ID JN104034; SV 1; linear; genomic RNA; STD; VRL; 302 BP. XX AC JN104034; XX DT 01-NOV-2011 (Rel. 110, Created) DT 01-NOV-2011 (Rel. 110, Last updated, Version 1) XX DE UNVERIFIED: Alfalfa mosaic virus isolate AMVF coat protein-like gene, DE partial sequence. XX KW UNVERIFIED. XX OS Alfalfa mosaic virus OC Viruses; Riboviria; Bromoviridae; Alfamovirus. XX RN [1] RP 1-302 RA Fidan H., Adak N., Surer A., Akerzurumlu E., Yilmaz M.A.; RT "Occurrence of Alfalfa Mosaic Virus (AMV) Diseases on Potato Crops in RT Northern Cyprus"; RL Unpublished. XX RN [2] RP 1-302 RA Fidan H., Adak N., Surer A., Akerzurumlu E., Yilmaz M.A.; RT ; RL Submitted (25-MAY-2011) to the INSDC. RL Plant Virology, Plant Protection Research Institute, Kisla Cad, Adana, RL Yuregir 01321, Turkey XX DR MD5; 5326fddfcad1a394190ffa731c425087. XX CC GenBank staff is unable to verify sequence and/or annotation CC provided by the submitter. XX FH Key Location/Qualifiers FH FT source 1..302 FT /organism="Alfalfa mosaic virus" FT /host="potato" FT /isolate="AMVF" FT /mol_type="genomic RNA" FT /country="Cyprus" FT /collected_by="Hakan Fidan" FT /collection_date="04-Apr-2011" FT /identified_by="Hakan Fidan" FT /PCR_primers="fwd_name: amvf, fwd_seq: FT ccatcatgagttcttcacaaaag, rev_name: amvr, rev_seq: FT tcgtcacgtcatcagtgagac" FT /db_xref="taxon:12321" FT misc_feature <1..>302 FT /note="similar to coat protein" XX SQ Sequence 302 BP; 69 A; 79 C; 76 G; 78 T; 0 other; ctaaaaaacg ttactgcaga aatatgctgc tttacgcaaa gctcatcagc cgaagcctcc 60 ggtgttgaag tcccggttgc aaaccgacga atactatact gccacagacg ggctgcgtgt 120 ggcaagcctc gggacccctc tgagtctgag ctcttttaat gggctcggcg tgagattcct 180 ctacagtttt ctgaaggatt tcgcgggacc tcggatcctc gaagaggatc tgatttacag 240 gatggtgttt tctataacac cgtcccatgc cggcaccttt tgtctcactg atgacgtgac 300 ga 302 //