggc agggccagta ttaattatca    210000
     ttgctgtaca aactgttgtc atggtgctat ttgcctgctt tatcaccttc aaaatgatgg    210060
     gcaaagatta tgatgctgtc gtgatcagcg cgggtcactg tggctttggt atgggagcaa    210120
     caccaacagc aattgcgaat atgcaaacag tcacaaaagc atttggacca tcacataaag    210180
     ctttccttgt cgttcctatg gtcggtgcct ttattgttga tatttcaaac agtatcttaa    210240
     ttaaaatatt tattgaaatt ggtacatact ttacctaata gctacacact actcggcgta    210300
     cttctcctaa caatttatta tagggcagta tgccgagccg ctttcttacc ccgtatattc    210360
     ccctagtcaa tctatttagc ttgcacgttt acgaattaat tctcgtgaca actaaaccaa    210420
     aatttgaatt atgacgagta tatctgatta tttatacttt attcgttaga atagtccgta    210480
     gaaataaata atcagtaggc tacatggaat gaaattaaga catctcgata tcttttatgc    210540
     tgtaatgact tgtggttcct taacgcgtgc ggctgaagtt ttacatattt ctcaacccgc    210600
     ggcgagtaaa gcactcaaac atgctgagca ctgagagatc ccctcataat ttccccaaaa    210660
     cgtaaccatg tgtgaataga ttttgagtaa gcagggttgc agccacgagt gagtcttccc    210720
     ttgttattgt gtagccagaa tgccgcaaaa cttccatgcc taagcgaact gttgagagta    210780
     cgtttcgatt tctgactgtg ttagcctgga agtgcttgtc ccaaccttgt ttctgagcat    210840
     gaacgcccgc aagccaacat gttagttgaa gcatcagggc gattagcagc atgatatcaa    210900
     aacgctctga gctgctcgtt cggctatggc gtaggcctag tccgtaggca ggacttttca    210960
     agtctcggaa ggtttcttca atctgcattc gcttcgaata gatattaaca agttgtttgg    211020
     gtgttcgaat ttcaacaggt aagttagttg ctagaatcca tggctccttt gccgacgctg    211080
     agtagatttt aggtgacggg tggtgacaat gagtccgtgt cgagcgctga ttttttcggc    211140
     ctttagagcg agatttatac aatagaattt ggcatgagat tggattgctt ttagtcagcc    211200
     tcttatagcc taaagtcttt gagtgactag atgacatatc atgtaagttg ctgataggtt    211260
     tccagttttc cgctcctagg tctgcatatt gtacttttcc tcttactcga cttaaccagt    211320
     accaacccag cttctcaacg gatttatacc atggcacttt aaagccagca tcactgacaa    211380
     tgagcggtgt ggtgttactc ggtagaatgc tcgcaaggtc ggctagaaat tggtcatgag    211440
     ctttctttga acattgctct gaaagcggga acgctttctc ataaagagta acagaacgac    211500
     cgtgtagtgc gactgaagct cgcaatacca taagccgttt ttgctcacgg atatcagacc    211560
     agtcaacaag tacaatgggc atcgtattgc ccgaacagat aaagctagca tgccaacggt    211620
     atacagcgag tcgctctttg tggaggtgac gattacctaa caatcggtcg attcgtttga    211680
     tgttatgttt tgttctcgct ttggttggca ggttacggcc aagttcggta agagtgagag    211740
     ttttacagtc aagtaaggcg tggcaagcca acgttaagct gttgagtcgt tttaagtgta    211800
     attcggggca gaattggtaa agagagtcgt gtaaaatatc gagttcgcac attttgttgt    211860
     ctgattattg atttttggcg aaaccatttg atcatatgac aagatgtgta tctaccttaa    211920
     cttaatgatt ttgataaaaa tcattagggg attcatcagt cctgagcgtc tttgcttgcc    211980
     ctgaggcaat tgtgcaggct caccagcacc ggcggtacca aaaatgtccc gggcaatttt    212040
     ataaagaagg taaaaaggta cgcccagcat cataaaaaag attactgaaa atattacacg    212100
     ttccattgat gatctcctgt cttgtgagag accagttata tcagggtgat tcagtatttc    212160
     cgtttagaaa agagtactaa tttggccctg ttcgctctta atttgccatc cgggaaaaag    212220
     tcatagggat aggcctgcca gagtcaataa cttccagtga tctggaggag accccggctc    212280
     tctgagccct catggatggt acggctttac cccttgtaaa cagattcacg ttccgcagga    212340
     caaacatcga ctactgacgt ctcatatttg ctgacgctaa tccgacgtct cattgccgtc    212400
     tgcttgtttt ctttaaaggg tgtattagac gaatatcaaa tcggaatggt aggggatgtg    212460
     tgggcaccat gcccggccct ctttgagcat ctgagagatt ggagacctag ccgggtaaga    212520
     tagctacttt cttacgggtt acccttcaaa tccaaagacg aaacggacgc tgccgttctc    212580
     cacgtggaga cgctttactt cttcgacaaa ttcctggatc acctctccgg cgttatcggg    212640
     tggtatggct gacaaaattt cttccgaagt cagccatgag tatgaatgtt caccgaataa    212700
     atcatcatct tcggacggta tatcatcagg taatccgcgt aatgcgtgga taaaaactgc    212760
     tgatgtgctc gccctttcac gatctacatc aaatccgagc caggcaaagt ggagatatga    212820
     tcggtcccct ttataattgc ttgataaatt aatccattta ccaggctttt cttccctttg    212880
     aaatcgccag cagatatcaa cgcccattaa gaaactccat tactatcgtt cgtatgagat    212940
     aactatcatt tcagaatact atgacttctt cccgtataga actaatcgct cacgccattt    213000
     agctacttac tttttttacg tacgcttgca gcgcagtacc ttgagagaag taagtaagac    213060
     tgggcgaagc caaccggttc cgccacctcg ctcaccggct tttaggcgta agcactgaag    213120
     tcagcctcca tgctaactgg cgagcctgcg aaagtcagac tcgttgttat aaagcggcat    213180
     atcgtaagca gtgtctgaaa tgaacattcg gatctgctca agcgtcatgc cacaatgaaa    213240
     acgggttacg ctcacattgg cccgggggaa gtcagcacaa aatgcattca aaacattctc    213300
     atggacaata ccaatgttga ttaacgcagc tggcccgttg tcacggaaag atacgacacg    213360
     gaatccccca taccagcctg actgggagaa aaatgaaaat gcactcgttg ccagaccatt    213420
     agacaggtca tagcgcaatt tcccgctcag agactggctg tctctgctgt acacgcgatt    213480
     aatgaaaatg ccgggaccaa cttctaccgg ctgcttgttg cttgctaaac acggaaagcc    213540
     caccagcgaa acctcccttt ctcctaacca gtttacctga tacccggcag tgagaaagtc    213600
     agtcagttct acgccagaaa gagcattaat ggccgcaata tcggtatcca aaatatttac    213660
     gtttttcata ttcatctcat ctatattcta aagtgcgttt tttgtctatc agcccgagga    213720
     ttgaaaattt gaatatttaa tgtgacagaa aaatacctgt caccttttca aaaactgcct    213780
     gcaattgaat atcgagagag tccattttaa aatccaccag ctcagcttta ttatcgcaaa    213840
     ccgaataaaa ataggagtca aatgcgtctg tatcttcatc tttaaaaata cggaaggaat    213900
     taattttatt atgcccttca aattcggcat gaataccata gcgaaccgag ccgtcatcga    213960
     actgaacaac ccgtcgtaca gaattaatcc ggacgtactg ttttaaggcc ctcgcgaaat    214020
     cggcatttaa cgccaacgct cgtaagattg aatcagcggt ttcattctgc tttttacgat    214080
     catattcaaa catcccacag ccggtgttac gaaagaccgg ctgaagagca ttaaccaggt    214140
     tgaaggaatc cacgtttctg tcgtttctgt acatgagata tctcctgccc ctccgctata    214200
     cgaaggggct tgatagggtt actgccaggc tgcgatcact tcttcgcact ggaaatgaga    214260
     taagcactgc tggagtaaaa gggccagcac cgctgtgtta gggacgcgat tgttacacca    214320
     cgcgttgaat agcagctgcc atggaccggc ataatacccg gccagtttct ttttttgttt    214380
     atctgtgcag cagctggaaa tggcctgctg ataaaggctt tcattctcgg caccagagcg    214440
     ttgttgcagt gcctgataaa tataggagta gacagaatcg gagcaattag atgcataggc    214500
     cagattggtt ttcataatac ctcctgtgtt tttgggtatt atataaaact ccgacctact    214560
     ggctaataac ccacactgta atttctttta aaaacacaat aaattttcaa aattggacca    214620
     gtgtggattt aagcgagcag tttaaatctt tatgaactag ctttcaaaga ggttggtttt    214680
     tcgggaagtt ttttgccaga ccagcatgtt ggtttttttt ctgtagtgca gattagctgg    214740
     tacctgcccc ttcttacctc tttgagcaat gactgtttga aatatggtaa gcccagttca    214800
     aaaacccagt aacgaccgtc tgcaaaaacg actgaatttt caacgccatc cgaagccacc    214860
     aaggatgcat cattaagtag acgttcttca taatgaaatg gtaatgaaaa tgtcagatat    214920
     aacgcacaaa gtacaaagat tcctgtgaga ctaactgcca gtgaaccaca ataaccagaa    214980
     taaacattta aatttctttt gataaatttc tcatgcaaga ttacaagcag acagaataca    215040
     caagctacca gcccaaatcc tacatgcaga taaaactgtc ttatttcatc attccagacg    215100
     atgttgtccc atttcgtgct taagattgaa cccaacaagg agataataaa agcggcaatt    215160
     tgagaactga taaagtagga gaaagctgac tttgaagtta tttttttcat agaaacagga    215220
     acctctttac ctcgttcctg atcagagaaa agacacaaaa cgcaccatgc gcaaaaaact    215280
     gcaagtccag atgcaataat ctcgcgtaaa aacatattaa acgtttccga taatgaataa    215340
     gtaattacca tatcctctcc gtaagtctac atataattca gacgtgacaa ataattaaag    215400
     gcattgctat tctatcatta tgcattgcgt ttaaaatcat ttctaattca gcagagtagc    215460
     gatacaggca tttcgctatc ctaaaatctg gtagctttcc atttccttgc tgagataaat    215520
     caaaataatt ctatttattg cctattcgga tgctgcaaaa ccttataaat ccggatgtat    215580
     atcacttaac agtgaaccat tcggtgactt gctctccgtg aggtccaccg ggtttatcca    215640
     gtagggaaca ttctgctttt accgtttact gcatacgcga gcaggaattc tgttgcagtt    215700
     ctgcatttgc ctgcttttcc agtgctgtca taacccggcg gagcatcgcc agagcctgaa    215760
     caggcgagct cccaaactgc actttcactt catccgtatc atgatcctga atcaggtcga    215820
     ggatgttcac ttcgatccct gccccgtttt catcttttgc cgtgcactga atacttaccc    215880
     gggtcaccga atccgtcagg actggcagtg ggttagtctt gtctacgttg ataaaagcct    215940
     tcttcattgc cctgtttccc cttgtcctga aaaagttacc gacccgtccg gatggagggg    216000
     tcggtcagaa aatcatgcct gacccttatt catcttctca gcatgcttac gcaggtactc    216060
     tttcaggtca gcatgagcat tgatgatatc gttcatttca tcattggtca gaacaagcgt    216120
     gtaagtatca gtgctgacag attcaccttc tttaagcttg gcttcttcag caatacgttc    216180
     aaaaatcggg atcgcggtgt cggcaatgac ggtcacggtc tttttgttca gaacgctgga    216240
     catggatggt gctttacctg ccgggttctg tttaggagcg ctgtcctttg gagccggagc    216300
     tggttcctgt accggtggcg taaccagcgt ctctgtattg ctttcatcat tcagttgatc    216360
     cggtaccggg gtgttaacgg tagcattacc tgccggttgc tcatcaccgg agttttccgg    216420
     agtctgcgga tctgccatgc gctcttctac cttggcagct ttgacgaatt tcagcgtgtt    216480
     tttcgtcgct ttaccataga tggagatcgc cttgttgatg ttatctaccg catcctcacc    216540
     gctgtacata tactcgtcca gcgcaacgta catgctcacc tgatcgctca caagcatggt    216600
     ctgtagttca gaaggcaggt ccagtacgcg aaccatctgg cgaagatgct gctctgattt    216660
     accacgtttt tttgccagtt ccgcaaaggt cttaggctct tctttatctt caacaagacg    216720
     cttaattgaa agcgcttcag ctacgacaga cagcgccagg ttggagttgc cggtcagggt    216780
     gaagagttct gcttttgaag cgctaccgcg aaactcttcg cagcgaatac gagtaatgcg    216840
     ttcacgccct tctgcttcca gctggcggtt tgcaatagcg atggaacgga tacggcaagc    216900
     cccctgacgc agtacaggta cgccattaac catctgaaca acgataggcg tcacgctgaa    216960
     cgggtcttcc atgtaggcat cggccaggct gttcaggtgt tccacaacgt gaggcattga    217020
     atagtagagc tcgcccatac cggccgtgcg ggtgttaaag ccttcctgct ctacaacaac    217080
     cgaagggtca atgataaggc cgttaccttt acgggcaccg ttaccagtgc gttccaggta    217140
     accacgaagg ctgatttcgt tgctgttgtt ttttacttca gtttcgattg cggacatttt    217200
     tgttctctct tttggttggt tgtttaactg cgctacaaca caacaatacc aggttcgaca    217260
     ttttttctaa taggttgcac agaagaaaaa gtaacttttc ttaaaaaaaa ttcctgagac    217320
     aatactactc gatccgtccg ttttaaatct tcacaacagt gggccgtttt tacgtttaag    217380
     caaaatagct ggttcagaag gtgagtcgga gagaaaagtt acttttccgg ttgtctgggc    217440
     cagtgatgag agagtggcag gacaggaatg gctaaaccgg tgcgggtctc ttgtaagtcg    217500
     caggggattg aggagatata gaggtaaacc ggtacgttca gtttttggat tgagccgggc    217560
     ttttggcccg ggcttaagga agcggaaatt tgaacgaact ggcaggtaat gatttatgcc    217620
     gccgacagct ggccgtcagt gctttgctgt tctggtttga cagttggggg ataaccggca    217680
     gttagccgct ggcattccgc atcacagaaa gccctgaggt tgctgaagac ggactccatg    217740
     aaatcagcat gagcatacga gtctacagga cgtgtcttgt tatctttcat cttgttctcc    217800
     tcaatcatta ttaaaaccag cggatttagt tcctggcgct ccatctgctg accggctttc    217860
     ccagagagca gcgatgtgtc gggttctgtt tctcatttta tcgttttcat cgggcccatc    217920
     cggccgtata agagaccgat ttggcatgtt taagaaacgt actggcgaca ttaaaagctg    217980
     aggttggctt tggaataaaa ggatactttt cccgtttgtc aggtctttcg ctaccgctgc    218040
     acgatgattc tgtcaggcat tctgcgccct ccttggctgt acatcttgaa acaagcggtg    218100
