
ID   HF545603; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   HF545603;
DT   26-OCT-2012 (Rel. 114, Created)
DT   26-OCT-2012 (Rel. 114, Last updated, Version 1)
DE   Homo sapiens partial HLA-DRB1 gene for MHC class II antigen, allele
DE   HLA-DRB1*16:01, exon 2
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Masson D.M.;
RT   ;
RL   Submitted (17-OCT-2012) to the INSDC.
RL   Masson D.M., HLA Laboratory, EFS Rhone Alpes, BP35, 38701, FRANCE.
RN   [2]
RA   Masson D.;
RT   "x";
RL   Unpublished.
DR   MD5; 216834d1201ce00bd47d91c2c93c3aab.
DR   IMGT/HLA; DRB1*16:01:03; HLA08904.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: 1RB3, fwd_seq: ggtgggtgctgttgaaggt,
FT                   rev_name: 2RB28, rev_seq: acacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /transl_table=1
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*16:01"
FT                   /product="MHC class II antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:K4ULZ0"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:K4ULZ0"
FT                   /protein_id="CCO01525.1"
FT   exon            <1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*16:01"
FT                   /number=2
SQ   Sequence 270 BP; 57 A; 65 C; 100 G; 48 T; 0 other;
     cacgtttcct gtggcagcct aagagggagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga cagatacttc tataaccagg aggagtcggt gcgcttcgac agcgacgtgg       120
     gggagtaccg ggcggtgacg gagctggggc ggcctgacgc tgagtactgg aacagccaga       180
     aggacttcct ggaagacagg cgcgccgcgg tggacaccta ctgcagacac aactacgggg       240
     ttggtgagag cttcacagtg cagcggcgag                                        270