
ID   HM627215; SV 1; linear; mRNA; STD; HUM; 801 BP.
AC   HM627215;
DT   27-AUG-2010 (Rel. 105, Created)
DT   24-OCT-2011 (Rel. 110, Last updated, Version 2)
DE   Homo sapiens MHC class II antigen (HLA-DR) mRNA, HLA-DR*08 variant allele,
DE   complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-801
RX   DOI; 10.1111/j.1399-0039.2011.01698.x.
RX   PUBMED; 21623731.
RA   Sun L.J., Hu J., Tan T., Guo H., Gao J.W.;
RT   "Identification of a novel allele HLA-DRB1*08:41 in a Chinese donor";
RL   Tissue Antigens 78(4):294-295(2011).
RN   [2]
RP   1-801
RA   Sun L., Tan T., Guo H., Hu J.;
RT   ;
RL   Submitted (05-JUL-2010) to the INSDC.
RL   Central Laboratory, Shaanxi Provincial People's Hospital, West Youyi Road
RL   256#, Xian, Shaanxi 710068, China
DR   MD5; 08ab8483e11ada19eb3dc9cc74715b00.
DR   H-InvDB; HIT000650050_02.2.
DR   H-InvDB; HIT000650050_03.2.
FH   Key             Location/Qualifiers
FT   source          1..801
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p31-p21"
FT                   /mol_type="mRNA"
FT                   /PCR_primers="fwd_seq: ttctccagcatggtgtgtctg, rev_seq:
FT                   gtggtcatctgcatttcagctc"
FT                   /db_xref="taxon:9606"
FT   gene            1..801
FT                   /gene="HLA-DR"
FT                   /allele="HLA-DR*08 variant"
FT   CDS             1..801
FT                   /codon_start=1
FT                   /gene="HLA-DR"
FT                   /allele="HLA-DR*08 variant"
FT                   /product="MHC class II antigen"
FT                   /db_xref="GOA:E1ACV6"
FT                   /db_xref="H-InvDB:HIT000650050_01.2"
FT                   /db_xref="IMGT/HLA:DRB1*08:41"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="UniProtKB/TrEMBL:E1ACV6"
FT                   /protein_id="ADM15723.1"
SQ   Sequence 801 BP; 172 A; 200 C; 259 G; 170 T; 0 other;
     atggtgtgtc tgaggctccc tggaggctcc tgcatggcag ttctgacagt gacactgatg        60
     gtgctgagct ccccactggc tttggctggg gacaccagac cacgtttctt ggagtactct       120
     acgggtgagt gttatttctt caatgggacg gagcgggtgc ggttcctgga cagatacttc       180
     tataaccaag aggagtacgt gcgcttcgac agcgacgtgg gggagtaccg ggcggtgacg       240
     gagctggggc ggcctgatga ggagtactgg aacagccaga aggacttcct ggaagacagg       300
     cgggccgcgg tggacaccta ctgcagacac aactacgggg ttggtgagag cttcacagtg       360
     cagcggcgag tccatcctaa ggtgactgtg tatccttcaa agacccagcc cctgcagcac       420
     cacaacctcc tggtctgttc tgtgagtggt ttctatccag gcagcattga agtcaggtgg       480
     ttccggaatg gccaggaaga gaagactggg gtggtgtcca caggcctgat ccacaatgga       540
     gactggacct tccagaccct ggtgatgctg gaaacagttc ctcggagtgg agaggtttac       600
     acctgccaag tggagcaccc aagcgtgaca agccctctca cagtggaatg gagtgcacgg       660
     tccgaatctg cacagagcaa gatgctgagt ggagtcgggg gctttgtgct gggcctgctc       720
     ttccttgggg ccgggctgtt catctacttc aggaatcaga aaggacactc tggactccag       780
     ccaacaggat tcctgagctg a                                                 801