
ID   GU376471; SV 1; linear; genomic DNA; STD; HUM; 4350 BP.
AC   GU376471;
DT   23-FEB-2010 (Rel. 103, Created)
DT   12-DEC-2012 (Rel. 115, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw*070206 allele,
DE   promoter region and complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-4350
RX   DOI; 10.1016/j.humimm.2010.03.001.
RX   PUBMED; 20226825.
RA   Deng Z., Wang D., Xu Y., Gao S., Zhou H., Yu Q., Yang B.;
RT   "HLA-C polymorphisms and PCR dropout in exons 2 and 3 of the Cw*0706 allele
RT   in sequence-based typing for unrelated Chinese marrow donors";
RL   Hum. Immunol. 71(6):577-581(2010).
RN   [2]
RP   1-4350
RA   Xu Y.P., Deng Z.H., Yang B.C.;
RT   ;
RL   Submitted (02-JAN-2010) to the INSDC.
RL   Immunogenetic Laboratory, Shenzhen Blood Center, 2 Meigang West Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; a0832da773c46de7b81d4520b52b1fa2.
DR   Ensembl-Gn; ENSG00000204525; homo_sapiens.
DR   Ensembl-Tr; ENST00000376228; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..4350
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: tggactcacacarggaaactc, rev_seq:
FT                   gggacaaggacaatggagcag"
FT                   /db_xref="taxon:9606"
FT   gene            <1..4350
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070206"
FT   regulatory      <1..6
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070206"
FT                   /regulatory_class="promoter"
FT   mRNA            join(7..937,1068..1337,1588..1863,2451..2726,2851..2970,
FT                   3411..3443,3551..3598,3763..4350)
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070206"
FT                   /product="MHC class I antigen"
FT   5'UTR           7..864
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070206"
FT   CDS             join(865..937,1068..1337,1588..1863,2451..2726,2851..2970,
FT                   3411..3443,3551..3598,3763..3767)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070206"
FT                   /product="MHC class I antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:Q6R739"
FT                   /db_xref="IMGT/HLA:C*07:02:06"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR010579"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:Q6R739"
FT                   /protein_id="ADC79687.1"
FT   3'UTR           3768..4350
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070206"
SQ   Sequence 4350 BP; 878 A; 1198 C; 1304 G; 970 T; 0 other;
     tggctagaga atgaggataa ctttaaatgc aacaacccag agtcacagaa ccatagtctg        60
     cgaaagtaaa acaggagctt tgagaattta attgtaatgc agttttgaca caggtctttc       120
     acagattgga attctaatca ttcagggatt accaatattg tgctacctac tgtatcaata       180
     aacaaaaagg aaactggtct ctatgagaat ctctacctgg tgctttcaga caaaacttca       240
     ccaggtttaa agagaaaact cctgactcta cacgtccatt cccagggcga gctcactgtc       300
     tggcatcaag ttccccatgg tgagtttccc tgtacaagag tccaagggga gaggtaagtt       360
     tcctttattt tgctggatgt agtttaatat tacctgaggt gaggtaaggt aaggcaaagg       420
     gtgggaggca gggagtccag ttcagggacg gggattccag gaggagaagt gaaggggaag       480
     gggctgggcg cagccttggg gtctctccct ggtttccaca gacagatcct tgtccaggac       540
     tcaggcacac agtgtgacaa agatgcttgg tgtaggagaa gagggatcag gacgaagtcc       600
     caggtcccgg gcggggctct cagggtctca ggctccaagg gccgtgtctg cattggggag       660
     gcgccgcgtt ggggattctc cactcccctg agtttcactt ctcccaacct gcgtcgggtc       720
     cttcttcctg aatactcatg acgcgtcccc aattcccact cccattgggt gtcgggttct       780
     agagaagcca atcagcgtct ccgcagtccc ggttctaaag tccccagtca cccacccgga       840
     ctcacattct ccccagaggc cgagatgcgg gtcatggcgc cccgagccct cctcctgctg       900
     ctctcgggag gcctggccct gaccgagacc tgggcctgtg agtgcggggt tgggagggaa       960
     gcggcctctg cggagaggag cgaggggccc tcccggcgag ggcgcaggac ccggggagcc      1020
     gcgcagggag gtgggtcggg cgggtctcag cccctcctcg cccccaggct cccactccat      1080
     gaggtatttc gacaccgccg tgtcccggcc cggccgcgga gagccccgct tcatctcagt      1140
     gggctacgtg gacgacacgc agttcgtgcg gttcgacagc gacgccgcga gtccgagagg      1200
     ggagccgcgg gcgccgtggg tggagcagga ggggccggag tattgggacc gggagacaca      1260
