
EBI Dbfetch

ID   GU070582; SV 1; linear; genomic DNA; STD; HUM; 3138 BP.
AC   GU070582;
DT   07-NOV-2010 (Rel. 106, Created)
DT   07-NOV-2010 (Rel. 106, Last updated, Version 1)
DE   Homo sapiens isolate BCI-04 MHC class I antigen (HLA-G) gene, complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-3138
RA   Martinez Laso J., Cervera Hernandez I.;
RT   "Evolution of MHC-G Alleles";
RL   Unpublished.
RN   [2]
RP   1-3138
RA   Martinez Laso J., Cervera Hernandez I.;
RT   ;
RL   Submitted (08-OCT-2009) to the INSDC.
RL   Inmunoterapia Celular, ISCIII, Carretera de Majadahonda a Pozuelo Km 2.2,
RL   Majadahonda, Madrid 28220, Spain
DR   MD5; bac9a114c1246608bbcdea0627033bd2.
DR   Ensembl-Gn; ENSG00000204632; homo_sapiens.
DR   Ensembl-Gn; ENSG00000206506; homo_sapiens.
DR   Ensembl-Gn; ENSG00000230413; homo_sapiens.
DR   Ensembl-Gn; ENSG00000233095; homo_sapiens.
DR   Ensembl-Gn; ENSG00000235346; homo_sapiens.
DR   Ensembl-Gn; ENSG00000235680; homo_sapiens.
DR   Ensembl-Gn; ENSG00000237216; homo_sapiens.
DR   Ensembl-Tr; ENST00000360323; homo_sapiens.
DR   Ensembl-Tr; ENST00000376828; homo_sapiens.
DR   Ensembl-Tr; ENST00000383621; homo_sapiens.
DR   Ensembl-Tr; ENST00000400665; homo_sapiens.
DR   Ensembl-Tr; ENST00000400682; homo_sapiens.
DR   Ensembl-Tr; ENST00000420559; homo_sapiens.
DR   Ensembl-Tr; ENST00000422371; homo_sapiens.
DR   Ensembl-Tr; ENST00000423011; homo_sapiens.
DR   Ensembl-Tr; ENST00000423373; homo_sapiens.
DR   Ensembl-Tr; ENST00000428701; homo_sapiens.
DR   Ensembl-Tr; ENST00000428952; homo_sapiens.
DR   Ensembl-Tr; ENST00000434881; homo_sapiens.
DR   Ensembl-Tr; ENST00000444098; homo_sapiens.
DR   Ensembl-Tr; ENST00000449127; homo_sapiens.
DR   Ensembl-Tr; ENST00000450984; homo_sapiens.
DR   Ensembl-Tr; ENST00000546545; homo_sapiens.
DR   Ensembl-Tr; ENST00000546634; homo_sapiens.
DR   Ensembl-Tr; ENST00000547241; homo_sapiens.
DR   Ensembl-Tr; ENST00000547931; homo_sapiens.
DR   Ensembl-Tr; ENST00000550897; homo_sapiens.
DR   Ensembl-Tr; ENST00000553052; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..3138
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /isolate="BCI-04"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: ccaatgtggctgaacaaagg, rev_seq:
FT                   acaaccaggccagcaacg"
FT                   /PCR_primers="fwd_seq: ctggttgtccttgcagctgta, rev_seq:
FT                   ggctggtctctgcacaaagaga"
FT                   /PCR_primers="fwd_seq: tgagacagaacgcttggcaca, rev_seq:
FT                   ggtacccgcgcgctgcagca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>3056
FT                   /gene="HLA-G"
FT   mRNA            join(<1..373,503..772,999..1274,1874..2149,2272..2388,
FT                   2834..2866,3009..>3056)
FT                   /gene="HLA-G"
FT                   /product="MHC class I antigen"
FT   5'UTR           <1..300
FT                   /gene="HLA-G"
FT   CDS             join(301..373,503..772,999..1274,1874..2149,2272..2388,
FT                   2834..2838)
FT                   /codon_start=1
FT                   /gene="HLA-G"
FT                   /product="MHC class I antigen"
FT                   /db_xref="GOA:Q6DU14"
FT                   /db_xref="IMGT/HLA:G*01:01:20"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:Q6DU14"
FT                   /protein_id="ADP21921.1"
FT   3'UTR           2839..>3138
SQ   Sequence 3138 BP; 598 A; 914 C; 984 G; 642 T; 0 other;
     tgagacagaa cgcttggcac aagagtagcg gggtcagggc gaagtcccag ggcctcaagc        60
     gtggctctca gggtctcagg ccccacaggc ggtgtatggg ttggggaggc cccgcgttgg       120
     ggattctctc ctccttctcc taacctgtgt cgggtccttc ttcctggata ctcaccgggc       180
     ggccccagtt ctcactccca ttaggtgaca ggtttttaga gaagccaatc agcgtcgccg       240
     cggtcctggt tctaaagtcc tcgctcaccc acccggactc attctcccca gacgccaagg       300
