
ID   GU319111; SV 1; linear; genomic DNA; STD; HUM; 2838 BP.
AC   GU319111;
DT   30-NOV-2010 (Rel. 107, Created)
DT   30-NOV-2010 (Rel. 107, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-G) gene, HLA-G*01:08 allele, complete
DE   cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-2838
RX   DOI; 10.1016/j.humimm.2010.07.003.
RX   PUBMED; 20650296.
RA   Cervera I., Herraiz M.A., Penaloza J., Barbolla M.L., Jurado M.L.,
RA   Macedo J., Vidart J.A., Martinez-Laso J.;
RT   "Human leukocyte antigen-G allele polymorphisms have evolved following
RT   three different evolutionary lineages based on intron sequences";
RL   Hum. Immunol. 71(11):1109-1115(2010).
RN   [2]
RP   1-2838
RA   Jorge M.L., Isabel C.H.;
RT   ;
RL   Submitted (11-DEC-2009) to the INSDC.
RL   Inmunoterapia Celular, ISCIII, Carretera de Majadahonda a Pozuelo Km 2, 2,
RL   Majadahonda, Madrid 28220, Spain
DR   MD5; fa866d703338809f199627590528945e.
FH   Key             Location/Qualifiers
FT   source          1..2838
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: ccaatgtggctgaacaaagg, rev_seq:
FT                   acaaccaggccagcaacg"
FT                   /PCR_primers="fwd_seq: ctggttgtccttgcagctgta, rev_seq:
FT                   ggctggtctctgcacaaagaga"
FT                   /PCR_primers="fwd_seq: ggtcctggttctaaagtcctcgct, rev_seq:
FT                   ggtacccgcgcgctgcagca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>2838
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT   mRNA            join(<1..73,203..472,699..974,1574..1849,1972..2088,
FT                   2534..2566,2709..>2756)
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /product="MHC class I antigen"
FT   CDS             join(1..73,203..472,699..974,1574..1849,1972..2088,
FT                   2534..2538)
FT                   /codon_start=1
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /product="MHC class I antigen"
FT                   /db_xref="GOA:E5DHS1"
FT                   /db_xref="IMGT/HLA:G*01:08"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:E5DHS1"
FT                   /protein_id="ADQ75437.1"
FT   exon            <1..73
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /number=1
FT   exon            203..472
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /number=2
FT   exon            699..974
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /number=3
FT   exon            1574..1849
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /number=4
FT   exon            1972..2088
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /number=5
FT   exon            2534..2566
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /number=6
FT   exon            2709..2756
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01:08"
FT                   /number=7
SQ   Sequence 2838 BP; 547 A; 821 C; 894 G; 576 T; 0 other;
     atggtggtca tggcaccccg aaccctcttc ctgctactct cgggggccct gaccctgacc        60
     gagacctggg cgggtgagtg cggggtcagg agggaaacgg cccctgcgcg gaggagggag       120
     gggccggccc ggcgggggcg caggacccgg cagccgcgcc gggaggaggg tcgggcgggt       180
     ctcaacctct cctcgccccc aggctcccac tccatgaggt atttcagcgc cgccgtgtcc       240
     cggcccggcc gcggggagcc ccgcttcatc gccatgggct acgtggacga cacgcagttc       300
     gtgcggttcg acagcgactc ggcgtgtccg aggatggagc cgcgggcgcc gtgggtggag       360
