
ID   HF545604; SV 1; linear; genomic DNA; STD; HUM; 1021 BP.
AC   HF545604;
DT   26-OCT-2012 (Rel. 114, Created)
DT   26-OCT-2012 (Rel. 114, Last updated, Version 1)
DE   Homo sapiens partial HLA-A gene for MHC class I antigen, allele
DE   HLA-A*32null, exon 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1021
RA   Masson D.M.;
RT   ;
RL   Submitted (17-OCT-2012) to the INSDC.
RL   Masson D.M., HLA Laboratory, EFS Rhone Alpes, BP35, 38701, FRANCE.
RN   [2]
RX   DOI; https://doi.org/10.1111/tan.13056.
RX   PUBMED; 28508589.
RA   Proust B., Masson D., Proust B.P., Baudron M., Dehaut F.;
RT   "Identification of a novel HLA allele, HLA-B*41:50, in a French
RT   individual";
RL   HLA. 0:0-0(2017).
DR   MD5; c2dff5cd1f627e4804556dbed6da1fc8.
DR   IMGT/HLA; A*32:56N; HLA08906.
FH   Key             Location/Qualifiers
FT   source          1..1021
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: LeuT11, fwd_seq:
FT                   aaccctcctcctgctactctt, rev_name: P3'IN6A, rev_seq:
FT                   gcccacagaasatgtggctag"
FT                   /db_xref="taxon:9606"
FT   mRNA            <1..200
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*32null"
FT   CDS             <1..200
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*32null"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:K4UF89"
FT                   /protein_id="CCO01526.1"
FT   exon            <1..200
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*32null"
FT                   /number=2
SQ   Sequence 1021 BP; 164 A; 247 C; 285 G; 125 T; 200 other;
     gctcccactc catgaggtat ttcttcacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggtttgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagcg gaggggccgg agtattggga       180
     ccaggagaca cggaatgtga aggcccactc acagactgac cgagagagcc tgcggatcgc       240
     gctccgctac tacaaccaga gcgaggccgn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnng ttctcacacc atccagatga tgtatggctg cgacgtgggg ccggacgggc       420
     gcctcctccg cgggtaccag caggacgcct acgacggcaa ggattacatc gccttgaacg       480
     aggacctgcg ctcttggacc gcggcggaca tggcggctca gatcacccag cgcaagtggg       540
     aggcggcccg tgtggcggag cagttgagag cctacctgga gggcacgtgc gtggagtggc       600
     tccgcagata cctggagaac gggaaggaga cgctgcagcg cacggnnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnacgcc cccaagacgc atatgactca ccacgctgtc       780
     tctgaccatg aggccaccct gaggtgctgg gccctgagct tctaccctgc ggagatcaca       840
     ctgacctggc agcgggatgg ggaggaccag acccaggaca cggagcttgt ggagaccagg       900
     cctgcagggg atggaacctt ccagaagtgg gcgtctgtgg tggtgccttc tggacaggag       960
     cagagataca cctgccatgt gcagcatgag ggtctgccca agcccctcac cctgagatgg      1020
     g                                                                      1021