
ID   JX549436; SV 1; linear; genomic DNA; STD; HUM; 283 BP.
AC   JX549436;
DT   31-OCT-2012 (Rel. 114, Created)
DT   07-APR-2013 (Rel. 116, Last updated, Version 2)
DE   Homo sapiens MHC class II antigen (HLA-DPA1) gene, HLA-DPA1-DPA1*02 new
DE   allele, partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-283
RX   DOI; 10.1111/tan.12066.
RX   PUBMED; 23510424.
RA   He L., Xu Y., Wang D., Deng Z.;
RT   "Characterization of a novel variant allele HLA-DPA1*02:02:05, identified
RT   in a Chinese Han individual";
RL   Tissue Antigens 81(4):234-236(2013).
RN   [2]
RP   1-283
RA   He L., Xu Y.;
RT   ;
RL   Submitted (29-AUG-2012) to the INSDC.
RL   Immunogenetic Laboratory, Shenzhen Blood Center, 2# Meigang South Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; fae7dd044eed0933708a4afbb0eba60b.
DR   IMGT/HLA; DPA1*02:02:05; HLA08603.
CC   ##Assembly-Data-START##
CC   Assembly Method       :: dnastar v. 5
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1..283
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: dpa-f, fwd_seq:
FT                   tgtaaaacgacggccagtacattttgtcgtgtttttctct, rev_name: dpa-r,
FT                   rev_seq: caggaaacggctatgaccctctcatcccttccagttg"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>283
FT                   /gene="HLA-DPA1"
FT                   /allele="DPA1*02 new"
FT   mRNA            <38..>283
FT                   /gene="HLA-DPA1"
FT                   /allele="DPA1*02 new"
FT                   /product="MHC class II antigen"
FT   CDS             <38..>283
FT                   /codon_start=3
FT                   /gene="HLA-DPA1"
FT                   /allele="DPA1*02 new"
FT                   /product="MHC class II antigen"
FT                   /note="glycoprotein; human histocompatibility complex class
FT                   II; human leukocyte antigen"
FT                   /db_xref="GOA:K4PDP4"
FT                   /db_xref="InterPro:IPR001003"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:K4PDP4"
FT                   /protein_id="AFV52783.1"
SQ   Sequence 283 BP; 70 A; 61 C; 68 G; 84 T; 0 other;
     acattttgtc gtgtttttct ctactgtctt tatgcagcgg accatgtgtc aacttatgcc        60
     atgtttgtac agacccatag accaacagga gagtttatgt ttgaatttga tgaagatgag       120
     cagttctatg tggatctgga taaaaaggag accgtctggc atctggagga gtttggccga       180
     gccttttcct ttgaggctca gggcgggctg gctaacattg ctatattgaa caacaacttg       240
     aataccttga tccagcgttc caaccacact caggccgcca atg                         283