
ID   GU232859; SV 1; linear; genomic DNA; STD; HUM; 1858 BP.
AC   GU232859;
DT   23-DEC-2009 (Rel. 103, Created)
DT   17-JUL-2010 (Rel. 105, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw*15 variant allele,
DE   exons 1 through 4 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1858
RX   PUBMED; 20403138.
RA   Wang D., Deng Z.;
RT   "Identification of a novel HLA-Cw*15 variant allele, Cw*1526";
RL   Tissue Antigens 76(2):158-159(2010).
RN   [2]
RP   1-1858
RA   Deng Z., Wang D.;
RT   ;
RL   Submitted (24-NOV-2009) to the INSDC.
RL   Immunogenetics Laboratory, Shenzhen Blood Center, Nigang Xi Road, Meigang
RL   Nan Street, Shenzhen, Guangdong 518035, China
DR   MD5; ec08fb00c75c3961c4264de6593f7d0d.
FH   Key             Location/Qualifiers
FT   source          1..1858
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.31"
FT                   /mol_type="genomic DNA"
FT                   /country="China"
FT                   /PCR_primers="fwd_seq: ccaatcagcgtctccgcagtc, rev_seq:
FT                   accccycatycccctccttac"
FT                   /note="ethnicity: Chinese, Han"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>1858
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*15 variant"
FT   mRNA            join(<1..73,204..473,720..995,1583..>1858)
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*15 variant"
FT                   /product="MHC class I antigen"
FT   CDS             join(1..73,204..473,720..995,1583..>1858)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*15 variant"
FT                   /product="MHC class I antigen"
FT                   /db_xref="IMGT/HLA:C*15:26"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:D2KMV9"
FT                   /protein_id="ADA60970.1"
FT                   TCHVQHEGLPEPLTLRW"
FT   exon            <1..73
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*15 variant"
FT                   /number=1
FT   exon            204..473
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*15 variant"
FT                   /number=2
FT   exon            720..995
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*15 variant"
FT                   /number=3
FT   variation       755
FT                   /gene="HLA-Cw"
FT                   /replace="c"
FT                   /note="results in a valine to leucine substitution"
FT   exon            1583..>1858
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*15 variant"
FT                   /number=4
SQ   Sequence 1858 BP; 351 A; 567 C; 615 G; 325 T; 0 other;
     atgcgggtca tggcgccccg aaccctcctc ctgctgctct cgggagccct ggccctgacc        60
     gagacctggg cctgtgagtg cggggttggg agggaaacgg cctctgcgga gaggagcgag       120
     gggcccgccc ggcgagggcg caggacccgg ggagccgcgc agggaggagg gtcgggcggg       180
     tctcagcccc tcctcgcccc caggctccca ctccatgagg tatttctaca ccgctgtgtc       240
     ccggcccggc cgcggagagc cccacttcat cgcagtgggc tacgtggacg acacgcagtt       300
     cgtgcggttc gacagcgacg ccgcgagtcc aagaggggag ccgcgggcgc cgtgggtgga       360
     gcaggagggg ccggagtatt gggaccggga gacacagaac tacaagcgcc aggcacagac       420
     tgaccgagtg aacctgcgga aactgcgcgg ctactacaac cagagcgagg ccggtgagtg       480
     accccggccc ggggcgcagg tcacgacccc tccccatccc ccacggacgg cccgggtcgc       540
     cccgagtctc ccggtctgag atccaccccg aggctgcgga acccgcccag accctcgacc       600
     ggagagagcc ccagtcacct ttacccggtt tcattttcag tttaggccaa aatccccgcg       660
     ggttggtcgg ggctggggcg gggctcgggg gacggggctg accacggggg cggggccagg       720
     gtctcacatc atccagagga tgtatggctg cgacgtgggg cccgacgggc gcctcctccg       780
     cgggcatgac cagttagcct acgacggcaa ggattacatc gccctgaacg aggacctgcg       840
     ctcctggacc gccgcggaca cggcggctca gatcacccag cgcaagtggg aggcggcccg       900
     tgaggcggag cagctgagag cctacctgga gggcacgtgc gtggagtggc tccgcagata       960
     cctggagaac gggaaggaga cgctgcagcg cgcgggtacc aggggcagtg gggagccttc      1020
     cctatctcct gtagatctcc cgggatggcc ttccacgagg aggggaggaa aatgggatca      1080
     gcgctagaat atcgccctcc cttgaatgga gaatgggatg agttttcctg agtttcctct      1140
     gagggccccc tctgctctct aggacaatta agggatgaag tccttgagga aatggagggg      1200
     aagacagtcc ctggaatact gatcaggggt cccctttgac cactttgacc actgcagcag      1260
     ctgtggtcag gctgctgacc tttctctcag gccttgttct ctgcctcacg ctcaatgtgt      1320
     ttgaaggttt gattccagct tttctgagtc cttcggcctc cactcaggtc aggaccagaa      1380
     gtcgctgttc ctccctcaga gactagaact ttccaatgaa taggagatta tcccaggtgc      1440
     ctgtgtccag gctggcgtct gggttctgtg cccccttccc caccccaggt gtcctgtcca      1500
     ttctcaggat ggtcacatgg gcgctgttgg agtgtcgcaa gagagataca aagtgtctga      1560
     attttctgac tcttcccgtc agaacaccca aagacacacg tgacccacca tcccgtctct      1620
     gaccatgagg ccaccctgag gtgctgggcc ctgggcttct accctgcgga gatcacactg      1680
     acctggcagc gggatggcga ggaccaaact caggacaccg agcttgtgga gaccaggcca      1740
     gcaggagatg gaaccttcca gaagtgggca gctgtggtgg tgccttctgg agaagagcag      1800
     agatacacgt gccatgtgca gcacgagggg ctgccggagc ccctcaccct gagatggg        1858