     ggatgttccc ttccccctgc tcaccgcaga ataattggca agtcccgacg gtcgttccgt    218160
     acgagccggg tccaaataat gaataaatac aacgccactt caattgtatt gacaatagaa    218220
     gttaggagga tcatagtgtc attcatggtg cggctttcgc accaccgccc cggcggtacc    218280
     gggcagaact ggagtacctc atgaaacttt cccgtcagac gacttctgat acttctgttg    218340
     atggccgttc acgcgcatat gcctggggcc gtgtccatta tttcattatc gaacatgcac    218400
     caatggctga gctggtcgct attgacgagc tgctggaaaa agctggctgg agcaatgacg    218460
     gctgtccgaa ctatgagaaa gatgacgagt ttggtaatgc tggttacagc tgtggttact    218520
     ggatcgatat tgacagcgtg ggaagcttca aggctgacta caaacgtctt aagggtgaga    218580
     ttagtgcgca tatcgcctca aaggcggcag aggtggagat ccgcgtactg gactcgatgt    218640
     ccgacaaaga atgtaaagat gttgcctcgg tggcatgtac tgttcgccgt gacttacgta    218700
     cgcagtccga atcgcttcat tcactgcgta ctatcgtaac ggttgatcat tacaatccct    218760
     atgtgatcac cagccgcccg ctgagcattt ccgcctggac acttatccac gactgtctga    218820
     aaaccggcac catcaatgac gtctgttcac ggttgagttc attaatcctg cactctgaag    218880
     ccgcgattgc ccgttgtaag ggaagctccg actactcttc ggaacacgct cagctatcgt    218940
     tttttgctgg taacgactat gtcaccagac gcacccttgt tgatgcagct cacgaagagg    219000
     ctctgcgaat gaaccgccgc tttgatgaac gtattgcaat gaacgcggat tctgatgcca    219060
     gaaggctcca gtgcgaattc aacctgagca accatgtcgt acagcgtcgg accgttgaat    219120
     ctgctcatat ccaggcaatc aacgaagacg tcacccgttc acaggcggaa ccacgctgcc    219180
     ctggaaagct tcttctgaaa atgaccagtc atgaggaagt gcgggactca ctgagcacct    219240
     gttagtccag cgacaccccc tgcggctcta ctaccgggcc gcagtctgct ccggccagat    219300
     ggtgccagtg gcgtaatgaa tttgtttaat aaggctgagt atgatgaata aagaacaact    219360
     aatcgacaaa ctggaacgcg tggtatgtgg tcagtactcc tacgaaatgc aggagcttgc    219420
     gtattcggcc ctctgctgca ttaaaggcac cccggacgac tgcgctaagt tccctgttac    219480
     gcgtccgctg cctgacacct tagtggacgt atgggacgag atcgggcaat accttggcac    219540
     aggcaaagcc attgaaactc gcagttgcgg cgtttcgctt ctgcttcatg gacactgcta    219600
     cgattcaaat catgtgctgt actggcgcaa tgctggcgca cttccagcag cttgcgatac    219660
     gccactggct ggtgggtctc gcaaactgtt cacctgctca gcctgtggag tggacggtct    219720
     ggatgaacca cctgaaacca gttgccactg ctgcacagag ggggcccact ggattgagag    219780
     caggctcttc acctccgggc aggcagaccc tgaagaattt agacccgtgg cggtcgtgaa    219840
     agagtgtgca ggctcaacgc cggatgatcg gctcatctgg agcgtgattg aacagctcaa    219900
     cggcgaactg gcggaaggcg ataaactatt taagcgacgc tgacagatca cgtcagcatt    219960
     tatatcagac gaactccaga ataatttaaa gcaaccatga acatgaaaaa gcccaaagct    220020
     gcattacaga atgccatgaa agaagatgtg ccagctgtga cacagattca gatgcgatct    220080
     acggtttcca gaaaggttcg ctatgtaaaa caggcaaatc gagagggtct gaaattatct    220140
     gagtggatgt cgcggcatct cgacgctgtc tgtgataccg cagatgagat tcataaaggc    220200
     aaacgctcaa ctccggttgc gcctgggaag attccccctg aggtatacca ggtgatatac    220260
     gatcagtgcg gcgggttcgt ggagtgtgat gctaatgccc aggtaatctg ggaagcctgc    220320
     cgtgatgcca ttcttaacgg agacaaaggg taaacggcag gtatcgcctg tcatttttac    220380
     ccttgtgagg aaaatcctga tgaaccatga gagccgaact gtatacctga acacggccat    220440
     tgaggccctg ttgaaagctg aggcggctct gaacgagctg gcattagcct atgtactcaa    220500
     accaggtgaa aaggcaagcg catgccatcc ccgaaccggt acgctttcca cagcttccca    220560
     ggtaagaaaa cttcgccgtg ttctagaaaa aaacaagtta tgacggccct tatacgctgg    220620
     cataatgtac cgtgcttcgc tcatcccagc agtatgggtt ttaaactctt ccatttttaa    220680
     gagtacggga agagccttat tattgtcgca taccctacgg atgcattgca gttcaaaccg    220740
     ctgttcggtg caattattgc tgtatccggc ggatttgaaa atgacagaaa tagtgatgta    220800
     aagctccgcc attaaagaaa tgccccgtag tttggcgaat caactttctg aattatctcg    220860
     atgaacacca tttaaggaaa tcgaatgtgt gatttttgca gggctgacga aaattacttt    220920
     catatggcag aatgcgtgta tgaccaactg gttaaagagt atcccgtaat gtggctgcgg    220980
     gattcaaccc ggatcggggc ctgctacctc tgtcgagaac tgctgtcgcc ggaggggatg    221040
     gtcctggcga tgcagagcgc tttccctgcg aagggatggc ggctgcgtat ttggtacaat    221100
     gaaaccattg acgaagagat agaaccgcag cgtggagact gtattgagct gtcctccagg    221160
     gcggacgctc tgctgtcctt catgtcgttc caggaaaagg tttagcgctg cggcccccct    221220
     cacaaaaagg cgctttccgc gacaaatctg gtacgaccgg acaacgttga gtcaattctt    221280
     gcttccccgc agaagaatcc ctatgaagta aagtagaggt aggcattacg cccaccagca    221340
     aacctgataa ctgttctttg cgtaacatcc tcaaacttct ggtgccttcg tagactgcga    221400
     tgcgaatgcc catgagctga attcaccgta tcatttgacc ggatgcagcg agaacagaaa    221460
     tgacaatgtt tgaacgattt gccagacggc cataaaactc tactgggtac agaataagga    221520
     ctgaccgcaa tggctacgtt ctatgagcta ccgaccagtg agaagtccat tgtttccggt    221580
     acgtgcccgg acgagcaccg gtgaaatttt tcccgactgg attacgctaa ggcttttgaa    221640
     cggtttgcgt gaagtgggac tctttgggtc tggttcttga tttatacaaa aggctatatg    221700
     ccacaagacg ggaggaaaaa agggtttccc cgactggaga aaccctttca aaaggtgccg    221760
     atggcatact aatccacacc ccgaaaagag ggggttgccc ccataagcgc taacttaagg    221820
     gttgtggtat tacgactgat atgatttaac gtgccgatga attactctca cgataactgg    221880
     tcagcaattc tggcccatat tggtaagccc gaagaactgg atacttcggc acgtaatgcc    221940
     ggggctctaa cccgccgccg cgaaattcgt gatgctgcaa ctctgctacg tctggggctg    222000
     gcttacggcc ccggggggat gtcattacgt gaagtcactg catgggctca gctccatgac    222060
     gttgcaacat tatctgacgt ggctctcctg aagcggctgc ggaatgccgc cgactggttt    222120
     ggcatacttg ccgcacaaac acttgctgta cgcgccgcag ttacgggttg tacaagcgga    222180
     aagagattgc gtcttgtcga tggaacagca atcagtgcgc ccgggggcgg cagcgctgaa    222240
     tggcgactac atatgggata tgatcctcat acctgtcagt tcactgattt tgagctaacc    222300
     gacagcagag acgctgaacg gctggaccga tttgcgcaaa cggcagacga gatacgcatt    222360
     gctgaccggg gattcggttc gcgtcccgaa tgtatccgct cacttgcttt tggagaagct    222420
     gattatatcg tccgggttca ctggcgagga ttgcgctggt taactgcaga aggaatgcgc    222480
     tttgacatga tgggttttct gcgcgggctg gattgcggta agaacggtga aaccactgta    222540
     atgataggca attcaggtaa taaaaaagcc ggagctccct ttccggcacg tctcattgcc    222600
     gtatcacttc ctcccgaaaa agcattaatc agtaaaaccc gactgctcag cgagaatcgt    222660
     cgaaaaggac gagtagttca ggcggaaacg ctggaagcag cgggccattt gctattgcta    222720
     acatcattac cggaagatga atattcagca gagcaagtgg ctgattgtta ccgtctgcga    222780
     tggcaaattg aactggcttt taagcggctc aaaagtttgc tgcacctgga tgctttgcgt    222840
     gcaaaggaac ctgaactcgc gaaagcgtgg atatttgcta atctactcgc cgcattttta    222900
     attgacgaca taatccagcc atcgctggat ttccccccca gaagtgccgg atccgaaaag    222960
     aagaactaac tcgttgtgga gaataacaaa aatggtcatc tggagcttac aggtggccat    223020
     tcgtgggaca gtatccctga cagcctacaa aacgcaattg aagaacgcga ggcatcgtct    223080
     taacgaggca ccgaggcgtc gcattcttca gatggttcaa cccttaagtt agcgcttatg    223140
     gggttgcccc cctctttgtc agctacttac cggattcgta ggccaggata gcagatacct    223200
     cccttgttcc gtctttcatc cgcaactcgc aaagcgagtt tcgtgtgagc caggtgaata    223260
     tcaacagcgt taaacaaact attaatatgc acaaaacaat gggttggttc ggcattttca    223320
     tggccttctt ctccttgcat ttaagcaggc aagaggctac tctgaatgtg actagcatac    223380
     aggggcctcg ggttgtactg accccaaaaa gttggacagt taaacacgag gcatataggt    223440
     ctgattccga tattcaattg gagtcagacc ttttaatttc aggctaattc ttctgctgtt    223500
     gtagtattca atatattccg taacagcatc cttcagttcg cttatattac tgaactcatc    223560
     aagataaaaa cactccgact ttaaggttcc aaagaaacac tccaccacag cattatccag    223620
     acaattgcct tttctggaca tgctttgttt aataccatgt tctttaagga tattttgata    223680
     tcttctcata cgatactgcc atccctggtc agagtgcaga acaggatgct cgtgaggatt    223740
     aagctttttg aatgcctgat cgagcatatt ctcaaccatg ttcatcactg gtctttccga    223800
     aaggctgtaa gaaataactt cgttgttgaa gagatctatt actggagaca aatacagctt    223860
     gcgcccattg actgcaaatt cagtaacatc ggtaacccac ttctcgtttg gccgcgtagc    223920
     cttgaaatct ctttggagaa cattaggggc ggtttgccct acctctcctc tgtaagagcg    223980
     gtatcgcttg accttaatcg ctgctttaag tgagagggtt cccatcaggc gctgaacagc    224040
     tttatggtta atctgtttcc cttctcgatg aagagacagc gttaccctac ggtatccgta    224100
     tcggcctcta ttctcgtgat aaatctcact aatacgcttt ttaacgtccg catacttgtc    224160
     aggcttgctg agagccttta gatgataata aaacgtactg cgcggtatct ccgcagccct    224220
     gagaagctca tcaagaggat aaaactgcct tagctcgttg agtactttca ctttttcgtg    224280
     ggatgagcta aggctttcag cttttttaga tacataagcc gcgtttcaag aaatcgaact    224340
     tgcctttcaa gatcctcaat gcgtcggtct tttgacagct ccaatgctga tgccgctttt    224400
     tctggatcaa ctgatattgc aatgtttctt ttggtgccaa tcttgagcgc gcgtaaacca    224460
     gcttctccgc gctcttcata gaccttcagc cacctggcta cagaaccact accagcaagc    224520
     ataaagtgag cagcagcctg attaagggac atgtgctgct cgatcacagc tttcacgacc    224580
     ttaatacgca actctggatc agcactaacg cctttaggtt tgggaattaa acctttttct    224640
     ccatgttttt catagagggc aacccatgtc ctgacctggg ttcgggggac accaaaacgt    224700
     gccgagatga tcctgtaacc atcatcagtt gtgaagtagt gattcacgac ttcaaggcgc    224760
     ttttcaaaag ggtattttgg ctttgacata ttaggggcta ttccatttca tcgtccaaca    224820
     aaatgggtgc agtacaggtt aattgaaaaa ttactcgggg ctttctgctt ttaccacagt    224880
     caaacagtgt taccgctggc tggggcaaaa gcctccagca ccagcgttat tataccaccc    224940
     tgccctgatc agccaaacac cccgcctaca taaattactg atttttcatt tatttgacat    225000
     gattcacttc cggttgtcgg cgaaagtcat tttatactaa agaaaagggt aacgggcagc    225060
     tgctgggtcg gaacatacag tgcagttcct gcccgtttaa tttccggatg caatggtagg    225120
     atcaggaggc actgcttccg ttgattaggg aaatcttatg tgcctgaata cggctgtatt    225180
     cgagatggga tgcaatatta cagatgcgct ccagtcgatc atgcagcctc gtgtaggtca    225240
     gtcgatgaat accggacatt tcatcaagta gccagcgctt gatgtaaggg ttacaggaaa    225300
     gccgggcaag atcgtcgtca tccacttcgt caaagaacca gtactgctcc atcgggacta    225360
     cctgaaatat ccacggccgg ggatagtccc ctgtgacaac caaaaaccat gcaagaaagc    225420
     atagacacag ctcaacgacc ataagcatcg aaaattgcga ataacttaga ccgggcacat    225480
     agggtgaact atccgcaaca taccccctga gcaattccgc cacaaggtag cccaatagcg    225540
     tcaaggccag catcagggtc aggattaatc ccccattaaa cgctaccgaa gccttttgaa    225600
     cccgatcagg tgctgtccgg ctgcgatagt tggtcactac tctttctaca agtgccctta    225660
     tggcagcctg ttctttactg acatcagctc cggaaaaacc ggacgggctt ttatttaatt    225720
     cagtcatacc ccactcctgt tatgtgctct acttaacaaa cacgtagatc atacagagct    225780
     cacggacgca ctcctgccag ataaaggagg gaatttggct gtaagacggt tagccaacag    225840
     ttcaggttat gcgtgggatc cgcccagtca gaaaggattc cgttaataac aggcaaggtt    225900
     aaaggcagat ggacggtgaa attgtgggtg ctaaaagggg gtattactct ttttcctgca    225960
     tagcggtttt ttcagcccgg gtggccagac gaacatttcc gaaaggctca cggacaagca    226020
     gtggcttctc cttcttccag cccctgatag ccgtttctcc aaaccgacgt ggtgcattgc    226080
     cgttccagcg agcaatcaca tggttatcat gaatttcaat aatgacaacg gggtggacaa    226140
     tgaccgttga aatggtggta tttcccattt tggtacgggt tacagaccaa acctgcatcc    226200
