
ID   JQ965996; SV 1; linear; genomic DNA; STD; HUM; 1382 BP.
AC   JQ965996;
DT   18-JUL-2012 (Rel. 113, Created)
DT   07-APR-2013 (Rel. 116, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-B) gene, HLA-B*P150new allele,
DE   partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1382
RX   PUBMED; 23216293.
RA   Caggiari L., De Zorzi M., Izzo F., Tornesello M.L., Buonaguro F.M.,
RA   De Re V.;
RT   "Identification and sequence analysis of a novel human leukocyte antigen
RT   allele B*51:141";
RL   Tissue Antigens 81(1):55-56(2013).
RN   [2]
RP   1-1382
RA   Caggiari L., De Zorzi M., De Re V., Tornesello M.L., Buonaguro F.;
RT   ;
RL   Submitted (23-APR-2012) to the INSDC.
RL   DOMERT, Dipartimento di Oncologia Molecolare e Ricerca Traslazionale, CRO,
RL   Centro di Riferimento Oncologico, IRCCS, National Cancer Institute, Franco
RL   Gallini, 2, Aviano 33081, Italy
DR   MD5; 03612aee28890a4035ed5de99e54c871.
DR   IMGT/HLA; B*51:141; HLA08391.
FH   Key             Location/Qualifiers
FT   source          1..1382
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /isolation_source="72 year old with HCV-related HCC and
FT                   cirrhosis"
FT                   /sex="male"
FT                   /PCR_primers="fwd_name: lh5ut, fwd_seq:
FT                   ggactcagaatctccccagacgccgag, rev_name: rh3utb, rev_seq:
FT                   ctggggaggaaacacaggtcagcatgggaac"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>1382
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*P150new"
FT   mRNA            join(<1..43,144..413,514..789,890..1165,1266..>1382)
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*P150new"
FT                   /product="MHC class I antigen"
FT   CDS             join(<1..43,144..413,514..789,890..1165,1266..>1382)
FT                   /codon_start=1
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*P150new"
FT                   /product="MHC class I antigen"
FT                   /db_xref="GOA:I6YW07"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:I6YW07"
FT                   /protein_id="AFN61267.1"
FT   gap             44..143
FT                   /estimated_length=unknown
FT   gap             414..513
FT                   /estimated_length=unknown
FT   gap             790..889
FT                   /estimated_length=unknown
FT   gap             1166..1265
FT                   /estimated_length=unknown
SQ   Sequence 1382 BP; 205 A; 301 C; 322 G; 154 T; 400 other;
     ctgctgctct ggggggcagt ggccctgacc gagacctggg ccgnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnngctccca ctccatgagg tatttctaca ccgccatgtc       180
     ccggcccggc cgcggggagc cccgcttcat tgcagtgggc tacgtggact acacccagtt       240
     cgtgaggttc gacagcgacg ccgcgagtcc gaggacggag ccccgggcgc catggataga       300
     gcaggagggg ccggagtatt gggaccggaa cacacagatc ttcaagacca acacacagac       360
     ttaccgagag aacctgcgga tcgcgctccg ctactacaac cagagcgagg ccgnnnnnnn       420
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       480
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnggtctca cacttggcag acgatgtatg       540
     gctgcgacgt ggggccggac gggcgcctcc tccgcgggca taaccagtac gcctacgacg       600
     gcaaagatta catcgccctg aacgaggacc tgagctcctg gaccgcggcg gacaccgcgg       660
     ctcagatcac ccagcgcaag tgggaggcgg cccgtgtggc ggagcaggac agagcctacc       720
     tggagggcct gtgcgtggag tggctccgca gacacctgga gaacgggaag gagacgctgc       780
     agcgcgcggn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       840
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnna ccccccaaag       900
     acacacgtga cccaccaccc cgtctctgac catgaggcca ccctgaggtg ctgggccctg       960
     ggcttctacc ctgcggagat cacactgacc tggcagcggg atggcgagga ccaaactcag      1020
     gacactgagc ttgtggagac cagaccagca ggagatagaa ccttccagaa gtgggcagct      1080
     gtggtggtgc cttctggaga agagcagaga tacacatgcc atgtacagca tgaggggctg      1140
     ccgaagcccc tcaccctgag atgggnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn      1200
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn      1260
     nnnnnagcca tcttcccagt ccaccatccc catcgtgggc attgttgctg gcctggctgt      1320
     cctagcagtt gtggtcatcg gagctgtggt cgctactgtg atgtgtagga ggaagagctc      1380
     ag                                                                     1382