     atggtggtca tggcgccccg aaccctcttc ctgctgctct cgggggccct gaccctgacc       360
     gagacctggg cgggtgagtg cggggtcagg agggaaacgg cccctgcgcg gaggagggag       420
     gggcccgcct ggcgggggcg caggactcgg cagccgcgcc gggaggaggg tcgggcgggt       480
     ctcaacccct cctcgccccc aggctcccac tccatgaggt atttcagcgc cgccgtgtcc       540
     cggcccggcc gcggggagcc ccgcttcatc gccatgggct acgtggacga cacgcagttc       600
     gtgcggttcg acagcgactc ggcgtgtccg aggatggagc cgcgggcgcc gtgggtggag       660
     caggaggggc cggagtattg ggaagaggag acacggaaca ccaaggccca cgcacagact       720
     gacagaatga acctgcagac cctgcgcggc tactacaacc agagcgaggc cagtgagtaa       780
     ctccggccca gggagcagat cacgaccccc acctccatgc cccacggacg gcccgggtac       840
     tcccgagtct ccgggtctgg gatccacccc gaggccgcgg gacccgccca gaccctctac       900
     ctgggagaac cccaaggcgc ctttaccaaa atccccgcgg gtgggtccgg gcgagggcga       960
     ggctcggtgg gcggggctga ccgagggggt ggggccaggt tctcataccc tccagtggat      1020
     gattggctgc gacctggggt ccgacggacg cctcctccgc gggtatgaac agtatgccta      1080
     cgatggcaag gattacctcg ccctgaacga ggacctgcgc tcctggaccg cagcggacac      1140
     tgcggctcag atctccaagc gcaagtgtga ggcggccaat gtggctgaac aaaggagagc      1200
     ctacctggag ggcacgtgcg tggagtggct ccacagatac ctggagaacg ggaaggagat      1260
     gctgcagcgc gcgggtacca ggggcagtgg ggcgcctccc tgatctcctg tagacctccc      1320
     agcctggcct agcacaagga gaggaggaaa atgggaccaa caccagaata tcgccctccc      1380
     tctggtcctg agggagagga atcctcctgg gtttccagat cctgtaccag agagtgattc      1440
     tgagggcccg tcctgctctc tgggacaatt aagggatgaa gtctctgagg gagtggaggg      1500
     gaagacaatc cctggaggac tgatcagggg ttccctttga ccccacagca gccttggcac      1560
     caggactttt cccctcaggc cttgttctct gcctcacact caatgtgtgt gggagtctga      1620
     ctccagctcc tctgagtccc ttggcctcca ctcaggtcag aaccagaggt ccctgctccc      1680
     ccgctcagag actagaactt tccaaggaat aggagattat cccaggtgcc cgtgtccagg      1740
     ctggtgtctg ggttctgtgc tcccttcccc accccaggta tctggttcat tcttaggatg      1800
     gtcacatcca ggtgctgctg gagtgtccca tgagagatgc aaagtgcttg agttttctga      1860
     ctcttccttt cagacccccc caagacacac gtgacccacc accctgtctt tgactatgag      1920
     gccaccctga ggtgctgggc cctgggcttc taccctgcgg agatcatact gacctggcag      1980
     cgggatgggg aggaccagac ccaggacgtg gagctcgtgg agaccaggcc tgcaggggat      2040
     ggaaccttcc agaagtgggc agctgtggtg gtgccttctg gagaggagca gagatacacg      2100
     tgccatgtgc agcatgaggg gctgccggag cccctcatgc tgagatggag taaggaggga      2160
     gatggaggca tcatgtctgt tagggaaagc aggagcctct ctgaagacct ttaacagggt      2220
     cggtggtgag gcctgggggt cagagaccct caccttcacc tcctttccca gagcagtctt      2280
     ccctgcccac catccccatc atgggtatcg ttgctggtct ggttgtcctt gcagctgtag      2340
     tcactggagc tgcggtcgct gctgtgctgt ggaggaagaa gagctcaggt aaggaagggg      2400
     tgacaagtgg ggtctgagtt ttcttgtccc actgggggtt tcaagcccca ggtagaagtg      2460
     cgccctgcct ggttactggg aagcaccatc cacactcatg ggcctaccca gcctgggccc      2520
     tgtgtgccag caccttctct tttgtaaagc acctgtgaca atgaaggaca gatttatcac      2580
     cttgatgatt gtagtgatgg ggacctgatc ctagtaatca caggtcaggg gaaggtccct      2640
     ggctaaggac agaccttagg agggcagttg gtcgaggacc cacatctgct ttccttgttt      2700
     ttcctgatcc cgccctgagt ctgcagtcac acatttctgg aaacttctcg agggtccaag      2760
     actaggaggt tcctctagga cctcatggcc ctgccacctt tctggcctct cacaggacgt      2820
     tttcttccca cagattgaaa aggagggagc tactctcagg ctgcaagtaa gtatgaagga      2880
     ggctgatccc tgagatcctt gggatcttgt gtttgggagc ccatggggga gctcacccac      2940
     cccacaattc ctcctctggc cacatctcct gtggtctctg accaggtgct gtttttgttc      3000
     tactctaggc agtgacagtg cccagggctc taatgtgtct ctcacggctt gtaaatgtga      3060
     caccccgggg ggcctgatgt gtgtgggttg ttgagggaaa cagtggacat agctgtgcta      3120
     tgaggtttct ttgacttg                                                    3138
