
ID   HM245348; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   HM245348;
DT   22-SEP-2010 (Rel. 106, Created)
DT   22-SEP-2010 (Rel. 106, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-A) gene, HLA-A*02new allele, exons 2
DE   through 4 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Jin S.-Z., Gao S.Q., Zou H.Y.;
RT   "Identification of a novel allele HLA-A*02 by sequence-based typing in the
RT   Chinese population";
RL   Unpublished.
RN   [2]
RP   1-1022
RA   Jin S.-Z., Gao S.Q., Zou H.Y.;
RT   ;
RL   Submitted (19-MAY-2010) to the INSDC.
RL   Shenzhen Institute of Transfusion Medicine, ShenZhen Blood Center, Nigang
RL   West Road, Meigang South Street, Futian District, Shenzhen, Guangdong
RL   518035, China
DR   MD5; 3611bf74b5f1483703b255a9bcc6f9f8.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: cgccagggttttcccagtcacgac, rev_seq:
FT                   gagcggataacaatttcacacagg"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>1022
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT   mRNA            join(<1..270,371..646,747..>1022)
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /product="MHC class I antigen"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /product="MHC class I antigen"
FT                   /db_xref="IMGT/HLA:A*02:251"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:E2GD50"
FT                   /protein_id="ADN33665.1"
FT   exon            <1..270
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /number=3
FT   variation       383
FT                   /gene="HLA-A"
FT                   /replace="c"
FT                   /note="compared to allele A*02:01:01:01"
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..>1022
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /number=4
SQ   Sequence 1022 BP; 171 A; 245 C; 281 G; 125 T; 200 other;
     gctctcactc catgaggtat ttcttcacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggagggtccg gagtattggg       180
     acggggagac acggaaagtg aaggcccact cacagactca ccgagtggac ctggggaccc       240
     tgcgcggcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn gttctcacac cgtccagagg atgtatggct gcgacgtggg gtcggactgg       420
     cgcttcctcc gcgggtacca ccagtacgcc tacgacggca aggattacat cgccctgaaa       480
     gacgacctgc gctcttggac cgcggcggac atggcagctc agaccaccaa gcacaagtgg       540
     gaggcggccc atgtggcgga gcagttgaga gcctacctgg agggcacgtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcacggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnacgc ccccaaaacg catatgactc accacgctgt       780
     ctctgaccat gaagccaccc tgaggtgctg ggccctgagc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gggaggacca gacccaggac acggagctcg tggagaccag       900
     gcctgcaggg gatggaacct tccagaagtg ggcggctgtg gtggtgcctt ctggacagga       960
     gcagagatac acctgccatg tgcagcatga gggtttgccc aagcccctca ccctgagatg      1020
     gg                                                                     1022