     cggattccag ctggctgatt ttcatattat atccttaagc catcacgaac tgcgccacaa    226260
     acaattaatg tggcgcaatt taccataaac aataaacatc agatacccgt gaaaagattt    226320
     ccctttattt taaaattctt ctggagaaaa aatgatattt ccagaagagg tcagcgaaat    226380
     tcagaaacgg ccatcacaat ggtgctgcgc tgacgctggc gttctgcctt gcgctgcctg    226440
     cggcgataga tctgttttgc gctgacgtaa gggcagtcct cacgggtata ccagcagcag    226500
     ccgcaaggtt cgggccgggg ttttccggca agtccaaatg gtttcatcaa gtcacctttt    226560
     taatgttttt aatggaaaga tacttaccta acccattgtt ttataggaaa taacgttgtt    226620
     gcataaacag atacagataa ccctcaggag aaaacatgca aaggttatca gtgataaccg    226680
     cgtccagata ccgagtgtca gtctgtaaac gttttatcac cagaaaatgt gctgccgcag    226740
     ccttaatgcc agaactaccg tttacaacat tatgtatacc cgctttgaat aacgaacgag    226800
     catgaattac cttttcccgg gccgcttcga tctcagcatt aataacgcat tgccgcgcct    226860
     ggatgactgc ctctccggtt aaatcgcgga aattcattag agatgtgatc atgattgact    226920
     ctccagatta tgtggaatca ttataacaac tggcaccacg ccacaaataa cctgagataa    226980
     attctttgaa atattcctat atataaggaa ttacagtcgg aaaagaaaca atgaaatagc    227040
     gccgaccgct taaaatcgat aaattaaaat ggacggcact ggaatgaaaa actgaaagta    227100
     gtaagaccgt aattatcctt cacggatgta agctttaaaa gaggagtact ggcaaagctt    227160
     tgccaagtac ttcggcggtt gtgtctacga ttttacggat gtcatcgatc tgcgaaggct    227220
     tattcaacac caccgtaaaa agctctcctt cgttatcagc ctgctcgcag tttccgtatc    227280
     ggctcccgtc gtacagctgc acaatacgtg acatagaaga ctttgtttgt ttcatggctt    227340
     tgcacctgct tttaggcagt ttggttactg gttatcagaa gctggtttca tgcgcttccg    227400
     gctgggacac gaactggtat ttgacgccgc caggcacacc tactgcttcg gcaatagagt    227460
     cgcaaagccg cgataaatca tttagtgtca tcggatattc aatatctact gaatataaag    227520
     cacctgcatt ttcagcatct tcgatgtttt tatactgggc actaaatata gcaatggtct    227580
     gaatttcgtg gttatgcatg aaccggtcct tattaaatta taaaagccac ccgagagtgg    227640
     cctgagtgga aacttaaatc tgtgaagtat atttgagaga ttttttgcga tccagatgcc    227700
     gggcaacaat ggttccgata acaagtagcg tgatgaccgc actgaagaag gtgctgtcag    227760
     ggacgccctg gaaaaaatca ctgaaactgt aaacaataaa aatcaatgcg caaaaataga    227820
     aaacgatacg aacataaggg gtaaaaaaca ttttcatcgg ttgccttcca ttcagggaga    227880
     attctcagta attacatcac acctgaagag aaactatttt cgtataaatg agcattttcg    227940
     acatatcaga ggggggtttt actcataaat gaggtagtaa gggtcacact tgagatgaaa    228000
     gttactttcc tggctgcgaa cgaactatct caaatgttag aggtgtgcgt tcgccttaag    228060
     agcttcatgc cctgaggagc tcaacttgag ccgatagtat aaacctggct ccagatgcct    228120
     tactggctgg cataactcca cgaggcccag ccggaacagg accggagagc tcctgcacgt    228180
     cacatcatca ggattcccca taaacgtacg ccgttctctg gcccgtctga aattgccaga    228240
     gatatcatag atcgtgccgg atgccatccg tcttaacacg taaatctgcg cccttgtaag    228300
     cttctgggcg gaactgctta aacctgacat accttcccgg ccttatataa aacaatccgc    228360
     cagcagctcg actggcggac aatgtttgac tggaaacagc aaggacatac tatttgctga    228420
     caagtttgat attggtttca ctcattcgaa gtcgaaactc ctgaaaaccc tgctctaccg    228480
     ctaactccag ccactcaacg ggaatggtat agctacaatc agacccaccc aaagcggcat    228540
     cacaagcgta atcccagtcc tcatccagtt ttggattcat cccctgggcg taagccacag    228600
     tatcgcggga tgcgggagag ccctcaagct cagcattagt gatcaggtat acaccatgac    228660
     tgtgcgcgag aagcactttt ggcaccagat gtgtgctggc aatttttgag gatgagggaa    228720
     agaaaaccct accagcttta cgcgcctctt cttcagtctg tccctcagcg ttaaggaggg    228780
     ctccccccgg atagcatgcc gggtcataga tctgatctgg ggtgaccgaa aacgtttttg    228840
     cggtgcgaat ttcttcgatc agtttattga tatctgccat ttcaaatacg agagtggtca    228900
     caggcttact ctccctcttc agtggacaac atcagatact ttgttgccag cagaagctct    228960
     cccacatcct tgagggacaa ttcagctttg ccttctacgg caagctgcaa gcgctgtcga    229020
     attgcatgaa cagaatctga agataaagat gccattttgc gcaaaacggc attagccttt    229080
     tctacagcag gatacagaat ttctgagttg gtattatctt cgtcattatc aaagataatt    229140
     tcagaatcca tattgatgtt atcttcaagc cagcttgaaa gcacttcaag taatgacatc    229200
     accttttcaa tttgcatatc gcctcctctg ttaacatgaa acaaatataa caaagtggct    229260
     tacccggcta ataacctgag cagaaagttt tcgaacttag tttgaaaaca agttttctgc    229320
     tcaggttaat gttaaagtcg ctgggtaaaa gataaaaggc actgaagatg atttaagcat    229380
     caaacagact aaataggatt ccgtctttta taacgctttt aaaatagaat gaatgaaata    229440
     taaattttgc gtttaagaat gaacgctgta gaggatgatt tatccagtga tatgcagttt    229500
     gtggccttta aaaaggcttt attatggact tgaattgcaa agagagcacc gacatttttc    229560
     tgggggctcc cgcagagaaa aagctgtgag gttatgaaga cgtataggag gtattcggcg    229620
     aaatactgta tggccacagg agagcttcag cacccatatc ctgccgcctc gctcgcctgt    229680
     ggtgatttca atatgttcta cgtcatacca cgtagttgta tttctcactt tgtttatgct    229740
     tcctgacacc gcgtgaacgc aatcttcgtc tggatgcgtt catagatgga aaactgcctt    229800
     tcaatggaat cggcattaga cagtaattca tgaagctcag cagaatctgt atcaggaacg    229860
     atagcgacag aaactccata tttacgccca gttctgatca ggtgcgcaag tttttccttc    229920
     tctgattctg tgagcattgc cagatccctt ccggatacct gctcgataaa tggaccaagg    229980
     tttttcggaa aaaagggttc ggcatcagaa ttatgtaccg ggagcgtttg cggcttatcg    230040
     aagctattgg acatgaaaag aacctttata gttagagagg tggagactga atgcgtagcc    230100
     cattaaaatt agtagtgcca cactcgaatg ctaatcatac tttatgatgg ctatggtagg    230160
     aatggccgtc aacttaaacc gccagaagcg agccattcac cgttaaagta actttcccgt    230220
     atgatgttct ttttatggaa tgagttgttc acactcctct ttaagagccg ccctggaacg    230280
     agatcgacag actttgctta atgaagagcg taattgatgt tcatcaaccc catcagcgac    230340
     aaactgacca attttctttt caagacgctg cattgcctca taaagcttgg catcagtatt    230400
     atttttaaga aacctcagta tataatcagc aataatttga acaggagtaa agttacacat    230460
     catgtatcct taataagttg tgtaaaaata aaaccataaa aaacataatc agaagtagat    230520
     tattatactt gagtaagctt ttcagctaac aagctggaga agcagattcc ggtaaattac    230580
     tacatatttg ataaaagtta ctgaataaaa aagcccagcg taccgggctt tcattcaatt    230640
     tgattctaag aatctgactc gccgcctgat ttttatacca agaagagcga acaaaacgcc    230700
     aacgaatgcg acgggactac ctactttaag acaattaacc gacgcttttg aaaaggtatg    230760
     tgatttagac atacgttttt gctcataacg aatcgcaagt ggtgagacgg atttatctaa    230820
     agctgtcttt tccaatgcat aacgaacttt cacgggaata tttgactgta atacaccaga    230880
     catatacgcc ctaacaacat tctgtgttaa cttcacatct ggcttgccga gttttatatg    230940
     tagttgcgcc tttaaatagt ttacagatac ctcttcgcct gagggccaat tactatcatt    231000
     taaatatgcg acaagtttat cgtatttttc atgttttaca tatttcttga taacctttac    231060
     agtcgaagct gaagtggcat cagtctcttc cgaacctaaa gcagatgtaa aaactgacaa    231120
     gccgataaga aaagcgccag caattagaag catcgggaat atctcaccta tttcctcccc    231180
     ctttaaaatt ttaaaggcag ttgaagaaac tactaatagc cccataatcc ctaatagcaa    231240
     cttagaatat gtagttagga agcctccaaa tgcatcgcca aaatccgaaa ccactaactt    231300
     atcttcacct tcagatgaat tgaagaatga caagggcaca tcaatatcaa agtccagaac    231360
     tgaaggtgag aggtgtaatg acagcaacca caagcaaaga ccaaaaatca ttatcagcag    231420
     gcccgcacca aatatcgcga aacctgaatt tctaatcttt atagaccggt gaaaaagaaa    231480
     tgacagttca cgggaaaaat cgtcactact cttaaggtta cgcaccatga tctacccctt    231540
     tttgtgtcag tcgggtgcgc aaattctcac gcatggcaag aacctgtttt tctgtttccc    231600
     tgagcttaat agccccttct ctctggattt taacaacatc gccaaccgtc tggataagcg    231660
     tatcctgcac ctctttaagg gtgcttatat caataaccag ccgttggttt gctttcatag    231720
     tttctactgc attgcgatgc agtaattttg cattactacg gagtaactca ttgttggcat    231780
     tatcgatatc attggcaaga tttacagcgt tacgctgtcc atttagagaa atggctaaca    231840
     gaaactgacg cttgaaatta gggacagtaa cctctttgac gctatgaaac ttgtcgataa    231900
     gactttggtt atttgcctgt ataatccgta ccattggcaa tacttgcata gcagactgct    231960
     gagaaacaac taaatcgcca atacgttttt ctaaattagc aattagcgta tccagatcag    232020
     atacttcctg gaacttagca ggattgttac caacattagc tctgagattt tctgctttta    232080
     attgtaattc tcccagcctt aatttaccgg cagcaatatg tacacctgtt aagtggtgtt    232140
     ctttaacgac ttcatcaaac atttgctgga gcgaaatatt attagaaccg aggctattct    232200
     gtgtaactga aacctctgaa accagagcat cgatttgttc acgagttgat tcaaactgtg    232260
     cggcgaaatt cttcccacgg gtgcggattt tatccaacaa agggccaata actggcagat    232320
     ttgaacgact ttcagttaag ttcgagatgt ttacatttct tgcaaggttg ataatttcag    232380
     ttaatttgct cccggcttcg tctaaatctt tattgcgaat ttgctcaagc aggctatccg    232440
     cataattagc agtgttttcc cccattgccc ggccaaaacg ataaactgtt cctggatcat    232500
     cggcattaat gcattccgcg acggctttaa tctcttgttc atcttgctca ttcagcccga    232560
     acttttccag ttcagcggaa gtcaaagtaa aagcaacaac ctcagttttg gtggtcaaat    232620
     tattaatcat ttttggaatc cctctaaatt ttgtcgcagg ctttttagaa gagcctcgtg    232680
     ggcctgatta gcttttctaa caatcgtagg gtcagtgtta tttactgata acagcgaaag    232740
     tgtgtgttgc cgccatactg gaaccaggac ttttatagtt tcgttaaagc ggtcagcaat    232800
     atctatacaa gtcccgcgag tgatttccat ctgcatggcg gccatttcat gagacgcaag    232860
     cagtgttgcc aggttagcta aacgtctggc aaatctttcc ctcggtttat cgaagacaag    232920
     gcttagatcg tcactatttt tttcttcggt agaatcccta aggaactcat ggcctgcctg    232980
     gataaaaatt ttaaggcgtt tgatttctga cacatatgtt tcaagcagct cttctaaagc    233040
     cagtagcgtc tcattcacat gtgtcagata tccgttcccc tcattaataa gattttccac    233100
     cttctcacgt gcgtgttggt aacgaacgcg cttttcaagg tgtttgcccg taaagcggga    233160
     aaaccaggat ggattgctac tgatagaacg tggatctgcc tccgctaagg cacttacgat    233220
     acggttcaag gctcctgata aagcggtaac tgcgtctttc tccagaagat ttgaatactt    233280
     atccatagcc ttcgaagata aagccgagtc gccgtaatgg cttattgccc cagcattaag    233340
     cagaagaccg ggtataaatt cttctttgag ttctgctatc gatatgttgc tgctgtcagt    233400
     tgaaacgttc atttttgcct caaaatggtt atccatgaca gcctatcatt taccgttctg    233460
     ctgatttttc ggttaaagcg ccaaaacctg ggtttatccg ttttcgaggc aaaaaaatag    233520
     aatctgatcc tcacgtaacc ctttgccatt ctgattaaag gagaagtccc ctactgtctg    233580
     tgcactgaat tcagcactgg atgaagttag gacatgaagt gcacatagat cccctgcttg    233640
     acctaccaat caccgccttc aatgtttaga tctggtgacc ttacagcgac catttctcta    233700
     accggatggt cattgttgtc gtggctgctc cccaacagca ggcttaccgt tccgctggca    233760
     gagtaataca tcgcgtcagg aaagtgctcc ctgacctcct aaagcaattt gttcatgctg    233820
     ttagttaaac gataaaagcg tcgggctgcg ttcggcatag cttcttccag gaggtcagaa    233880
     gcatcaatct cacggccgtt tataacgcgg agaatatctt gctcatccat aggttactcc    233940
     caggcaataa atcaaagtgg ccaggcaaaa ggagactcgc ctggcatcaa aaagaataaa    234000
     aggtcgttac gaactgataa tgatggcctg gtcagtttga ggaagtcggt ttcctctgat    234060
     gaatgctgga tggcttaaac gagcagatga catggtcatc gccagaaatg tctcttcacg    234120
     cgaacgcagc aattcccccc atgaataggt ttcccatacg tcgtgggaaa gatcggattc    234180
     ctttatgtac cttgactgca ttgttggttc aaaatcgacg ggagctagac tgtcatagga    234240
     tggatgtaca cggtacccca attcttcctc cctctgatgg tatgcatgtg ccaaaaggac    234300
