
EBI Dbfetch

ID   HQ399496; SV 1; linear; genomic DNA; STD; HUM; 1858 BP.
AC   HQ399496;
DT   20-APR-2011 (Rel. 108, Created)
DT   24-OCT-2011 (Rel. 110, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-C) gene, HLA-C*01 variant allele,
DE   partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1858
RX   DOI; 10.1111/j.1399-0039.2011.01654.x.
RX   PUBMED; 21501119.
RA   Wang D.M., Xu Y.P., Deng Z.H.;
RT   "Identification of a novel HLA-C*01 variant allele, C*01:46";
RL   Tissue Antigens 78(1):70-71(2011).
RN   [2]
RP   1-1858
RA   Deng Z.;
RT   ;
RL   Submitted (12-OCT-2010) to the INSDC.
RL   Immunogenetics Laboratory, Shenzhen Blood Center, Nigang Xi Road, Meigang
RL   Nan Street, Shenzhen, Guangdong 518035, China
DR   MD5; 9cf3f6ad7a51c5134678d82bc82ea32a.
FH   Key             Location/Qualifiers
FT   source          1..1858
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.31"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: ccaatcagcgtctccgcagtc, rev_seq:
FT                   accccycatycccctccttac"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>1858
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*01 variant"
FT   mRNA            join(<1..73,204..473,720..995,1583..>1858)
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*01 variant"
FT                   /product="MHC class I antigen"
FT   CDS             join(1..73,204..473,720..995,1583..>1858)
FT                   /codon_start=1
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*01 variant"
FT                   /product="MHC class I antigen"
FT                   /db_xref="GOA:F5A4J4"
FT                   /db_xref="IMGT/HLA:C*01:46"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:F5A4J4"
FT                   /protein_id="AEB71530.1"
FT                   TCHVQHEGLPEPLTLRW"
SQ   Sequence 1858 BP; 350 A; 569 C; 611 G; 328 T; 0 other;
     atgcgggtca tggcgccccg aaccctcatc ctgctgctct cgggagccct ggccctgacc        60
     gagacctggg cctgtgagtg cggggttggg agggaaacgg cctctgcgga gaggaacgag       120
     gtgcccgccc ggcgagggcg caggacccgg ggagccgcgc agggaggagg gtcgggcggg       180
     tctcagcccc tcctcgcccc caggctccca ctccatgaag tatttcttca catccgtgtc       240
     ccggcctggc cgcggagagc cccgcttcat ctcagtgggc tacgtggacg acacgcagtt       300
     cgtgcggttc gacagcgacg ccgcgagtcc gagaggggag ccgcgggcgc cgtgggtgga       360
     gcaggagggg ccggagtatt gggaccggga gacacagaag tacaagcgcc aggcacagac       420
     tgaccgagtg agcctgcgga acctgtgcgg ctactacaac cagagcgagg ccggtgagtg       480
     accccggccc ggggcgcagg tcacgacccc tcctcatccc ccacggacgg cccgggtcgc       540
     cccaagtctc ccggtctgag atccaccccg aggctgcgga acccgcccag accctcgacc       600
     ggagagagcc ccagtcacct ttacccggtt tcattttcag tttaggccaa aatccccgcg       660
     ggttggtcgg gactggggcg gggctcgggg gacggggctg accacggggg cggggccagg       720
     gtctcacacc ctccagtgga tgtgtggctg cgacctgggg cccgacgggc gcctcctccg       780
     cgggtatgac cagtacgcct acgacggcaa ggattacatc gccctgaacg aggacctgcg       840
     ctcctggacc gccgcggaca ccgcggctca gatcacccag cgcaagtggg aggcggcccg       900
     tgaggcggag cagcggagag cctacctgga gggcacgtgc gtggagtggc tccgcagata       960
     cctggagaac gggaaggaga cgctgcagcg cgcgggtacc aggggcagtg gggagccttc      1020
     cccatctccc gtagatctcc cggcatggcc tcccacgagg aggggaggaa aatgggatca      1080
     gcgctagaat atcgccctcc cttgaatgga gaatgggatg agttttcctg agtttcctct      1140
     gagggccccc tctgctctct aggacaatta agggatgaag tccttgagga aatggagggg      1200
     aagacagtcc ctggaatact gatcaggggt cccctttgac cactttgacc actgcagcag      1260
     ctgtggtcag gctgctgacc tttctctcag gccttgttct ctgcctcacg ctcaatgtgt      1320
     ttgaaggttt gattccagct tttctgagtc cttcggcctc cactcaggtc aggaccagaa      1380
     gtcgctgttc ctccctcaga gactagaact ttccaatgaa taggagatta tcccaggtgc      1440
     ctgtgtccag gctggcgtct gggttctgtg cccccttccc caccccaggt gtcctgtcca      1500
     ttctcaggat ggtcacatgg gcgctgttgg agtgtcgcaa gagagataca aagtgtctga      1560
     attttctgac tcttcccgtc agaacaccca aagacacacg tgacccacca tcccgtctct      1620
     gaccatgagg ccaccctgag gtgctgggcc ctgggcttct accctgcgga gatcacactg      1680
     acctggcagt gggatgggga ggaccaaact caggacaccg agcttgtgga gaccaggcca      1740
     gcaggagatg gaaccttcca gaagtgggca gctgtgatgg tgccttctgg agaagagcag      1800
     agatacacgt gccatgtgca gcacgagggg ctgccggagc ccctcaccct gagatggg        1858