     gaagtacaag cgccaggcac aggctgaccg agtgagcctg cggaacctgc gcggctacta      1320
     caaccagagc gaggacggtg agtgaccccg gcccggggcg caggtcacga cccctcccca      1380
     tcccccacgg acggcccggg tcgcccagag tctccccgtc tgagatccac cccaaggtgg      1440
     atctgcggaa cccgcccaga ccctcgaccg gagagagccc cagtcgcctt tacccggttt      1500
     cattttcggt ttaggccaaa atccccgcgg gttggtcggg gcggggcggg gctcggggga      1560
     ctgggctgac cgcgggggcg gggccagggt ctcacaccct ccagaggatg tctggctgcg      1620
     acctggggcc cgacgggcgc ctcctccgcg ggtatgacca gtccgcctac gacggcaagg      1680
     attacatcgc cctgaacgag gacctgcgct cctggaccgc cgcggacacc gcggctcaga      1740
     tcactcagcg caagttggag gcggcccgtg cggcggagca gctgagagcc tacctggagg      1800
     gcacgtgcgt ggagtggctc cgcagatacc tggagaacgg gaaggagacg ctgcagcgcg      1860
     caggtaccag gggcagtggg gagccttccc catctcctat agatctcccg ggatggcctc      1920
     ccacgaggag gggaggaaaa tgggatcagc actggaatat cgccctccct tgaatggaga      1980
     atggcatgag ttttcctgag tttcctctga gggccccctc tgctctctag gacaattaag      2040
     ggatgaagtc tctgaggaaa tggaggggaa gacagtccct ggaatactga tcaggggtct      2100
     cctttgacca ctttgaccac tgcagcagct gtggtcaggc tgctgacctt tctctcaggc      2160
     cttgttctct gcctcacact caatgtgtct gaaggtttga ttccagcttt tctgagtcct      2220
     gcagcctcca ctcaggtcag gaccagaagt cgctgttcct ccctcagaga ctagaacttt      2280
     ccaatgaata ggagattatc ccaggtgcct gtgtccaggc tggcgtctgg gttctgtgcc      2340
     gccttcccca ccccaggtgt cctgtccatt ctcaggatgg tcacatgggc gctgctggag      2400
     tgtcccaaga gagatgcaaa gtgtctgaat tttctgactc ttcccgtcag aacccccaaa      2460
     gacacacgtg acccaccacc ccctctctga ccatgaggcc accctgaggt gctgggccct      2520
     gggcttctac cctgcggaga tcacactgac ctggcagcgg gatggggagg accagaccca      2580
     ggacaccgag cttgtggaga ccaggccagc aggagatgga accttccaga agtgggcagc      2640
     tgtggtggtg ccttctggac aagagcagag atacacgtgc catatgcagc acgaggggct      2700
     gcaagagccc ctcaccctga gctggggtaa ggaggggaat ggggggtcac atctcttatc      2760
     agagaaagca gaagtccttc tggagccctt cagccgggtc agggctgagg cttgggggtc      2820
     agggcccctc accttctcct cctttcccag agccatcttc ccagcccacc atccccatca      2880
     tgggcatcgt tgctggcctg gctgtcctgg ttgtcctagc tgtccttgga gctgtggtca      2940
     ccgctatgat gtgtaggagg aagagctcag gtagggaagg ggtgaagagc ggggtctggg      3000
     ttttcttgtc ccactgggag tttcaagccc caggtagaag tgtgccccgc cttgttactg      3060
     gaagcaccat ccacacatgg gccatcccag cctgggaccc tgtgtgccag cacttactct      3120
     tttgtgaagc acatgtgaca atgaaggacg gatgtatcac cttgatgatt atggtgttgg      3180
     ggtcctgatt ccagcattca tgagtcaggg gaaggtccct gctaaggaca gaccttagga      3240
     gggcagttgg tccagaaccc acaactgctt tccccatgtt tcctgatcct gccctgggtc      3300
     tgcagtcgta gttctggaaa cttctcttgg gtccaagact aggaggttcc cctaagatca      3360
     catggccctg cctcctccca gtcccctcat agggcatttt cttcccacag gtggaaaagg      3420
     agggagctgc tctcaggctg cgtgtaagtg atggcggcgg gcgtgtggag gagctcacct      3480
     actccataat tcctcttgtc ccacatctcc tgcgggctct gaccaggtct ttttttttgt      3540
     tctaccccag gcagcaacag tgcccagggc tctgatgagt ctctcatcac ttgtaaaggt      3600
     gagattctgg ggagctgaag tggtcggggg tggggcagag ggaaaaggcc tgggtaatgg      3660
     ggattctttg attgggacgt ttcgagtgtg tggtgggccg ttcagagtgt catcgcttac      3720
     catgactgac ctgaatttgt tcatgactat tgtgttctgt agcctgagac agctgcctgt      3780
     gtgggactga gatgcaggat ttcttcacac ctctcctttg tgacttcaag agcctctggc      3840
     atctctttct gcaaaggcac ctgaatgtgt ctgcgttcct gttagcataa tgtgaggagg      3900
     tggagagaca gcccaccccc gtgtccaccg tgacccctgt ccccacactg acctgtgttc      3960
     cctccccgat catctttcct gttccagaga ggtggggctg gatgtctcca tctctgtctc      4020
     aaattcatgg tgcactgagc tgcaacttct tacttcccta atgaagttaa gaacctgaat      4080
     ataaatttgt gttctcaaat atttgctatg aagcgttgat ggattaatta aataagtcaa      4140
     ttcctagaag ttgagagagc aaataaagac ctgagaacct tccagaattt gcatgttcgc      4200
     tgtgctgagt ctgttgcagg tgggggtggg gaaggctgtg aggagccgag tgtggacggg      4260
     gcctgtgcct agttgctgtt cagttcttca tgggctttat gtggtcagtc ctcagctggg      4320
     tcaccttcac tgctccattg tccttgtccc                                       4350