     atcatgggag accaagtcat agtctttgtc ctgaacgagc gtttttacgg tatgactaat    234360
     ttttccaaag ccttcaattt cccagattgt tatcattgtg aactcagtta aagtccgtgg    234420
     gctttttacc agaaagccat ttaatgcacg tcgccccttc aacatgacaa cgtggtagga    234480
     cttgttggga taaggtttca ttgccaccag cgaatcagct ttaagctcaa gtgacaattc    234540
     aggtacagaa actgacacga gagtacactt gtttttcata tggtgaagaa tacggggcac    234600
     aagatgcaga tacatcattt tctcctttga aggatatacc aggcagctcc tcagcagcat    234660
     caaaatattt aaatcactct ttaattagta aaccactgct gattaacttc ttttatgttt    234720
     cacagaaatt attcgttttg tttctgttcg ttatactgct caaaccagaa gacgaccggt    234780
     ttttctacaa tatgaagcaa cccaaaacgt tctgcggtac ggaaattcac gctatatgcg    234840
     cgagcccgtt caacctgttt ggtaatttct tttctcattc cttcaacact aaaagctcct    234900
     ttaaaaaggt tgcagggggc gcatgatgga aataagtttt ctatagcatg cagttcaggg    234960
     tgcataacct tacccgtact tcgggcaaca tgagttacgc cgctgccgac aggggctctc    235020
     accagttcaa agtcgcgtcg aacaggctca acatgatcgg catgccaccc tttttcagga    235080
     agcttgcaac cacaataggc acaacgcccc ccaaatttca ttcgcagctc agctcgctgt    235140
     attttagaga tcttattttt aggttttgag aacctaccat caggtgattc agctttggat    235200
     aactttgctg agggctcagg taattcaact aaattcccgt tgatatttat caccttgacc    235260
     atatcatttt ccgcctttac taagctcacg ggcacaggaa ctggcttaag taaccgctaa    235320
     agataacagc cactgactgc atctacccag accttctgtt tatactcaat aggccacccc    235380
     tctttatctg cccggatgac gcaatcattt accgtggtgc gtgaccggat acgaacatca    235440
     agcggaagcg aatcgttatc cacacgagcc tgtgcctcat ttaaaatgcg taaaaacatc    235500
     tctttggtca ttcagatacc ccctcaactt tgcgaatttt gatcagatga gggcgactca    235560
     gtttacaaag ttgttctgtc gcttcatcaa tcgaattgaa ccgatgagcc tcttcgatat    235620
     ttaaagtcca gtatttcgct ttcccttctc ccagatcgga ctcaaaataa tttcgcttta    235680
     catccatttt tttaggcctg ccatttatct tgacgacatt atgtctgtca tcaaaaagaa    235740
     attcgtcccc ctcaaaagtg attaatacaa atggcccctc aggcttggaa gtccgggaac    235800
     tttccatttt caaagtcata cttcagcctc tcgatagaac tcatgaaacg tcaaattaaa    235860
     atggactcac accacactga ttcagtattc ctcctgaacc ccattaggct ctgttgtgat    235920
     ttcatattta attccgccag gtgctcccac agcgtccgcg accgactcac acagcagcga    235980
     gagatcgttg agggtcattg ggtgttcaat gtccagcgtg aagagtttcc cggcttgctt    236040
     ggcggctgtc ttgtcagcat gttcggcatt aaaaaggtat acggtgtgtt tttcctgagc    236100
     gggtgtattt tgattttgca ttgatgatcc ttttgtttag ttccccgatt ccgggggtga    236160
     gtgaattaat ttaaatttat attcgtctgg tttaattaga acgtttccac gctatgcgta    236220
     aacaggtaat gcaagggctg tatcaacagg attaaagtta cttttctgga tgcagcaacg    236280
     cttggacatg atgtccacat tacatcacga tcaaagctaa gttttttttg tataacccct    236340
     ccattttcgt gtgtttcgcg tttcagacgc ttatacgacc tgcttgacca tcctcatcag    236400
     aaggcggttt aacagtcctt tcgctgtcgg gcgattgcta tcgacatagt aaaaacctgt    236460
     tttggtcgta ccgtgagcac tgctcagcac cctcagttcc cagataacgt cacggataac    236520
     gccgccattt tctggcttaa ggcattcaga taaatggcgc atgaaacgag ctcttacggc    236580
     acggtaatag cggaactcct ctggctggtt agtattttct ttcacccgga gtcgctggtt    236640
     acacagagtt agaactgcat ccatcattcc cgccttcagc ttcgcctgga tcgcaccttg    236700
     ttgctgttcc ctctcacctt cgagtaacgt taaaattctt tctccgagtg ccgtcttgtt    236760
     gtgtacgtgc aactgaacac aggcagctac gcatgcccag aatctgaact tttttatctg    236820
     tccacgcaat ttccgggcta caacctgacg gtatgcagaa tcactgagta ttttaaaacg    236880
     ccgactggca accagctctg gaagcgacac tctgtcgcct atccccaggc gggaaaaggt    236940
     ttgtccccgt tgtgcgagac gatgatagac agcgcccttg ccttttgaaa ttcggaccgc    237000
     gccataacga agaagatact gagcagcagt cgttggagta aactcaccgt cagcgatgcg    237060
     ctggcgtaac ccgtcgtatt catgccagat aatccaggac gccgtatctt cttcaacagt    237120
     cagctcatcc tcttcctcga atgccacgac gacagaactg ctctctccgg tctttaggct    237180
     acgtgaagcc ctggggtcag cctgcccgtc aaaataggtc atcagcggca acgtatcagt    237240
     cagtccatca taagctgtac cgaaccggcc tccgggcagt ttcatccaga gtggagctgg    237300
     cattggtgta cggggcacag gctgcatgtc aggctcatcc tcaagaaggt ccagatcggc    237360
     ctcttcccag accctgcgat agatctcaat tgcccgaaac gggcgagggt tgaaacagtg    237420
     caacgaccag aggaaatcaa cgtggatcac gtttgcttcc tgtacaagcc gaaattgtgg    237480
     ctcagccata cgacggttat aagccgtatc gtcaacctcg ccggaaagta gctttctgcg    237540
     atgctctgcc gcacgtcttg cttcaacata atcaaggctg caacaggcat gaaaaagacg    237600
     ttcagtcagg gacgaagaaa agatattggg ttgaagacgc acatatccgc cttcgaacac    237660
     tttacgaccg atataatccc gcaggctcca gtcgtactgg atcttagaaa gaaatcgctg    237720
     aagacgactc aggccagcct gataaccgta tttctccggg tcagttcgaa ggagcgtttc    237780
     cattgaatgg tcaaccccta ctgctgtgca aagcgagcac ccatatcgag ccccacaagc    237840
     tgatgttcga gtgggtttct ccggcgacca gatacactcc ccggtggcgt ctttataaag    237900
     cgttgccagg ctgaagttat ccggcataaa gcttggtaaa gggaagcgtg attcggaacc    237960
     acaggccatc agaaaagacc agatgtcctg agtgcgccac tcctttaccg gatagagttc    238020
     accaccgtgc tcagtcaggg ttactttcct cgcctgccct cccattttga ggatatttcc    238080
     ggcccttcgg gcactttcat catccctgga gcccagcatc aggcataccc tgcttcgaac    238140
     ggatgccggg gcgtttttca ggtaacgagc tttggcctgg cgcaggggcg cgattttgta    238200
     gtcggttgag cactgtcggg tagaagaatt agtccaggtc ggaagtccgc gcccagtcag    238260
     aatgcggccg acccagctct gcgtaagaga cggtcgggcg acaaggactg tgaccggtag    238320
     ctggtgttca gcaatgaaca ttctgagctg gttgagaacc tgtgaagcct gatagtgcat    238380
     ctcagggttt tcgatcagcg tatcggacat ctgaatgaaa tgatgttcgc tgatatttgt    238440
     gccgttacgt actgccctga tcaatgccat cagaaacagg tgcagaagag aatgggagtc    238500
     tttgccgcca ctgtatccca cgcacattgt ccagccgtcc gtaatagcct gataaatagc    238560
     agatgtggct gacatgacca gagaagaaag actcacagtc tccttttcat cggtatagtt    238620
     cagatcggca tcggttgtca gggtctccca aacatccgcc catttatcat gtttcaaaat    238680
     ggcagcatta gccgcctcag gaaaaataac ttctgaggat aattcaagga atgagtcgct    238740
     tttttcaata aacatatatt ttcctgaacc acggtatatg ctgcatcact gatattatta    238800
     gaactttaaa ataactacag cgcaaccatt tagcgaaatt atattaaatc aaaatcacgc    238860
     ggatttaatg tcaatatata taaaaataat ccattgtaat ttaatcaccc ggcacagcta    238920
     ttagttatag gttggcggcg taataaatgc cgtattattt gttttcaact cagacagcgg    238980
     aataaaagga gtgttaagag tcatgtcatc accacaatgg cgtggtagag ctgaaagctg    239040
     aaatgaatct ttcatcaccc taataaccgg gcattccgta cgtgctgatg gcattacttc    239100
     ccgcagcatc gcttcctgct ttatgctgtc gctatgctta tattcatcca tgtcttttat    239160
     ttcttgaatt tcatcttcac cacaaaatga ccagttagcg tcatagaagt aaaactcagt    239220
     taaatgaaga tcgttttctt tcacgtatgc cgccaatttg cggatacgct gttcaagcat    239280
     tgtatctatc cgtaaggaaa cactctgcgg aacgtcactt gcaaattcat tgatacaatc    239340
     aacggtagaa actatgaatt tattggtcat ggcaggctcc aggccaccgg ggaaaccggt    239400
     ggctacggta attggcaggc ttaagcgccg caaagggtgt caagggaagg gagaagcttg    239460
     ctcagcttgt cgtaatcgag cggagacagt tctgtaacga gttcgaccga aagactagtg    239520
     ttgtcttctt cacacagaat atagattccg tcttctggct cttttccggc acatgccttc    239580
     agtcgtttgt taacgacctc ctgggctgaa tccgctacgt cgcagctcag gacatagctt    239640
     gccacatagc tgctctcacc gtggtaatgc gtcactttac acagagcata ctggataccg    239700
     gctttgtgag cctcattcat gagacgagaa aactgacagc catcctggta atagtgggta    239760
     tcctttgtga ccagaatagt cataccccca aattcatctg tccggctttt actgcatgta    239820
     aatgcagcag taattgttac catttccgag aggtcgaata ccgacagcac ggcagttgtg    239880
     aggcaaattg catggtcaag atcaatggtc tctccatgaa aaactgccag cccactgctg    239940
     gtaacttctg ttgcgaacaa cagttcataa ttgcagtctg ggcaggatgg ttgcccaaag    240000
     ctcggctcag aagggtcata ctcagggtgg ttctcgataa tactgaggat cagcttctca    240060
     gtcagagaac aatctgtcag tggcttatca agcaaacgct caccttctgc aatttctgct    240120
     tcggtaacga atgtgattgc ttcttgtgcc atttttgcct gctcctgagt gcagggaata    240180
     ataaacgacg cctgagtata attatctgcc acagttgact ccttgattat ttaattaatg    240240
     tatttgatga gaagatcata acaaatacac taataccaac taataacctg aaggcgtttt    240300
     tttagaaaaa atattaagaa gaagaatatg aacactacct catcttaaat taatatcatt    240360
     caggattaat attcattttt gcaaataaaa accgccagac ggcggctttt ataaagaggg    240420
     aaatatcatt ggaagttgaa attacttcac ggcaggccga caaattacgc gactgctgtg    240480
     agctgaagcg aaacttgtag aggaaactat aatcaccttt tctaagtcgt cggcactgtc    240540
     agcaatatga tgccggaaag cctcctctgc atcaccaggg gagtcggctt cgaccaggta    240600
     ggcctgatca tcatcatcaa acataatgcg cccggaaatg agataaagtc ggctcaaatc    240660
     tggcgttgct gcgctcgtgc ttcgttcgtt cagattcatt ttttctccgt ctgttgctcg    240720
     taaaaagaat gacgccggtt taaaaggcgt cgccagggtt cgggctaaaa cgcagggttg    240780
     ccatcgagga agctcattgg ctggccaata gcggatgcca ccctgagaat ttcacctggt    240840
     gtggcataac gcagcatttc agagcgtcca aatttctgat actcatctac tgacatcttt    240900
     ctccactctg ggtgaggatc ttttccgcac agtgaccagt tgctttcaga ggaatcacga    240960
     cggagaacgt acacatcaag cgaggctgta agcccacttc catatccccg ctgcgctaca    241020
     acacgaacct gagaaccatc gtcgcgttgc aacgtctggg ttaatttcgt gataggatcc    241080
     tgagaatgca tgccatttac ctcgttttca aaagatttac cgtaagtaaa tgataccgaa    241140
     tcgagaattc tggctaatag gtcagaagaa aaaataatga atatttttga agtgtaggat    241200
     aatgattaga ataaaatggc ctgaataaat cgctagcggt taaatccgct tatttcagag    241260
     aagctctgat ttagtagtta gggaaaacga tgcggtgaaa agtaactttt acaccgcaat    241320
     tcagaaaaaa gtttcaatta gtcacattac gaataacccg gcttactttc gcatgtgcgt    241380
     tcccctggat gttaaagtaa agcccctcag gcagactcgt cgcccactta actcctcgct    241440
     cagccatacg cttcggtgtt tccagccaac cacgaggaat attgcccgta acgtcaccga    241500
     taacccgtga aatgcatgct gctacccgga tgccgccggg aatatcgcat tcggattcaa    241560
     caatatgcat aacctcaaat aaagcaccat gccgctggac atgatcgcca atgtgcaact    241620
     cgataggaga aaccatttct gtatctgact tcatatctgt ccacctttaa tttagaaacc    241680
     gtctaaatta ccaatatagt taatgtaccg gatgttaatt caacaagttc tgtatcacaa    241740
     ccatcagttt tttttgttgg gtctatatcg gagaaacaag tgaatattga atacactcgt    241800
     taatacagac aaccggaaat gaatggcacc ctaattatct ctgcggcgta tgctaagccg    241860
     ttaatattgt cattttatgg tagaaacaat gcaaaatgaa taaaccgctt gtcgcttcaa    241920
     accactttat caaaaccgtt aacttgcatt aagcccgata cagttcggcg agctcgtcca    241980
     gcatggggtt actcttatat cccggtgcgg ccgtaaaaag gtttcgggaa atcgccagcc    242040
     attccatgat tttgtccgtc gccagccaac gtctgccaag tcgctcggct gcgatgggaa    242100
     ctttatgcag gccagcgaag ggatctacaa caacatctcc cggctctgtc aaaaactcaa    242160
     tcagaaacgc tgcaagcctg gtaggagacg ttgcaccatg cagcggaaaa cctagctcgc    242220
     gggcaatgga atggcaaaat ctcgtatcag cgcagctatt gccgtaaaac aaagtatttt    242280
     tggggatcgt tccttctgtt ttatttccaa aggatccgct tttaagctgg tacgccccat    242340
     caccataaaa ggtcgtgcga ttttcaccgc ctgctgcctg caatttaaga tgctgctctg    242400
