
ID   HM131491; SV 2; linear; genomic DNA; STD; HUM; 1022 BP.
AC   HM131491;
DT   28-JUN-2010 (Rel. 105, Created)
DT   29-JUN-2010 (Rel. 105, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-A) pseudogene, HLA-A*11 variant
DE   allele, partial sequence.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Gao S.Q., Jing S.Z., Zhou H.Y., Xu Y.P., Deng Z.H.;
RT   "Identification of a novel allele HLA-A*11 by sequence-based typing in the
RT   Chinese population";
RL   Unpublished.
RN   [2]
RP   1-1022
RA   Gao S.Q., Jing S.Z., Zhou H.Y., Xu Y.P., Deng Z.H.;
RT   ;
RL   Submitted (18-APR-2010) to the INSDC.
RL   Shenzhen Institute of Transfusion Medicine, Shenzhen Blood Center, Nigang
RL   West Road, Meigang South Street, Futian District, Shenzhen, Guangdong
RL   518035, China
RN   [3]
RC   Sequence update by submitter
RP   1-1022
RA   Gao S.Q., Jing S.Z., Zhou H.Y., Xu Y.P., Deng Z.H.;
RT   ;
RL   Submitted (28-JUN-2010) to the INSDC.
RL   Shenzhen Institute of Transfusion Medicine, Shenzhen Blood Center, Nigang
RL   West Road, Meigang South Street, Futian District, Shenzhen, Guangdong
RL   518035, China
DR   MD5; 07a3c3a0655e553da23ac8efa2b8b894.
DR   IMGT/HLA; A*01:56N; HLA05224.
CC   On Jun 28, 2010 this sequence version replaced gi:299149727.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: cgccagggttttcccagtcacgac, rev_seq:
FT                   gagcggataacaatttcacacagg"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>1022
FT                   /pseudo
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*11 variant"
FT                   /note="MHC class I antigen"
FT   gap             271..370
FT                   /estimated_length=unknown
FT   gap             647..746
FT                   /estimated_length=unknown
FT   variation       850
FT                   /gene="HLA-A"
FT                   /replace="g"
FT                   /note="results in a stop codon to tryptophan substitution"
SQ   Sequence 1022 BP; 170 A; 251 C; 285 G; 116 T; 200 other;
     gctcccactc catgaggtat ttctacacct ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     accaggagac acggaatgtg aaggcccagt cacagactga ccgagtggac ctggggaccc       240
     tgcgcggcta ctacaaccag agcgaggacg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn gttctcacac catccagata atgtatggct gcgacgtggg gccggacggg       420
     cgcttcctcc gcgggtaccg gcaggacgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctgc gctcttggac cgcggcggac atggcagctc agatcaccaa gcgcaagtgg       540
     gaggcggccc atgcggcgga gcagcagaga gcctacctgg agggccggtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcacggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaccc ccccaagaca catatgaccc accaccccat       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac       840
     actgacctga cagcgggatg gggaggacca gacccaggac acggagctcg tggagaccag       900
     gcctgcaggg gatggaacct tccagaagtg ggcggctgtg gtggtgcctt ctggagagga       960
     gcagagatac acctgccatg tgcagcatga gggtctgccc aagcccctca ccctgagatg      1020
     gg                                                                     1022