
ID   GU133628; SV 1; linear; genomic DNA; STD; HUM; 646 BP.
AC   GU133628;
DT   18-NOV-2009 (Rel. 102, Created)
DT   18-NOV-2009 (Rel. 102, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-C) gene, HLA-C-Cw*15 allele, exons 2,
DE   3 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-646
RA   Niokou D., Cormack C., Davey S., Brown C.;
RT   "Identification of a novel HLA-Cw*15 allele sequenced from an African cord
RT   blood donor";
RL   Unpublished.
RN   [2]
RP   1-646
RA   Niokou D., Cormack C., Davey S., Brown C.;
RT   ;
RL   Submitted (26-OCT-2009) to the INSDC.
RL   H&I, NHS BT, Colindale Ave, London N22 8PL, UK
DR   MD5; 38894712c21d5476d74293d255033397.
FH   Key             Location/Qualifiers
FT   source          1..646
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: 369 HLA-C Ex2 123-140, fwd_seq:
FT                   agcgaggkgcccgcccggcga, rev_name: 213 HLA-B&C Ex3 44-59,
FT                   rev_seq: gaggaggcgcccgtcg"
FT                   /PCR_primers="fwd_name: CFOR Int1 42-61, fwd_seq:
FT                   agtccaagaggggagccg, rev_name: CREV Int3 12-35, rev_seq:
FT                   ggagatggggaaggctccccact"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>646
FT                   /gene="HLA-C"
FT                   /allele="Cw*15"
FT   mRNA            join(<1..270,371..>646)
FT                   /gene="HLA-C"
FT                   /allele="Cw*15"
FT                   /product="MHC class I antigen"
FT   CDS             join(<1..270,371..>646)
FT                   /codon_start=3
FT                   /gene="HLA-C"
FT                   /allele="Cw*15"
FT                   /product="MHC class I antigen"
FT                   /db_xref="IMGT/HLA:C*15:25"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:D1MDP2"
FT                   /protein_id="ACY79420.1"
FT                   VESLRRYLENGKETLQRA"
FT   exon            1..270
FT                   /gene="HLA-C"
FT                   /allele="Cw*15"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-C"
FT                   /allele="Cw*15"
FT                   /number=3
SQ   Sequence 646 BP; 110 A; 168 C; 197 G; 71 T; 100 other;
     gctcccactc catgaggtat ttctacaccg ctgtgtcccg gcccggccgc ggagagcccc        60
     acttcatcgc agtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagtccaag aggggagccg cgggcgccgt gggtggagca ggaggggccg gagtattggg       180
     accgggagac acagaagtac aagcgccagg cacaggctga ccgagtgagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggacg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacat catccagagg atgtatggct gcgacctggg gcccgacggg       420
     cgcctcctcc gcgggtataa ccagttcgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctgc gctcctggac cgccgcggac acggcggctc agatcaccca gcgcaagtgg       540
     gaggcggccc gtgaggcgga gcaggacaga gcctacctgg agggcacgtg cgtggagtcg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcgcgg                      646