     aatgcggttg cagtacacgt aagttgtttg aacgaacctt actcgcatca ttggtaaacc    242460
     acagcacagg ctcatacgat gagcagagct gcactcgttg cttacatgcc cagtgcgttg    242520
     gcgatggggg cttactgcga ttcacccact gaagcctgtc catgagctca agccccagct    242580
     tgtcacataa tgccagtgtc agacgctcca gatacagaga acgtgaaggc ctgcccctat    242640
     taaagctatc ttgagtgata ttcaatgcca cacttgcgcc gggtacaagc tgtttcacga    242700
     tcggttcgag gatacgcaga agccagtcaa tataaacctg ctcgccacgc cccccgccat    242760
     gcccgtagtc tcttgaattt cgaaggaggt aaggcggcga ggtcaggcaa agatgaattt    242820
     gctctgtgat attgctgaag aaggcatagg cgtttccaaa aaccgatgcc ccaagagaag    242880
     ttgagaaacc gacaacacag agcttttccc atgactcgtg taggtttgtt ttcgtcttag    242940
     aggagtatct ccagacgccc cgtttttctg gaacgcgttc gatgactccg gcctgccgaa    243000
     gagtctgctg aaaccagcgt actttgtgtt tgacgccgct ggttctggtt ttatctgacc    243060
     caaattcttt cagttcgtgc aattcggcat ccgacatgcc agtttcacgc tgcacttcgc    243120
     gataaagctc gtcgttgctc aacggcaatt cggaggctgc gtagatccgt gcaattaaat    243180
     ccgtagaaat cgtgctcatc agccatcctt aatggagatg cagtttaaat atcggcctga    243240
     tggttggaag ggggattact aaatcaaacc gatctgttta tttataggct ttgtcaggtc    243300
     atgcagcaca gctgggcatg cgcaaagaga cccagtcttc tttagcggag acaccttcaa    243360
     aagttgtact caatcagccc caagattttg aaactcaatg tgcttttgct cacactcctc    243420
     cctgccccac gagccctgcc attcacagat gtcccggtac ttaatttcca gcttatccat    243480
     ctgtgagagg ttagctgttg cgaagtctgg ccatatgtcg tgccagcatg cgttgtacgt    243540
     gacgcctgct ggtgggcaat acatcattgc atcagcatgg ataatttcaa cgcgaggatc    243600
     gtttgcaaac gaggccgcaa cgaggttaat aacgtcctgt tctttttcaa ttactgttac    243660
     atgggttaca tcttcttttt gaagaatggc gtgaagcacc atccccagac caagaccatt    243720
     aatgagcacg cgcccggtgg ctcgctctaa aaaatcctgg caggttctga tctccatcgg    243780
     ggtattggac atcaccacat cccagccgtt ggacaaacgc cgatatctac cgggcgggat    243840
     aaactcgtct gtattacctg tatactcggc acgaagggcg aggctcatcg ccttatctgc    243900
     ggtaatttcg aatgtgtcca gtttccaggt tccggacgtg ccgtctttaa cgggtaaatc    243960
     agaaaagcag ctcttcatca aggcaaccaa aattccagta atgttgttac gctgaaccta    244020
     tcacaaacct gctcttaata cagttatcag gagtgacagc gatctttgag gaatcgttta    244080
     aatcacgggc atcctgtagc ggacgcccga tatttaatca aatgtcgcag gtgttaaagg    244140
     aagcgttgca aagttgcaac gtcttctgga gcaacctcca cgcagctcct gacactgtag    244200
     tgattttcgc cgttgtagtc gtaaacccca ccgtcttcaa aactcagctg ttcaagctcg    244260
     ccatggcact ctgaaatgag tgccgtctgg caagcatttt tctcacaatc gctgacgagt    244320
     aaccgaacat agctattctc atggtcgccg tttcggttct ggattttaac gataaagtgt    244380
     ttttcagaca tttgtgcctc cagcacagtt tgaggttaat ttagcgttgc cccggctcac    244440
     cggggcaaga ataaatcaac ccttaatgaa actgtgcccc caggtgttag gcttaaatgc    244500
     ctgctctttg atatatgttt tcattacctt gcaggttttt ttcagggctt tggtattggc    244560
     atcggttact gagataaaat ggcgagaata acggttttcc cggtattgct tatcagcgtt    244620
     tgggtcaatt gcttcgcttt gcaggagtcc ttcgtgcctg ccaattacta ttacgtagtt    244680
     catttcacct gaaacacgat ccgtgagtaa ttgaatggaa atatcagtcg ctcgcgtggc    244740
     ctggctagca gaaatttttg catgtaagaa agctcccttt cgaaagttgg ccggagtcaa    244800
     acctgtaata tcctcggtgc taaaattaag tgaagataga gttgaaaata aatcacagct    244860
     aatgacttca gtattattag acataacccg gctccgctca tattcatgtt aaggtaatta    244920
     tatcaggttg atagcattac ctaataactt ggtggcaaaa agttgtggtt tttgattaac    244980
     taaaattgat gttctcaata ctgctcaaga attctttctt tacacccgga gtaaaaggta    245040
     tacgttcaat gtatttataa agcgtcgcaa aggttttggt ttcaatgttt cgtgaaataa    245100
     catcatcaat cgggtcttcg aacatattaa taaaaacatc aatatgctgc tctccgcttt    245160
     ctgaagctaa agagagaata cagaccactt caatgtagcg gttatcctgc tctgcaatga    245220
     acaaccagtg cccttcgtta aaggctggtg cagcactgaa gcgttttaca acaatttctg    245280
     aaagagcata tcctgcctga tccaacagat taataaagtt gagttgagtt gaaaccacgt    245340
     ctaacgcttt cataaaacct ccttttcatc tgtacttatt atactgttac ccatcccccc    245400
     agctaataac ctcccagcaa actttcaaaa aaaataccac ctttaattag aattgaacac    245460
     atccttttta aataacaaaa aggattatga aacccacaat gtttgtgatg tgccaccaag    245520
     gaaaagtaac ttttatgtgc tcataaatct tatttcgtat tcactttcct ttgtctttcg    245580
     gtcgtagatt atcaggggaa gcataagaag aatatgtgag gtttaagcaa atgcggtgat    245640
     cgggcattat aatttggtga ggctattata agtggataaa gatagtcgta ggtataggat    245700
     caggttaaat tgcattttcc cggttgcctt ccctggccta ccggtttcag ctcagatact    245760
     aagaccagcg gtaatactta aaatattcct catttgcagc tataaactcc ctcaaaccgt    245820
     tcattaatcc cttctcaaac gctgtcacga taaaccggta accgtccagt gtttcaatgt    245880
     agtaaatacc gcctggtgta attccaacat gcaacacctc ggctgtcatc ataaactggc    245940
     cttccggaaa atcatgcgaa aggtaaatga aaccagtagt ggccgatgcg ggtgtggcat    246000
     tcactaagac cccgttaaac tgctgcccgt gcctcgccgg tacaagctca cttcccctgg    246060
     ttgacttatc aagcagcctc ttaacatctt tttcttcttt taacgaggta tagacccgca    246120
     catcactgtc atcacctggg cgagagccgg tgccaacatg agcaagacga cggtaagcac    246180
     tgcgcatatt aacgtggcag gatgcccctg ctctaccctg aagccttacg ccaaagtctt    246240
     cgcaaagtaa caaaatctga cgtagctggt tttcatgcac ggacgctgag agtgaaagat    246300
     tgaaacagga aaaggtcagt tctaaaacct tttcgcgttt gtcattgaaa tgagcttcca    246360
     gcctgatgac tggcttttcc gacattgcaa aagctttgtc cgttactctg taccggcatt    246420
     catctccgaa acattcttta acaacgctgg ctatgaccgt gtcgtgttct ccatcttccg    246480
     gagctggcac aaagatttca aattgtgccg gtgtatccgg ctcaagcaga acgggataga    246540
     gacgcggaga attaagcaaa gcgcattcag aattaatgag cttaacccag gcgcttttgt    246600
     cgtccggatc cttaagctgc tgtccaaggt tatcgcaaaa gtcaactatc tgacgggtat    246660
     gctcatccgt gactgcacag atcaggttaa gaccatgcgt ggccatacgc agttcccggg    246720
     ttcgggactg ggaattgatc gaccaggggt taagtgaaag cgaaataggg cttatggaag    246780
     ggacgaccgt ctcattctgc aaatctgtaa gctggcagtt cgcagtaggc ttcggggaaa    246840
     gggtactaaa tatgtaactt gcctgttgtt tagtactggc ctggatataa aacatcgcgt    246900
     ccatgcttgt atcccgggat gaaattgaaa atagcttcat ttttaacctt aatggatgag    246960
     cgatttatag tcatgtgcag acaaatgaac attatgtgcg ccatcattcc attcaaagaa    247020
     taatcgatac ttagagttta ctcgaatgga ggaataacgg tttgacgtca ttcttaagcg    247080
     ttcataacgc aagctgttgg ataataactc ccgctcactc tggacattat ccagcgtttc    247140
     aagtcgacac agaatcgcgt taataatttc agaaggaata cctgccgttg tttttccatt    247200
     acggaagaac ttttcaagcc gtctgtcttt aaatgaatgg atcatagttc ctccgtaata    247260
     attgacctta aaattaaatt aaaagggctt tgaattaatg aatacctaaa atgcgggcgg    247320
     caactgccag ctgcttatca cttaactgac gctggtgggt taaagaagac ttaaggcttt    247380
     ccagaaaatt attactactg gattgttggg tgattgcatc aaccattttt tgatgagacc    247440
     tgcaccatgc tgtgaacgca gaactgtggg cgctttcagt ccttaaacgc tcgtcttgca    247500
     gggatgctga cactttgcgg gcagcttgcg cattaatgcg gtacagcgca ttcagcgtgt    247560
     aagcagtacg ggtcgtttcg aggctgtaac ccgtggcttt acaagccata cagcgacttc    247620
     tataaaaatg cttacgctct ccccgcccat tgcatttatc gcaaacaata cgaaaagtat    247680
     attccgcagt accttttaca gaatcaacac agcggatttt tgcgctggag atttcaattc    247740
     cactgcgatc ataatatttg gtcataatgt gattcctccg gttagttctg gagtaatcat    247800
     gacagaatga atctactggc taataacctg agagtaaata ttttaaaaaa acattgagag    247860
     agggtctgca aatttataca cgaaggattc aaatataatt tgtttaaaaa attaagagca    247920
     ttctgaagta aaattgcatc aaaaagcatt catggataaa tcatgtactg gtgccagcga    247980
     tttaaacgag gacattgttc cggtgtaatt acacggttta gcatcataga ttataaccaa    248040
     aaggaaggag tccttcccgt ctcgggaata ttactttccc gtttgcagtt taagagacac    248100
     ttaatgagaa agtaataatt aagtcatgct caactctaca ttttacattg aggatggcgt    248160
     aacagggtac ggcatactac cgtacccttg tgtagggttt atgtttgagg gaattctata    248220
     gcaaatgtgg ccgtgccaga ttgaccactt acagcgggag taacgggata tgtgcgctct    248280
     tcaccattac caagatccag tgacagcgat ttagtttcac caggctggac cgtaactccg    248340
     gcaaccgtaa cgccgaactg ggcgtttttc tgaacagtca gggttccgtt taactgtccg    248400
     gtaatgatag aaccgtcctg acgacgcaac acactggttc ggatgatggc cagcggcgtg    248460
     ttgtccgttg ctttcagtgc tacggctgtg gccagcgtct tgagattatc cagcataatc    248520
     aggttagctg gctggtaggt aaaattaagc gttttagtgg tccggttacc tgattcgtca    248580
     atagccagag cctccagatg atacatctgt cccgattcgt cagtattggg gaagattctg    248640
     gggtattcag gaataaagac atccttggat agcggcgtga atgcaagggt gaccttttca    248700
     gagttaggtc caccagcgag ctgaagcgat atcagggaag catccccaga ggcatcagta    248760
     acgcttatgc gtaggttctc aagcccttta accagttttc cttctgcgtc tgcgccatta    248820
     aagctgaacg caataaccgg aagcgttgag tcaattttca gcggtgcatt aagcgttttg    248880
     gttcctgtgt ttccaacaag atccgtggca gacacgctaa caaccgtata atccccgtcc    248940
     ggtagaccag cgtatgagaa agtggcgttt ttggttttat aatcgctttc actgacagtc    249000
     acaggcttca gggtgaaagt ttccccccgg gcatttttaa gggtggcttc gaaaactttg    249060
     gtatcccagt agctgatgtt ccaggcgttg acgcgatcat tatcggtggc cgtcatagtg    249120
     attgtcttgg aggccttgtt tacctgagcg acattaacca ccggtgggtt gttatcccag    249180
     ataaccgtaa aattaccagc aagcgcatcg aatatgctgt caccatcttt tcccgagtaa    249240
     agatgcagat actcaaatcc tttgtcactg gtgtagttga agttaaccgt catctcgcat    249300
     gaactttgtc cgacaggaat agtgcagaac caggctgcat tttttaccgt tctgaacttt    249360
     tgcacgtatg gtcggggttc tgcggttacc tttatgcggc taatggtggc ggttttaacg    249420
     ctgattgagg cctgagttaa ccactcactg gtatcactcc ggtacatctc tttagccact    249480
     atcttcgggg ctatttccat cgccggggct ggagtgaagt tgagggagtt atgatgaatt    249540
     cgtcttactc ctcccgccag agtctgaaat tcatgataag tatcccccac atttggatat    249600
     atgtatttga aagtatagat attataagtg ctatcggacg tctggaaatt cgagtccgcc    249660
     cagccatatt tggaaccgtt aacagcagta aagtcacttt tcttccttaa tacccgtacg    249720
     gaaatagggt tctggaagac ggtcatgcca gactgatagg agacccatga tccggtagtg    249780
     gcgtcctgca cctggatgat atcgtcaggc ttaacccgat caattacgct tcggcggctt    249840
     agttcgctcc tgtttcccgc tttgtcataa aggtagatcc ccactttata ttcagagcgg    249900
     ttttccggtg ccagggcatt gctgcttgcg tcggcgactt gaacggttac gctaccttcc    249960
     actgtattaa tttccgctgg ctttttacgc tccactccag cggcatcggt tatgaaatat    250020
     tcagcattag caagcccgga acctttatca ctcagtccat taaagaccag tgcctggacg    250080
     ctggcgtact gcataccggc tggtactgaa gtgaagatcg cttcgctgcc aaagttccac    250140
     ccatttctcg tataacttat ggtacccgtt gccggaggcg ttcggtcaat tgcaagcggg    250200
     taatcctgcc gggagacctc cttcccttgc aagtcggtaa tcacctctct gagggtgaag    250260
     ctatcttctc ccatcgctgg tacggtcaga gtcttgccgt aataatcaaa gcctgtcgaa    250320
     gatgtggtac ggtcatcaac ggtaaccagg ctgcttttcg tgctccagat gaggctcccg    250380
     tcacttttca gcagactgag cgtaatataa cggtccagac cggaaataac ggcaacgtca    250440
     aagctcgtta ccggattaat ccatacggat gcaggcgata cggtcttttt aacgttcagg    250500