     caggaggggc cagagtattg ggaagaggag acacggaaca ccaaggccca cgcacagact       420
     gacagaatga acctgcagac cctgcgcggc tactacaacc agagcgaggc cagtgagtaa       480
     ccccggccca gggcgcagat cacgaccccc cacctccatg ccccacggac gccccgggta       540
     ctcccgagtc tccgggtctg ggatccaccc cgaggccgcg ggacccgccc agaccctcta       600
     cctgggagaa ccccaggcgc ctttaccaaa atccctgcgg gtgggtccgg gcgagggcga       660
     ggctcggtgg gcggggctga ccgaaggggt ggggccaggt tctcataccc tccagtggat       720
     gattggctgc gacctggggt ccgacggacg cctcctccgc gggtatgaac agtatgccta       780
     cgatggcaag gattacctcg ccctgaacga ggacctgcgc tcctggaccg cagcggacac       840
     tgcggctcag atctccaagc gcaagtgtga ggcggccaat gtggctgaac aaaggagagc       900
     ctacctggag ggcacgtgcg tggagtggct ccacagatac ctggagaacg ggaaggagat       960
     gctgcagcgc gcgggtacca ggggcagtgg ggcgcctccc tgatctcctg tagacctccc      1020
     agcctggcct agcacaagga gaggaggaaa atgggaccaa caccagaata tcgccctccc      1080
     tctggtcctg agggagagga atcctcctgg gtttccagat cctgtaccag agagtgattc      1140
     tgagggcccg tcctgctctc tgggacaatt aagggatgaa gtctctgagg gagtggaggg      1200
     gaagacaatc cctggaggac tgatcagggg ttccctttga ccccacagca gccttggcac      1260
     caggactttt cccctcaggc cttgttctct gcctcacact caatgtgtgt gggagtctga      1320
     ctccagctcc tctgagtccc ttggcctcca ctcaggtcag aaccagaggt ccctgctccc      1380
     ccgctcagag actagaactt tccaaggaat aggagattat cccaggtgcc cgtgtccagg      1440
     ctggtgtctg ggttctgtgc tcccttcccc accccaggta tctggttcat tcttaggatg      1500
     gtcacatcca ggtgctgctg gagtgtccca tgagagatgc aaagtgcttg agttttctga      1560
     ctcttccttt cagacccccc caagacacac gtgacccacc accctgtctt tgactatgag      1620
     gccaccctga ggtgctgggc cctgggcttc taccctgcgg agatcatact gacctggcag      1680
     tgggatgggg aggaccagac ccaggacgtg gagctcgtgg agaccaggcc tgcaggggat      1740
     ggaaccttcc agaagtgggc agctgtggtg gtgccttctg gagaggagca gagatacacg      1800
     tgccatgtgc agcatgaggg gctgccggag cccctcatgc tgagatggag taaggaggga      1860
     gatggaggca tcatgtctgt tagggaaagc aggagcctct ctgaagacct ttaacagggt      1920
     cggtggtgag gcctgggggt cagagaccct caccttcacc tcctttccca gagcagtctt      1980
     ccctgcccac catccccatc atgggtatcg ttgctggcct ggttgtcctt gcagctgtag      2040
     tcactggagc tgcggtcgct gctgtgctgt ggaggaagaa gagctcaggt aaggaagggg      2100
     tgacaagtgg ggtctgagtt ttcttgtccc actgggggtt tcaagcccca ggtagaagtg      2160
     cgccctgcct ggttactggg aagcaccatc cacactcatg ggcctaccca gcctgggccc      2220
     tgtgtgccag caccttctct tttgtaaagc acctgtgaca atgaaggaca gatttatcac      2280
     cttgatgatt gtagtgatgg ggacctgatc ctagtaatca caggtcaggg gaaggtccct      2340
     ggctaaggac agaccttagg agggcagttg gtcgaggacc cacatctgct ttccttgttt      2400
     ttcctgatcc cgccctgagt ctgcagtcac acatttctgg aaacttctcg agggtccaag      2460
     actaggaggt tcctctagga cctcatggcc ctgccacctt tctggcctct cacaggacgt      2520
     tttcttccca cagattgaaa aggagggagc tactctcagg ctgcaagtaa gtatgaagga      2580
     ggctgatccc tgagatcctt gggatcttgt gtttgggagc ccatggggga gctcacccac      2640
     cccacaattc ctcctctggc cacatctcct gtggtctctg accaggtgct gtttttgttc      2700
     tactctaggc agtgacagtg cccagggctc taatgtgtct ctcacggctt gtaaatgtga      2760
     caccccgggg ggcctgatgt gtgtgggttg ttgaggggaa cagtggacat agctgtgcta      2820
     tgaggtttct ttgacttg                                                    2838