
ID   HE967305; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   HE967305;
DT   24-JUL-2012 (Rel. 113, Created)
DT   24-JUL-2012 (Rel. 113, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, allele HLA-B*40,
DE   exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Masson D.M.;
RT   ;
RL   Submitted (22-JUL-2012) to the INSDC.
RL   Masson D.M., HLA Laboratory, EFS Rhone Alpes, BP35, F-38701, FRANCE.
RN   [2]
RX   DOI; https://doi.org/10.1111/tan.13056.
RX   PUBMED; 28508589.
RA   Proust B., Masson D., Proust B.P., Baudron M., Dehaut F.;
RT   "Identification of a novel HLA allele, HLA-B*41:50, in a French
RT   individual";
RL   HLA. 0:0-0(2017).
DR   MD5; fb364a9cad221c6de37e667cc7cd5006.
DR   IMGT/HLA; B*40:01:27; HLA08439.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: AlaG-20.2, fwd_seq:
FT                   gaggatgcgggtcatggcg, rev_name: PExon5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:I7L1P5"
FT                   /protein_id="CCJ65510.1"
FT   exon            <1..270
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..1022
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40"
FT                   /number=4
SQ   Sequence 1022 BP; 181 A; 254 C; 272 G; 115 T; 200 other;
     gctcccactc catgaggtat ttccacaccg ccatgtcccg gcccggccgc ggggagcccc        60
     gcttcatcac cgtgggctac gtggacgaca cgctgttcgt gaggttcgac agcgacgcca       120
     cgagtccgag gaaggagccg cgggcgccat ggatagagca ggaggggccg gagtattggg       180
     accgggagac acagatctcc aagaccaaca cacagactta ccgagagagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggcgg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagagg atgtacggct gcgacgtggg gccggacggg       420
     cgcctcctcc gcgggcataa ccagtacgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctgc gctcctggac cgccgcggac acggcggctc agatctccca gcgcaagttg       540
     gaggcggccc gtgtggcgga gcagctgaga gcctacctgg agggcgagtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggac aagctggagc gcgctgnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaccc cccaaagaca cacgtgaccc accaccccat       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggt ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gcgaggacca aactcaggac actgagcttg tggagaccag       900
     accagcagga gatagaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagaaga       960
     gcagagatac acatgccatg tacagcatga ggggctgccg aagcccctca ccctgagatg      1020
     gg                                                                     1022