     gtatctttaa agctgaattc tgcgatttca gcggaagctc ctgcgctgaa acctgcaaat    250560
     gcaataagca gggctagttt gattttcatg ggttgtctcc tgatcaggtt ccccatgata    250620
     ctttttcagt gttcgtgatc ttttcgggaa aatagctatt tttgatgttt ttcttttctg    250680
     cccggcggga ctttttttgt ttacgtgaat gcaacaaaac cagaaaagtt actttttgat    250740
     agggtaaaat taggtttccc taatttccag aagcaagcga aagcagaact agcttaatag    250800
     ccattaagaa cgccatacct attgataaat aacgctcctt acatttaatg atttgagcat    250860
     ttaaaaatga attagcgaaa gaattttggt ttgcttttta ttgcatgagt aaaacagtat    250920
     taataatccg gagccattag aacgtactct aaagactccg gtatacagat atcttgccag    250980
     taaaaatggc cttactcctc atcatccccc agcgcttttt tgatggcgcg gcggcgggct    251040
     gcatcaccta cacgatatcc gactgaatat acgtcattca accggcgcag aataagattt    251100
     atttcctcat cctgaatgta ggcaggtaaa cacagaacca cgtcgccatc ttcatcatag    251160
     actcgaacaa cttccttctg cccatctcgc tcgcgaataa tctggacatg ctgaaccctg    251220
     gtgtattctg ggtttacgct cattttaagt atctctctgt aattgttgtt accagttagc    251280
     tataagccgg ataattctgg tattcagtgt tctgcacagc aatcgcctgc tcgtggatca    251340
     ttgacactgc caggcgggct ttaactcgct tgctggtgag aaaacgcttc acttctttaa    251400
     gttcgctgcc agccgacagc atattgaaga catgctgttt gagactgttg ttatttttgg    251460
     ccacttgttt ctccatcatc tttgtacatg gttatttcag gctggcctgc cagatcacac    251520
     acgttatcca tatgcttttg gacccagtct gttagaccca gaccttcggc ctttgcctga    251580
     ttgacgtaac gcagtttacg ttcaggggta acccgcatct gtagttgtgc cgtcgctgga    251640
     accgcctctt tcagggcgtt aaggcccctc tgatcacggg cctgaattga tggtttaccg    251700
     ctaggcatct gatgtatcgc tctcccggcg agcggtggac agctctattt cttttgcgat    251760
     agctttatct atggcatcca gctgcatggc aaacttgatt tcaagcgaac agcgtaatgc    251820
     cttcagggcg cgttctttgg tgctgtattg tggtatgccg ttctggctac cattcatgcc    251880
     tcgcatgcgg cgggaggttg catcgacaac ctctccctct tcccgtgtgc cgtgaaccgt    251940
     agttccgctc catgtcggat aaacagtgcc agtggcggtg ttgaagctcc agccgttttg    252000
     gtattccccc gagacctctg gtacgggcat atcgcgttca acgccatagt cagaccagcg    252060
     taaagcgcgg tttattctgg cctgtgccac cagctcatca tacgcggctt gttctttttt    252120
     attcatcgcc atttagggca atctccttag aggggaatta ggtgttatat cggtacgtaa    252180
     gtgcttttca ggcctaatct ctgacaaggc ctgatgtgcc agactgccgt tgcattcacc    252240
     gttttatggc ggttgacaga gcctcattaa gagccgcaat tagctcaggc gaagtcggct    252300
     ccagattttt ggaagcgttc agcagctcct gaagtgaaga gatttccttt ggctccacct    252360
     ggtttgtttc aggtgccgtt ttttgcactt catccagtgt acgctgtgca ccgttatcca    252420
     gcaccagcac ccccccggca cgaatttctg aaatggtgcg caacgtatac atcaatttat    252480
     cccagacacg gctaccaacc tcgaacccgg aatcagctac tttttcttca ttatgctttt    252540
     gaaaaatttc ttctaaccaa gtggtgaagc gctttccaaa agtattggcg gctaaagaag    252600
     tgcaggaata aacctgttcg acctgttttg ttccattttt atcagtgaat gtaatgagac    252660
     cgattcggcc actgttaaca gtgtaaaagc gaggttgaaa gccagctttg agaaggtttt    252720
     caatagctga aaaaaaatct tttttgagca tcggtttcaa aatggttttc cttttatgcc    252780
     cggtgccgcc ggggcggtgg cgttaaatat acgccatgta agtaaattaa tttataccca    252840
     tttgattgtc aatacaaaca aaaaaacaaa ccatgtttat tattttatca acgatgctat    252900
     tttaaagtcc gtctaaaata aaaaaccaaa aagttaaatt tgaagccgtc cttcctaaat    252960
     tcatttcttg cgcatattag caccctgctt taagtaaata atttttgaaa aagttgtctg    253020
     gaggttatta gctcgtgcat ctggattggt aatataaagc caacacagaa aaggaaaaca    253080
     aaatgtataa attagtatct cctcgtgaac tgactgagat tattaccggt ttactgctta    253140
     aacctgaact ccttggtgag ctggactcac cagaaaagca tcggatgttt atggcagatt    253200
     taggccgcgt ggtggccgaa cattgtggag gtctggtaaa cagcgtcgtc ttgccaggaa    253260
     cagaagttac agtgtcggat gggttaccgc ttaatggcca gccggtacgt tatctcggaa    253320
     tcaaagagaa catccctcac ctccttgtag agcctgatgc ttccttacct tcgctcgcta    253380
     aaaacgtctg gatgtatgca gatcctgaag gctggaaaga acattttgga gctgaggaag    253440
     actgccttac tcctgaaatg atgcagctgt tccgtaaagg tatccaggct cttcagaaag    253500
     agcatgacac ccctgaaatt agcctcacac ttcaggactg gcgcctggag gaggaaacac    253560
     tgccagaaga ggacagtcag gcctatcagg tcagcgttac cggccaacat aacatccact    253620
     gtgaagttgt taacaaggaa ggtaacccct gttttggtgt catgttcgaa atcgatcagg    253680
     gtgtgcctgc cttacacatc aacaccggcg gggatatgtt gctccacatt cattgcgccc    253740
     ataacggact cgttctgacc cctgatgcaa gcggtcagcg atttgataag gctcccgttg    253800
     accgcttctc ttataacagc ccatccctgc tgttgtctgc cgactaacca aggccaaatc    253860
     tgaattgtcc cgtttaagta accaacccgc tgccgccagg cgggtaaatc ctcttaatgg    253920
     agttttaatg caaatctcaa ctgaagttct gaacgtctta tctcgctgcc gtgctgaagg    253980
     gaactttctt ttcctggccg accagctcga ccgcagcatt tatgttaaga caaacaaagt    254040
     gctcgaagcc gccggtggca aatggaaccg aaaagagcag gcacatattt ttacggcgga    254100
     tgcagctgag cgtatcgagc aaatcattct gacaggttcg gttgacatcc cacgagatct    254160
     gttcaatttc ttccctacac ctgagaattt agtcacagat atggttctac gcgctgaacc    254220
     agctgccggg gagcgtgtac tggagccaga gtttggtgat ggccgcattc tgaaagcctt    254280
     aaaactggcg gctccggatg cattgattac cgggatcgaa ttgaacgatg agcgattcct    254340
     tgcagtgaag aacgatagtg tccttagcac aggagtcgag ctggtgcata ccgactttct    254400
     tgggtaccag cccgatgaaa cttttgatgt tatcgttatg aatccaccat tccttaaacg    254460
     ctctgacgtt aaacatgtca tgcatgccat cgcaatgctc gctaagcgag gtcgcttaca    254520
     ggccattctg tcagctgggg tattgttccg ggaagacaca ctgacaaaag cgctcaggga    254580
     gcgagtcaaa caacttggcg gacaaatttc gcctcttccg gatgatacat ttagggagtc    254640
     cggaacaaag gtcaaaacag cccgccttga aattgatctt cgccgctaac tgacaagcaa    254700
     ccggaaagaa atcttaatac gagtagccgg ttaaagttac ctgaccggct taactgacta    254760
     aatcaataaa gagtgaacag aaatgacgca tactgccgtt tctcaggcta atagtgcttt    254820
     gcagctaccc acggtggagc atgtctacgc tcttctgaaa gcaaattgta aacctgaccg    254880
     ctttgacggg cgtgacggac ccgtgtgggg ccaggaatac tcgtggaatc tggcaaaaga    254940
     tcgcttacag gatctggaga aatacggtaa ggcatatgtc tcccgtcatg aagaccgtat    255000
     gggggaagga tttagttttg gtcctgacct gttaattatt cgctaacgct cctaatgcct    255060
     gatgatatgg taagcacaac tggaaaaata tgttttcaaa gcctatgacc actttcacac    255120
     cagaacgtat tgaacaaatt ttggaatttg ccgagggtag taacccaagc gaagcaatga    255180
     gtctcagagc tgacgaagtt gctgtactgg cacgtattgg aaaggcagtt atgtcgattg    255240
     cgcctgttta tcagtgcgag ttttgccacc atgacgcaac cgggcaactt cagtggcact    255300
     gggaagatgt gaacaaagct ttttatgata aatacgatcc agacagacgc ggaagacgtc    255360
     gaatcctcta taccgccccg ccgatgcctt tagtttcggc tgacctgctt aacatggctt    255420
     catctgctat tgaagacttg ctcactaaca aagacagaag tggtgcggga atgtggaatg    255480
     acattccaga acagctacga cgcgcagcta atgcgatatg tggatgccga tagtttcagg    255540
     ctaatgttat aagttttgca atcgttgcca gtttggacac cacagaaatg tcagatgtaa    255600
     ttccaaaaag aaagatttcc gtcctgaacg cacaataagg tttgtcgaaa ggcaaattat    255660
     agatttgtaa tttcgagcac catatggaga agttttttat acttttacga acatagtgac    255720
     ctttaggaaa agcttaaaat aacaccaaac ctaaagggga ataagaatga aacatctcgc    255780
     ttttattact gctgtagccg gactcggtat gtctgttcag gccccagctc agatatatga    255840
     atcggccttt aaagacacga acggtattga gatccacgcc ccgtcttctc gtcttatgct    255900
     taatccggca tcaccggtaa ctttgacact tatttcaggt cttgatcgtt tcgttaatgt    255960
     caaagtcacg aaagacactg gaactgtcat tcttaatact acgactacac ggacgggtgt    256020
     atcagaccga ctaacagctg ctgacggtag tgagttctac ggcaaaaaag taactttgcc    256080
     tgctttgggt gaaggcaaat ttgtcgttca gataaacgtg ttagatctca atcagaagcc    256140
     tgtagcgacc tataactata actggctaat tgatgtcacc cctccagcgg caaatgctct    256200
     taccgctaat actggttctg gctctaccgc tggtgacgtg tggaagcttg gattagaggc    256260
     aacggggcag tatgacttca cctcttcggg cgtaagtgat gcaaatggta ttgataaggg    256320
     cctaatatat atttacaggc aggacggtag cctctacagc actacacaga tgcagtatga    256380
     cgtatccggc caaaagatgt accacactta ctctaagaat tcagttaagg gaaccggaat    256440
     accagacagc aacctggatg aagactttac tgcaaaagtt gttatcttcg ataacgcagg    256500
     taatagccga acgctgccaa ctcaaaaatt tcgctacgac aacacgctgg gtgagatgac    256560
     actgtgggcc gttcatgatc caaatacgtc ttccagcgtc gtacccgggg tttctaatta    256620
     tccggcttac aaagccggta tggtcgttaa cgaaaaccct attcgattag tctaccggat    256680
     cccaaaatct aactaccgtg cttattcaga aggtgggctt cagttcatca atcaatattc    256740
     cgcccccaaa gagatagctg tagacagcac ttatgcttat gttgaaatga ctcttcccta    256800
     tggctcaatt aatggggata tggctcgtat ggcgaacttt ggccagtggg gagggtatta    256860
     tccgtcatac agcctcgttc taaacccatc tgcaaaccaa acgcctgcat ttgcgggtac    256920
     ctgggtagat ttcctcgatg ataaggggaa ctgggttaag tggaaggatt ttgagagtgt    256980
     ggcttcatca cgactgccaa ttaaaatttc ccgacttcgt tttaacgttg aagcccggcc    257040
     ctttgcacaa gagatcggcg gtaaggcgac ctgcaccatt ccggcaggaa aaacctcgtg    257100
     tgaagcgcct gagacgtttg atatggcctt gggtacccag ggctacaata ggatccttta    257160
     cttcgttcgc agcatcagca atcccatttt gcggtctgag caatggatta tgacacgctg    257220
     gaacaataaa caactgccgg taataaactc gatatcatat gacgagacta acaagcagct    257280
     ggatgtactg gcgtcacttg aaggcgatgg taactggttc gactcggtct cattgaggga    257340
     attttatctt tccgataaga acaccggtac ccggatgtca cccacaggcg taatcaaatc    257400
     tcgtatctca ggtaactaca cgattgctta tgatttatcc cgtcagtctg aaggaaaata    257460
     caacgttgag gtcaacatca gggacttctt ccagaaccag accaataaaa ctttcggaga    257520
     aattgctctg gataacactc ctccgacagt ggccataaca ttcgacggaa agccggtaaa    257580
     agacgatacg gtagtgtacg gcctggagaa cctcaggatc gctctggcag ataatctgac    257640
     aaccccgagg ataacccgtc ttcagctcgt aggtggcccc acagctgata acgttgagct    257700
     tacgtggtca ccggcaggca aagatacata catgcctgag tatccgaggc tgttcccaaa    257760
     tttcgaacca tctgaaaatt attcaattag cgtaacagtt gccgatagtc agtcgaatac    257820
     caaaacctat actcagaagt tcagttatct accgaataac cttgtgcagt tacataatct    257880
     acgcacatta tcggtcagtt cgcctctcaa aacgacagat ggcgtacccc ttgcgtacct    257940
     gtccactaac gttctgcgta agacaaatgg agaaattgct aaaggggtcc agaacgcaac    258000
     gctgactgtg cggaaggatg cagccttcgg tattaaattt aacggggcac aggcggctcc    258060
     aggtgagtca gttgaggtgc aaatagatat gggccagggg gataatcttc tgttacccgt    258120
     ttatccttcc gaaaatggga aagttggcac ctcagaattc atgattcaga tcgacgagtt    258180
     gaagtaacta cccggagccg acagtaaaac tgacggcttc aattttactg ccctccttga    258240
     ctccgatcag ccagtacgtc ttcagagatt cgcaaggaag aaccgaaaga aaagttactt    258300
     taatcgtacg tttccagcga tgcttttaaa agacaatgca cactcgttga ttacgacaat    258360
     gggagtgagt gtcgaaaccc ttgagtaagg atacccggta aatatacagc cccggggatc    258420
     ctcttccttc aaccggggat gacaacggta gtgagtccgg caactcactc ccgttgtcac    258480
     ttctctgaca tatcgtcata cgagcttact caagtgcatc cacaaagatg ggatcgtttt    258540
     gaatctaaac tggtactggt tagccagtca cttgcatcta ttcccccgtc gatacttaag    258600
