
EBI Dbfetch

ID   JX966389; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   JX966389;
DT   14-JAN-2013 (Rel. 115, Created)
DT   07-APR-2013 (Rel. 116, Last updated, Version 2)
DE   Homo sapiens MHC class II antigen (HLA-DRB1) gene, HLA-DRB1*14 variant
DE   allele, partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RX   DOI; 10.1111/tan.12067.
RX   PUBMED; 23510427.
RA   Park H., Lee Y.J., Han B.Y., Song E.Y., Park M.H.;
RT   "A novel HLA-DRB1*14 allele, HLA-DRB1*14:136, identified from a registered
RT   marrow donor in Korea";
RL   Tissue Antigens 81(4):239-240(2013).
RN   [2]
RP   1-270
RA   Park M.H., Park H., Lee Y.-J., Han B.Y., Song E.Y.;
RT   ;
RL   Submitted (12-OCT-2012) to the INSDC.
RL   Department of Laboratory Medicine, Seoul National University College of
RL   Medicine, 101 Daehak-ro, Jongno-gu, Seoul 110-744, Korea
DR   MD5; 9abe434ce7c840412576a79ba1938198.
DR   IMGT/HLA; DRB1*14:136; HLA08890.
CC   ##Assembly-Data-START##
CC   Assembly Method       :: ASSIGN SBT software (Conexio Genomics,
CC                            Applecross, WA, Australia) v. v3.5.1.45
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: i1-rb11, fwd_seq:
FT                   gttttcccgcctggaccct, rev_name: i2-rb28, rev_seq:
FT                   acacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14 variant"
FT   mRNA            <1..>270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14 variant"
FT                   /product="MHC class II antigen"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14 variant"
FT                   /product="MHC class II antigen"
FT                   /db_xref="GOA:L7SW87"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:L7SW87"
FT                   /protein_id="AGC22564.1"
SQ   Sequence 270 BP; 55 A; 65 C; 98 G; 52 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcaattctt caatgggacg gagcgggtgc        60
     ggttcctgga cagatacttc cataaccagg aggagttcgt gcgcttcgac agcgacgtgg       120
     gggagtaccg ggcggtgacg gagctggggc ggcctgatgc tgagtactgg aacagccaga       180
     aggacctcct ggagcggagg cgggccctgg tggacaccta ctgcagacac aactacgggg       240
     ttgtggagag cttcacagtg cagcggcgag                                        270
