
EBI Dbfetch

ID   JX291162; SV 1; linear; genomic DNA; STD; HUM; 283 BP.
AC   JX291162;
DT   19-SEP-2012 (Rel. 114, Created)
DT   01-MAY-2014 (Rel. 120, Last updated, Version 3)
DE   Homo sapiens MHC class II antigen (HLA-DPA1) gene, HLA-DPA1*02new allele,
DE   partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-283
RX   DOI; 10.1111/tan.12187.
RX   PUBMED; 24033096.
RA   Xu Y., Deng Z., He L.;
RT   "Characterization of the novel HLA-DPA1*02:05 allele identified by
RT   sequence-based typing";
RL   Tissue Antigens 82(4):298-299(2013).
RN   [2]
RP   1-283
RA   Xu Y., Deng Z.;
RT   ;
RL   Submitted (09-JUL-2012) to the INSDC.
RL   Immunogenetic Laboratory, Shenzhen Blood Center, 2 Meigang South Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; c2c06eeaca186f39cf05fbcfdf4c6999.
DR   IMGT/HLA; DPA1*02:05; HLA08415.
FH   Key             Location/Qualifiers
FT   source          1..283
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: dpa1-f, fwd_seq:
FT                   acattttgtcgtgtttttctct, rev_name: dpa1-r, rev_seq:
FT                   ctctcatcccttccagttg"
FT                   /db_xref="taxon:9606"
FT   gene            <38..>283
FT                   /gene="HLA-DPA1"
FT                   /allele="HLA-DPA1*02new"
FT   mRNA            <38..>283
FT                   /gene="HLA-DPA1"
FT                   /allele="HLA-DPA1*02new"
FT                   /product="MHC class II antigen"
FT   CDS             <38..>283
FT                   /codon_start=3
FT                   /gene="HLA-DPA1"
FT                   /allele="HLA-DPA1*02new"
FT                   /product="MHC class II antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:J9UEA6"
FT                   /db_xref="InterPro:IPR001003"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:J9UEA6"
FT                   /protein_id="AFR69059.1"
SQ   Sequence 283 BP; 70 A; 62 C; 67 G; 84 T; 0 other;
     acattttgtc gtgtttttct ctactttctt tatgcagcgg accatgtgtc aacttatgcc        60
     atgtttgtac agacccatag accaacagga gagtttatgt ttgaatttga tgaagatgag       120
     cagttctatg tggatctgga caagaaggag accgtctggc atctggagga gtttggccga       180
     gccttttcct ttgaggctca gggcgggctg gctaacattg ctatattgaa caacaacttg       240
     aataccttga tccagcattc caaccacact caggccgcca atg                         283
