
ID   JX291163; SV 1; linear; genomic DNA; STD; HUM; 523 BP.
AC   JX291163;
DT   19-SEP-2012 (Rel. 114, Created)
DT   07-APR-2013 (Rel. 116, Last updated, Version 2)
DE   Homo sapiens MHC class II antigen (HLA-DPB1) gene, HLA-DPB1*05new allele,
DE   partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-523
RX   PUBMED; 23020589.
RA   Deng Z.H., Xu Y.P., Wang D.M.;
RT   "Characterization of the novel HLA-DPB1*140:01 allele identified by
RT   sequence-based typing";
RL   Tissue Antigens 80(6):549-551(2012).
RN   [2]
RP   1-523
RA   Xu Y., Deng Z.;
RT   ;
RL   Submitted (09-JUL-2012) to the INSDC.
RL   Immunogenetic Laboratory, Shenzhen Blood Center, 2 Meigang South Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; 30d35b54051b3073c27c965756d94f8d.
DR   IMGT/HLA; DPB1*140:01; HLA08416.
FH   Key             Location/Qualifiers
FT   source          1..523
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: dpb-f, fwd_seq:
FT                   aggaccacagaactcggtactagga, rev_name: dpb-r, rev_seq:
FT                   tgaatccccaacccaaagtcccc"
FT                   /db_xref="taxon:9606"
FT   gene            <154..>417
FT                   /gene="HLA-DPB1"
FT                   /allele="HLA-DPB1*05new"
FT   mRNA            <154..>417
FT                   /gene="HLA-DPB1"
FT                   /allele="HLA-DPB1*05new"
FT                   /product="MHC class II antigen"
FT   CDS             <154..>417
FT                   /codon_start=3
FT                   /gene="HLA-DPB1"
FT                   /allele="HLA-DPB1*05new"
FT                   /product="MHC class II antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:J9U8C4"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:J9U8C4"
FT                   /protein_id="AFR69060.1"
SQ   Sequence 523 BP; 121 A; 131 C; 189 G; 82 T; 0 other;
     tggaccacag aactcggtac taggaaaact cctactttaa aatccagccc tgggtgggaa        60
     gatttgggaa gaatcgttaa tattgagaga gagagggaga aagaggatta gatgagagtg       120
     gcgcctccgc tcatgtccgc cccctccccg cagagaatta ccttttccag ggacggcagg       180
     aatgctacgc gtttaatggg acacagcgct tcctggagag atacatctac aaccgggagg       240
     agctcgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag ctggggcggc       300
     ctgaggcgga gtactggaac agccagaagg acatcctgga ggagaagcgg gcagtgccgg       360
     acaggatgtg cagacacaac tacgagctgg acgaggccgt gaccctgcag cgcccaggtg       420
     agtgagggct ttgggccggg ggtcccaggg cagccccgcg ggcccgtgcc cagggcgcag       480
     gagcagccgg gttggcctaa gggaccttag tgccgggcgg aaa                         523