     tgacaattgt agtgatctgc aatactggtg tctcagaaac actgacgacg gtagagactc    258660
     aataccctaa cccctgacaa caggagtgag cttagaggtg ttacgctgct gtcacttaat    258720
     gcttgggaat tgcctgactc acaaccattg tcatccggag ctactgatta acgttgaacc    258780
     gctggacttt aatgacagtg gtagtgatgg ataggctcat ttccattgtc gtcattttat    258840
     cggacaagcc tcttcgtcct acaggtttaa gctgacaatg gtagtgattg gatgatctca    258900
     ctactgttgt cactcagttc tttgagcgga cccttccctc ggttggtcgg cattaacaac    258960
     ggtagtgact cgattggctc actgccattg tcatcgtgta aatgacgtac cttatcagct    259020
     cagctgaaag caatgacaac ggaagtgact ctaattgctc actgccattg tcgtcgtgtc    259080
     tattgagagc cttatcagtg cacctgaaaa gcaatgacaa cggtagtgat tctaatggct    259140
     cactaccgtt gtcaccgtgt gtattgagag gatggtccac ttaactggac gtctatgaca    259200
     atggtagtga ctttaatagc tcactaccat tgtcggcgtg tgaattgaga ggatgatcag    259260
     ctcagctgta cggccatgac aatagtaatg acttaatgag ctcactaccg ttgtcaccct    259320
     gttaattaag aggctcatct gctcttctgg aaggctatga caacggaagt gacttgctgg    259380
     gctcagtgcc attgtcgccg tatgaattga gaggatcatc cgctcttctg gatggcaatg    259440
     acaacggtaa tgacttaata ggctcactac cgttgtcatc ctgtaagtta agaggttgat    259500
     ctgctcaacg ggacgactat gacaacggta gtgacttgct gggctcacta ccattgtcac    259560
     cctgtgaatt gagaggtaga tccgcttaac cagacgtcca tgacaacggt agtgactttc    259620
     tgggctcaat accgttgtca ccctgtgatt taagaggttg acccgctcta ctggacggcc    259680
     atgacaacgg tagtcacttt ctgggctcac taccgttgtc gccacataga atgagaggag    259740
     catcagctca gctgaacggc aatgactaca gtaatgagct ggatgaagca taaccattga    259800
     catctggccc aaccggaagc cgtattcgcc aatccaatcg agattcacaa tggccgtgac    259860
     tcgccgcatt aagttccggt gtcctcccaa agctgaacgc acactcggag gacaatgaca    259920
     atgccagtaa ggtacacatc attaccattg tcactatagc taccagagaa gccgggattt    259980
     gaatgtcgat ggtagtgagt gggtcaactc actgccattg tcaccccgtt acgatatttt    260040
     ccgttggatg tactggccaa tgaagtaaag cgtagaaacc gggtgttaac aggtgactca    260100
     ggagaaagcg ttgaattcgc aatctcgatc tacatagggt ggtagagaac aatgacaacg    260160
     gtaatgactt ttgactcatt accgttgacg tgaaagagcg ggctgggact aacgaaaatc    260220
     gaagaagtaa tttagcaccc ggagcctgaa ccgccgggtt aactttagct ggcgttgctg    260280
     ttctttttct ggcttcgaag actacgaata tagcgcagtt cttcagcggt taaatcatgg    260340
     acggtaagaa catcatcgcc gtctatcggg tcagctggtg ggcataactc accttctaaa    260400
     acagaagacc ctgagttctc ttcttcatct tcaaccactt ctaaaggagg ctgagtattg    260460
     ttcaaattca gatcgggatc ccgcttatga atctggaagt atacttttcc gtctttctta    260520
     atttcggtgt actggaggta tcctatcgat gccaactctt caagagcctt tctcacggta    260580
     gcattctgac tatttgctcg tgttttgagg ttcagacgat ttttcagccg agtaagggat    260640
     atcggtatag gatttggcgg taatgactct atgaacgtat agagagcctg ggcgctttcc    260700
     ttcttggcca actccttaat tgccttcagc tgcatcaaaa ccttatgatc gtattgatag    260760
     agctcgaaaa tcttaggatc aacctgaagg acaacctgat ctgattccgg gtctaacagg    260820
     gcagactgta ccagatgcgt tgtatagact ttggacgagt tattactggt gaacgacaag    260880
     gtaacggatg ctaacctgcg taaggaggcg tctatacgtt ttctggacgc tgtagatgag    260940
     cgataatttt caggcgtaca tagcttgagg aattcagtga attttaagct tatcgtgtca    261000
     ttgttaatcg gatgattggc ataggttcga atgatgccca tccacgtctt aaaatctact    261060
     gacatatcaa gacgctcacc gacaattgaa atattggtga acccctcgct ctccattaaa    261120
     gagagcgtct gtaactcttt cgttgcgtca aagccaaccg ttttatattc ccgattttga    261180
     cgccccacac tctttggtga tgggacgaac agcccgagcc gcatcaaagc aatagactgc    261240
     accgtacggt tgctgttagg acgcaaaatg atgtctttac ctgattcttt ctctctaaca    261300
     gagaaagccc tggtgaccag gtcctgctgc tcagtatctt tctctttagt cataataagt    261360
     tatcactgaa tgtgtaaaca gattggtgaa tagtaagccc cagcgaactc tatgtcactg    261420
     gatggatcat tgtgatgatc catatctgtg cataagttct acctaaaaaa acgactccac    261480
     tcattaaaac ttggcaaaaa ctctttgcat acaatgacct gcaactctta tcaacaacgg    261540
     atcagatcaa gttaaaaaga tctaatgaaa agtcactact attgtcgctc tgatcactac    261600
     tgatgtcaaa aaactcatta ccaacgttat aataatcact accaatgtca aaataatcac    261660
     tactgttgtc actgatcacg tctcaggcct tgtgccgtct ggcctggagg cagcggggat    261720
     ctcttttgat ctatcaggaa cactaaggta ctaattattg gaactacctt gtggaaaatg    261780
     gggataaata aatgcttagt tcttatacag gtctcaactt gcctccctga taaaaactgt    261840
     cgtcaaagct aaatcacagc cacaggcatt ttcggtggat aaatttttga gaaatagaag    261900
     catacatgca gactcgtgtc gcaagtaatt gaaagtaata atttatttaa ataatgcgag    261960
     tcaccttacc ttacagtgga agtttaagtc taacctcact accattgtca cttaaaatca    262020
     ttaccaacgt cgaaatagtc tctaccattg tcttttaagt cactcccgtt gtcacttatg    262080
     tcgctactgt tgtcagtgac aatgctccag cccagtaacc atgcggccta cagcgtaccg    262140
     ggatcttctt tgtactctct ggcacctttg ggatcattta ttggatctac atgagggata    262200
     aaatcttttg acgatttcgt agtgcagtta taccagcgac ttagcaagac aaaagctgca    262260
     atttagtgac gagttactag tctgcccaac aagagcaatg cagagaagat atgtggtgaa    262320
     atgaccatgg tagtgagtct aatcactacc atggtccgca gtaagcgtta cttacgcaat    262380
     gaacgtcgga ctgatttgca acaacatggg ctacggcgca tcagaagacg gccgttgtgc    262440
     ttcagcaaaa cagccctgct ttattttaat tcttcaatgt taatcatgaa ctcagatctg    262500
     cctgtaaggc cggatacagc agggaaaata ggaaagctac ggctgtcccc gagccccaaa    262560
     tccagttgaa gctctttgct ttcacctggc atcgcagaaa caccatttac agtcacgccg    262620
     aatgcagcgt ccttacggac agtaagcact gcgtcctgaa gccctgtagc gattgaacca    262680
     tcctttttac gcagctggct ggcatacaga acagccagag gagtattgtc agatgttttg    262740
     agagaagcat tgacagctaa ggttttcaga ttctctagcc tgacgagatt gtttggaagg    262800
     tagttaaatt cgactgagct ttctttaacg ttgttcatct catctttggc ctgaactgtg    262860
     agagtgtatg tttcgccttc attaagagac ggaaagatct tgggataatt aggtgcatac    262920
     aggttgtttc ccagattcac ccaagacaat tccaccgcat cagaaacagg gccaccgcga    262980
     agagtcatac ggcttaagga tggtttagtt agagcatcgg tgagctgtat acggacgttc    263040
     tccagcccat atactgttac gtttttgctg atcggttttc cttcgtagct aatacttaca    263100
     gatggtgctg tattatcaac gacaacagtt tgataaggga ggttaccggt attgttgaat    263160
     gtatcttggg cattaattac cacgttataa ctgccttctg gtacctcttt catgttgaac    263220
     tcatacgtgt agttcccaga cgccatattt ctacctgttt gtttgccggt tacgcttatt    263280
     tctgcgttgt tacggttttt atctgacaac caaactcgat ttacataaac atggtcgaaa    263340
     tatgaaccat ctccaggttg attcacgtaa acctggagaa tgttggtggt ttcaatgtaa    263400
     tcaaatccag tgacggaggg acccagtgta tgccaggcta tattctccca tataggggca    263460
     aagaaggttg cttcggtggt tgaccttact tcatagccac tatgaagata gccggtagtg    263520
     ccatttataa tatcctgggg caaagagacg gtacaggttg ttgagccagc tggaatactg    263580
     catgttgctc cgccagtgat tttttgatca tatggcctag cctgtacatt gaaccggata    263640
     ttagtaagtt ttataggcat atcagatgcc ttgaacaggt tccagtttac gctgttgaac    263700
     catgttccat cagccttttg tcgttctatg ggtgaacttc cccaagccgg actctttaca    263760
     gaggcaggat cccagttgag ccagctggca tactgaccaa gatctcctcc agaccattga    263820
     tatgtattca caggtctata gtagtttcca tctaaggcac cctgtggcag cttaacttcc    263880
     acgtagacat aggtggcatc ttcggaaagg acctgtactc cgccatagtt attggtaatg    263940
     ctcatgccac catttcgata tggcttccag ttagttcttg ggatacgtat aaccaacttg    264000
     taggggtttt ccagcactgt aaggcctcgt ttaaacggga cgtatcccga agaaatgccg    264060
     ggtacaacac tggtgcttac acgtgagtca tgaactgcaa atggcgtaaa ttctcccatt    264120
     tgatcgtcat ataaaaaccg ctggggagga atgttaagcg tatttcctgc caggtccgta    264180
     acgatgaaat tgaaggtgaa ttcttcatca agatcacttg agggcatgcc agcctgggtg    264240
     ttcatatctt taatccacgg atagaacgca cgtttattgg ctgtgtcata actcaggtta    264300
     ttgtcggaga ccacagaacc attacttcgt ttaatgacaa gacggatctt ggcaattcca    264360
     ctagcatcct caataccgtc tgcaaatata gaaaactggc cactaccgcc tcggcccaac    264420
     tcccaaagtg gcccagaaag taccatgtcg taacctgcgt tttgactcgg ataaatactc    264480
     ttatagcgtg gaggagttgt atcaacgatg aaatgataag tagatgtgct cactacagtc    264540
     tggcgaatat ccagagtttc attgactaca gtaaaggtcc cttctccgag cgccggtaga    264600
     accatatcct ttccatagta ttctgttcca tcggcagcaa cgatacgatc tgcaacgctc    264660
     gttttggtcg agacggagga atacataacc tttttatcgc tgtctcgtgt gaccgtcact    264720
     cgctcgtacc gatcaagacc cgatatcaag ttcagagtca aaacaccagc gggattaaga    264780
     tatgtttgtg ttgcaggctt aatattccga acagccttat tggtatctgt aaatgagtag    264840
     ctaaatacct gagcatgtgc cgaagataca gtagcaaggg cagttgcaac catgcagcca    264900
     attagagttt tacgcatatg atgctccggg aataggttat agccttattc tacggattca    264960
     gcctacaagg tccggtcgga taaagtgata atttgcctgt taaaagagac atcaagtgag    265020
     aaagcaacca acgtacagaa tgcaaaatgg cggcagtgca tctggatgac gcaaaagtaa    265080
     ctttttgtac ccactttttt ggattttagc cttcaaaatg agtattcaac caatcataaa    265140
     agtaactttt gatagacgct gctcctttat gtttgccaat tgtgctgata tgtttttaaa    265200
     ttcaaggaag cgagatttta aaagcatctg ttgagtcaaa tttatgtaaa ataacagggt    265260
     aaccatcact tctaggttga ggaaacccaa tgttatacat gctcttatgc tgttttctga    265320
     tgctcaacag tacattcgtt atgttcagag caatgtctgc aataagtaaa ggatccgcta    265380
     aagaaaaccg gtctgaaata tcgctgatag tcctagcaac acttggaatt gcatcaccat    265440
     tcattgtcgc aatgattact attaatgaaa gtatgacatc taaaacagta acagattttt    265500
     ctttgggtgc tcagtggtcc ggaatggttt cagcggtagc gctaatgggg ttatatgctc    265560
     gacgcgtttg gaaagagaag aagtccttat ttactggcgc tttcctggcc tcttccttaa    265620
     tggcctttat ttttactgac agccttgttt tcgtatccca gaaggacacc ggcgttctgg    265680
     ctactttcgt actcgataaa aacgctggag atattgattg tagtcgcccg gctatgattg    265740
     tccattacag taaaggtgtt ccaacggact ggcgttgccc aaccagtatc atgttgatgg    265800
     cgtattcttc atatcctttt ttaccttggc ctgagtatag ccatggtacc agccagtctc    265860
     ttacggttgt tattgataca tttatggaaa acgctgttaa tctcagtcaa aaataataaa    265920
     taaacctctc tagtgagagg ttttataaac ctgagccacc aatctaatta actctatatt    265980
     tttgttttag cttttttaaa ggtagactta ccgaataaaa cagcaattat agagcaaagg    266040
     cctggcgtta ggacaaaagc taataatgca ctgccaaaac ttgtcatttc aggcaccacg    266100
     aaccagctga taggccacgt cagggcaggt aaatttagcg gatcataaag cgcatgtaga    266160
     gcgcttaaca cacagtaaag tgctaaaaag caaactagat aaacaacgat ccacatttta    266220
     atttgctcag caatttcaaa tttaggactg cccatgcttt acctcagtgg ctgaatattg    266280
     atggttaata tctttaatca cccgtaagca cttagtgcat accttagttc gatttgtctg    266340
     cttgtccaga gtgtatttaa cttcaagttg acctccagca ttaagcaaag tgagcatctc    266400
     atcttctaac acgcttcggt aaatggtctt gtccgagagt gtgcccggta acgagtactc    266460
     aacataattg tttgaaactc ttaccgattt agggatttta ccactgagct ggatttcatt    266520
     cgttgaaggc attacagtta ctttaatcac agttgccggt gaccagaaat cctgataacg    266580
     cactttatga attttatcag ctctaaggcc taaccacaca tttccggcga taagaacaat    266640
     aagcaatcca taaactgatc gtcgaatgtt acgcctttta atcacaatgt cccccatccc    266700
