Dbfetch

ID   HE974905; SV 1; linear; genomic DNA; STD; HUM; 268 BP.
XX
AC   HE974905;
XX
DT   13-AUG-2012 (Rel. 113, Created)
DT   13-AUG-2012 (Rel. 113, Last updated, Version 1)
XX
DE   Homo sapiens partial HLA-DRB1 pseudogene, allele HLA-DRB1*15, exon 2
XX
KW   .
XX
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
XX
RN   [1]
RP   1-268
RA   Masson D.M.;
RT   ;
RL   Submitted (04-AUG-2012) to the INSDC.
RL   Masson D.M., EFS Rhone Alpes, HLA Laboratory, BP35, 38701, FRANCE.
XX
RN   [2]
RA   Masson D.;
RT   ;
RL   Unpublished.
XX
DR   MD5; 297eb211f40472babc743c981f752550.
DR   IMGT/HLA; DRB1*15:80N; HLA08583.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..268
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: 1RB3, fwd_seq: ggtgggtgctgttgaaggt,
FT                   rev_name: 2RB28, rev_seq: acacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   exon            1..268
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*15"
FT                   /number=2
FT                   /pseudogene="unitary"
FT   CDS             <1..>268
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*15"
FT                   /db_xref="PSEUDO:CCK33879.1"
FT                   /db_xref="GOA:J7QWX7"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:J7QWX7"
FT                   /pseudogene="unitary"
XX
SQ   Sequence 268 BP; 55 A; 66 C; 99 G; 48 T; 0 other;
     cacgtttcct gtggcagcct aagagggagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga cagatacttc tataaccagg aggagtccgt gcgcttcgac agcgacgtgg       120
     gggagttccg ggcggtgacg gagctggggc ggcctgacgc tgagtactgg aacagccaga       180
     aggacatcct ggagcaggcg cgccgcggtg gacacctact gcagacacaa ctacggggtt       240
     ggtgagagct tcacagtgca gcggcgag                                          268
//