
ID   HE974341; SV 1; linear; genomic DNA; STD; HUM; 1381 BP.
AC   HE974341;
DT   06-AUG-2012 (Rel. 113, Created)
DT   06-AUG-2012 (Rel. 113, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, allele
DE   HLA-B*08new, exons 1-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1381
RA   Tourne S.;
RT   ;
RL   Submitted (31-JUL-2012) to the INSDC.
RL   Tourne S., EFS Alsace, Laboratoire d histocompatibilite, 10 rue Spielmann,
RL   67065 Strasbourg Cedex, FRANCE.
RN   [2]
RA   Froelich N., Schell A., Weschler B., Leisenbach R., Mariotte A., Bert S.,
RA   Hanau D., Tourne S.;
RT   "The new HLA-B*08 allele has a nucleotide change from HLA-B*49:01:01 (a G
RT   to A ) at position 36 (exon 1), which is silent.";
RL   Unpublished.
DR   MD5; 312a22099ad49a4f03ffd5eee172a87a.
DR   IMGT/HLA; B*08:01:20; HLA08776.
FH   Key             Location/Qualifiers
FT   source          1..1381
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: BCUP-378, fwd_seq:
FT                   caggaaacagctatgaccccaggaggagaagtgaagggg, rev_name: Exon 5B,
FT                   rev_seq: gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   exon            1..85
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=1
FT   CDS             join(13..85,214..483,677..952,1082..>1357)
FT                   /codon_start=1
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:I7JHQ8"
FT                   /protein_id="CCK33656.1"
FT                   TCHVQHEGLPKPLTLRW"
FT   intron          86..213
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=1
FT   exon            214..483
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=2
FT   intron          484..676
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=2
FT   gap             550..649
FT                   /estimated_length=unknown
FT   exon            677..952
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=3
FT   intron          953..1081
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=3
FT   gap             965..1064
FT                   /estimated_length=unknown
FT   exon            1082..1357
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=4
FT   intron          1358..>1381
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=4
SQ   Sequence 1381 BP; 233 A; 378 C; 417 G; 153 T; 200 other;
     tcagacgccg agatgctggt catggcgccc cgaaccgtcc tcctgctact ctcggcggcc        60
     ctggccctga ccgagacctg ggccggtgag tgcgggtcgg gagggaaatg gcctctgccg       120
     ggaggagcga ggggaccgca ggcgggggcg caggacctga ggagccgcgc cgggaggagg       180
     gtcgggcggg tctcagcccc tcctcgcccc caggctccca ctccatgagg tatttcgaca       240
     ccgccatgtc ccggcccggc cgcggggagc cccgcttcat ctcagtgggc tacgtggacg       300
     acacgcagtt cgtgaggttc gacagcgacg ccgcgagtcc gagagaggag ccgcgggcgc       360
     cgtggataga gcaggagggg ccggagtatt gggaccggaa cacacagatc ttcaagacca       420
     acacacagac tgaccgagag agcctgcgga acctgcgcgg ctactacaac cagagcgagg       480
     ccggtgagtg accccggccc ggggcgcagg tcacgactcc ccatccccca cggacggccc       540
     gggtcgcccn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       600
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnc ggggctgacc       660
     gcggggccgg ggccagggtc tcacaccctc cagagcatgt acggctgcga cgtggggccg       720
     gacgggcgcc tcctccgcgg gcataaccag tacgcctacg acggcaagga ttacatcgcc       780
     ctgaacgagg acctgcgctc ctggaccgcg gcggacaccg cggctcagat cacccagcgc       840
     aagtgggagg cggcccgtgt ggcggagcag gacagagcct acctggaggg cacgtgcgtg       900
     gagtggctcc gcagatacct ggagaacggg aaggacacgc tggagcgcgc gggtaccagg       960
     ggcannnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn      1020
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnctgact cttcccatca      1080
     gaccccccaa agacacacgt gacccaccac cccatctctg accatgaggc caccctgagg      1140
     tgctgggccc tgggcttcta ccctgcggag atcacactga cctggcagcg ggatggcgag      1200
     gaccaaactc aggacactga gcttgtggag accagaccag caggagatag aaccttccag      1260
     aagtgggcag ctgtggtggt gccttctgga gaagagcaga gatacacatg ccatgtacag      1320
     catgaggggc tgccgaagcc cctcaccctg agatggggta aggaggggga tgaggggtca      1380
     t                                                                      1381