     tcaaatatca ttctaaataa ctgcaccagg atatcatgag cgtaattaaa agaattcttc    266760
     ataaccgggg ttttcagttg agtttgcgga ctctttactt tgcggtttct cgccctctat    266820
     ttgagtatcc ctgacaggtt tggatttacc catgctcctc tgaaaggtat ccataacaaa    266880
     ctcaatatct tcttctggca ggctggtggg ttggttgctc ataggacttc ctcttgttga    266940
     atacgttcgg cgtacaggat gcgaaccgaa acggtcgtgt tttcaaactc gttctcaaaa    267000
     acgtccatcc attccgtccg gaattcttcc cccagaaggt tatcgagccc ctgaagagat    267060
     aatggaagaa cggctgctag agatcccccg gctgcgagat gagatgcagc tgcctggaga    267120
     tgcagcctgg cccggttatc ggcaaaaggt gggttcatca cgacataatc aaacttcttc    267180
     tgttgattag acttagacca tgtgaggaag tcagcttctg tcgtatcgta tcccttagcc    267240
     cgggagataa ggcaattcaa agtatcaagc tcgatgccag taacgatcac accggcaggg    267300
     aatgatttaa gcaaatccgc atggccaata ttaggctcca ggagggtatc cccttcccct    267360
     gcaccgagca gggaatatac atattcgctg attcggcaag atgaagggta aaactgatgc    267420
     gatacaatat caggcatctc ccctatctgg ccgatgtaac gaataacctc acacggatca    267480
     taggaaaatg tcacatcgta ttttgttact gttgccccta agaaccgaag ggtgtcagcg    267540
     gcaacactcg aagatttgcg ttcggcgaga gaccctaaag atgtccagca actccattta    267600
     ttgtccccgt catttttaaa cattagttca gaaagctgca tccgggtatc aaagtcgatg    267660
     cactgcttaa gtacagggaa tgcctccaaa gatttcttgc tatgagccat gcggtcggca    267720
     ggtaatgcca gcggtacgat agctgataaa atattgttaa gccgctcggc gatatcaggg    267780
     tggacgtcaa tatgcattga tccatttttg taaaccctga aacgaatact gttgccatcg    267840
     atgcagatcc attttctgaa cccctcatgt tcgaccaacg cctcaaccaa tgatttggtg    267900
     ttatggatcg ccttcacctg ttcgccacgg aagaatgcgc atataacgcg gagctcgctc    267960
     agtggtgaaa tgccagactc tttaaaatcc acccttaatt tctgccaggg gtatttagac    268020
     ggctcgcaaa ctccggtagt gatcatgcgg gtggagaacc caaaagcttt gtttgtctta    268080
     tgactgcggc tcagagactg gaagacgtcg taaacccttt ctttaataaa ttgattgcgg    268140
     tcattaagca aagcaacgac tgtgcctact acagcgtcag ctgtgaaatc agggatcacc    268200
     tgaggcggca taatatagcg gtcggccgta aactgcttat cccattcgtt acgtttggca    268260
     tccgacatga taggcaaaac atcagtgagt gccataacgc gtttccagta ttcagatctc    268320
     agagcgtttt ccgcgaacaa ggcatccgct tcagagatac tgtggttgta gcctgagaga    268380
     taagaataaa gtttctggtg attgtgggtt ttgaactgga cagccatgtg tttcaacaag    268440
     cagagttcat cattatagga ctcaacaaga tccgcgataa tgccgagctc tttgcgcata    268500
     tctggaagaa atgtttcaga agagctaacc accaggctat gagaggttgt taaagccagt    268560
     acgctgtgac ctgcattatc gggtttagct tcagaatcaa gagatgacat tttaccggtc    268620
     ctttagaaaa aacttttacc aggatagcaa cgtcgctctg taacctaata ggttcagtga    268680
     cacgaaaaag ttttttatgt ctctgaataa aacttaaaga tgtcaactca tagaaagaag    268740
     caaaaaaaaa gccccgcata aacggggcaa gaacgataca tggaggttta aaaaaggcgg    268800
     gcaaaaagcc tgaatcctta atgactctga caaaaccaac actttgccaa aagtaaatta    268860
     ttctgcgtcc ggctgtgggt cagtatcctg atcggtctct tcccctgcct tcttagcatt    268920
     ttttttacgt gggtattttg gcttctcacc attaagtttt gcctgacgat tctccgcacg    268980
     gcgaagctgc ttgttctctg attctgtgat ctcttttgaa agatttctca gcatctccag    269040
     agtactgcgg ttcaacgtaa tgttgatttc ttcgtcagca cttgaatctg tcatctccgg    269100
     caattcaata tcccccagtt tctgtaataa gctggtggtg atgagtttga cgccttctac    269160
     ggcttttgtg gcaataaccg gcggaatccg tgctggcttg aagtctgaag gtctgactcg    269220
     tacctgacca tgttgggttt ttttcaccgt gatgccattc gcatcggcct gctcaagttc    269280
     cgcgatcatc ttcttgatac gtgaaattgc ttctgtttca ccgagctcat cgatcagtga    269340
     aagcacgtta acatacgaaa tagcgtcagc atgaatccat ttcttgataa caacagaaca    269400
     ggttgtcagg cggataagag aactgatggt cgtcgggctt ttattttcac gttgagcaat    269460
     tcgttcgagt gaccagccag caagagaatg taggcgacga taggactcgc caagcgcaac    269520
     aggagaaagc gcaagaccac ggttaccatc aatggtcgcg agctcacagc caatttcatc    269580
     ttctttaatc tcaacgcaaa ggattgtgat gtcatgatct tcatcacatg ccatcattgc    269640
     ggcttttaaa cggcagtgcc cctggcgaac aaaaggtacc ccatcaatga cacgtactcg    269700
     gatagggtct acatagtcac ctcgaatgta ggcattcttg atgttgtaga tgtgttcttc    269760
     aacctcaggg agcttatagt aatcgtcacc cattcccatt tcgcgggagt tgaagcctgg    269820
     cgtgacctga attactgaag ggtggatagc ccatgctttc tggtcactta cttcagtaca    269880
     aagttcaggg tttgcatcac ggaactgttt aagcccagtg acgtaacgac ctgtgccagt    269940
     aactactgaa aaggcaacat gggccgtttt aaagaccttg tcattagctt gctgtgtagg    270000
     ttctgtcagt aaaacactca taggggctcc gttacatttt tctgcttact ttctgcgtag    270060
     cggggatact accgaaaaaa aaatccataa tttttcgcaa aaaaggtact ttttgagcct    270120
     attctgattt ttcacaaaaa aagagggctc cccatttctt gtgatggcat caaaatcgct    270180
     tcataaacaa agacataaat ccaaaacata aagttcaggt atcagtgagg aaaaatctta    270240
     taaatccgca atgctgaaag tcaaaactgt gcgtcttaaa caactttttt ttgctcccta    270300
     agttattagt taaagcccgt ggttaggtac gataccagca cctaaatttc tctctcaggt    270360
     atagacactt tgactcgaca tctcagacac atgccgataa tcaaatgggc tggtggaaaa    270420
     acgaaactga tgcctttcat cagccatcac tacccacacg atcatagttg ccggtgggta    270480
     gaacccttta taggcggtgg tgccgttttt ctgaacatgt ttgcacaaaa tgcattgctt    270540
     gcagatagca atccagactt gatcaaccta tacaggacta ttcaaagaca gaaaactaac    270600
     tttataaatc aggtccaaaa cctagcggat aaaacctttg tcgaaaagga ctactatgag    270660
     atgagggacc gtttcaacaa aacctgtatt tctggtcaac cgcttcaaag agcggctttg    270720
     ttttactccc tgaatcgcct gggctataac ggtatgtgcc gctataactc agaaagaatc    270780
     tattcagtgc cctgggggaa acatacagaa ctgaagcttg acttcaataa aatagactac    270840
     ctttcatttc gtctttcagg tattgaactg atcaccgctg gttttgagga gactctggcc    270900
     gcaaccggcg aaggagatca gatttattgt gatccgccat atgacaaaac aagcaaaact    270960
     agttttgtca gttacgatgg taaaccgttc agccaaagcg accacgtgct gttagcaaat    271020
     atgctcgttg acgctcacag aaaaggcgct gctgttgcga tatcaaatag cctgacacca    271080
     ttcactttgg gcctctatga agagcgtgga ttcgtcatac acagactcag cgcttaccga    271140
     tccgtaggaa gtaagccaaa tacacggaaa acggaaacag aaatactggc cgtgctgaaa    271200
     tagagttaat tctaatcaac ggggctaatc cattcctgaa aagttaatac ctcagggtga    271260
     gttcgttgaa cataaggtat aaactgaagc tcttctattc tccggtcgcc cctctttcct    271320
     tcgcaaataa atgaaatgag tccttgctga gaaagcccag taaggacgct cataagtctt    271380
     atatttagag ttttaagctg taagtcgtta ttaatgtcct ccactttatg agagctctgg    271440
     cctgaacgtt taagatactc gtaaaccatg aaattcgaat ttcgtcgttt taacaatttt    271500
     tcggttatgc attcctgaat gaaaccgcca agagcatcta aaagcggact gagaactacc    271560
     gggaaagtta atgtgtaact ttgagaagtt ttagacaaag taaatgaatt tagaaagcta    271620
     aagttaagtc tcttttttga atatggagcg taagcgacaa gagtagttga cataacagta    271680
     agtaaagctt caagatgttc cactgttatt aatgtggttt tatctgtatt tcttagatta    271740
     tggaaatcaa taaacgctac tcttgaacgg ctaagccaat cttgtacttt aatgtcgata    271800
     gaaaattgcg atatatgatt tgaacattca ttttggttga tagggcatgc agacgaaaga    271860
     tggttatgga ttatcatgca tagcacaaaa aaaggaaatc ggcaggctgt ggggcattga    271920
     aaaccggtta aagaaagctt agacgtttca tatgcgctta ccggaaaagt aacttttctt    271980
     aacgttggct ttgacgatgt tcttgcattt ttacaaatga aaccgagacc cagatcattg    272040
     tgcattttaa agtccatctc catcatcacc ttttagcctt aactgtatgg tattggtata    272100
     caaaaaatta aaaattataa ttaataagat tatcattttt ttactattga aaaggttgtg    272160
     atagagggga atttaaatgt aaaagattta tactcgcaga tctttatgag ggataaaacc    272220
     cattgcgtaa gcaacaatat tacgtgagtg agtcctaacg acagtttaag tcttggctct    272280
     atatttaagc agtaaaacat ttaactgtct tggagtttac ttaacttaaa aactgttatt    272340
     gcagcataat ttttcgaatc aaaatcatag aattttctga cttttccagt caaatgataa    272400
     cgttcaccca ataaaatgtg atcctgttta tcggccgtta aagcgatccc gtcatttcta    272460
     actttaccag taaatgtaaa aaaataactc cctttacttt ttgcgtacgc ggccctgact    272520
     tcagtaaatg ttagttcaat gcttatgacc tggccgatat tgtagctatg ttttaaaatt    272580
     tcttgttcat tttccggagt ttcagacaac atcacatcaa aggttgtaaa gaaacaatcc    272640
     agctggcgtt ctgtcaaaaa acggttattg tctagttgcg ccaatatact attagaaaac    272700
     ttagtgttag ccttttttgc tttctcaata agtacgtggt ttctggattt ccatgcttcg    272760
     agtgttgggt taacacgcag ttccggaatg ttatcgagaa aggtaattgg ctctagtacc    272820
     actaattttt caataatggg tccaactgtt tgtaccccat gacacttttc acatacatca    272880
     gcccctttgt ggcctgtgcc cgcacattcg ttacattctc tttcgatagg tgcataataa    272940
     tttccatctc cgttaaggga tacattcact gaggctggta ccatatgacc atcaagagta    273000
     aagaaaagag atttcatttt cgaaacacct ccaaacgtgc ctctacgatt gctacagctt    273060
     ctttcacagt tttttcatag tggtcatgcc cttcaggaaa ttggtcaaaa cgtttaccgt    273120
     gttctaactc ttccatgttg cgtttaagga cttcatgagt tagaagcaaa tcattataat    273180
     tatcgataag agtcagcttt ataggtttaa tcactcaact aatcctcggt tttttattcc    273240
     ttaaggagat ctcgaatttc cagaagctct tctaattttg gtttagaaag aatgattgct    273300
     gtattttcgt cgttaagtaa agacaataaa atatttagct tttcatcatt caagattatt    273360
     tgaacaccat catcagaaaa tattacattt ttactatcaa catttttgaa caagtgtgca    273420
     ctatctctac caaattttag ttctgtttga gtattcgtta tagattccgt atgtgtactt    273480
     tccacaagct caagaaattc agattttagc cgttctgttt tcttatgcga gaggcgctta    273540
     atacccaaag tcttacgtgt gactgccgaa tttttctttt ctggtccgcc tttatttaag    273600
     gtgtctggtc ctgctccagc tgcattgtgt tcaggtatgc ctacaatttt gctcgttgta    273660
     gtctcaatat tcttaacgcc aggtaagaaa ccttctatat gttttaaaac cattttgtga    273720
     tcgttggaat attttaacat tatttcaatg gcgagcgttt ttttgattag atttaggcta    273780
     atcaaacgtt gaagctctaa tggcatatca aggattttta gcatattacg aattgcggta    273840
     gttgatcgtt gatatcgcat tgctagttct tcaaccgaat acccgagact aacagcatga    273900
     gctaatgcat gagcttgccc aaccggattt agcccattgc ttctgttacc atcgaggttc    273960
     tcaaggtatt cttcaatttc gtttttataa tcgattaaga taacagataa ttttggaata    274020
     ttagcacctt cagaaattgc taattttaag ccatgaaaac gagtatgacc ttgacgaact    274080
     aaatatttac cttttctttt tacgaccttg atcatatcaa cctgccttcc ttccttaaag    274140
     gcttgtttga ttgacacaat catcgatttg acaggttctt gttcgtaaca caaatctccg    274200
     attaccgcct ctcggggatt aaatcccttt tcaatttcaa ctagattagt atccacttca    274260
     atgactgtat gtttgctgtt gttcatatct tcctcctgtt tactacatga tacatgaacc    274320
     tcaaatttgc caaatagggc tgatacatct aaaaggtaaa ctcaaaaaat ttgcttaata    274380
     aaattaaaat aaaaactgtc ttgaataaaa caatgatagt aaacccactt tcatttccgt    274440
     ttgcgatctg tagatattga taaaggagcg ctattccttg ttttatatgg acttatcatt    274500
     gttttcaaca ggttagatca attctttaga tcactaaaga tcaatagagt tcaagtaaag    274560
     atcacggcat ctttaactca ttgattatag taactttatg aaaggatccg gcattcggat    274620
     gcatgcgaaa agcatttgaa tgaataagga aggcatttac tggaatgctt atggcattta    274680
     ggtaaatgcg taaaaagcat ttgcaagaat atgttataaa cagtttgcca aatgaaaatc    274740
     ttatcaccga cgagttaagt ta                                             274762