
ID   GQ472844; SV 1; linear; genomic DNA; STD; HUM; 4359 BP.
AC   GQ472844;
DT   27-SEP-2009 (Rel. 102, Created)
DT   27-SEP-2009 (Rel. 102, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw*1701 variant allele
DE   allele, complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-4359
RA   Xu Y., Deng Z., Wang D.;
RT   "Characterization and polymorphism analyses of HLA-C genomic full length in
RT   Chinese Han population";
RL   Unpublished.
RN   [2]
RP   1-4359
RA   Xu Y., Deng Z., Wang D.;
RT   ;
RL   Submitted (11-AUG-2009) to the INSDC.
RL   Immunogenetic laboratory, Shenzhen Blood Center, 2# Meigang South Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; 3fd4769755d36fcefa43cab2b8848a5f.
FH   Key             Location/Qualifiers
FT   source          1..4359
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: tggactcacacarggaaactc, rev_seq:
FT                   gggacaaggacaatggagcag"
FT                   /db_xref="taxon:9606"
FT   gene            <862..>3776
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*1701 variant allele"
FT   mRNA            join(<862..934,1065..1334,1581..1856,2444..2719,2844..2981,
FT                   3420..3452,3560..3607,3772..>3776)
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*1701 variant allele"
FT                   /product="MHC class I antigen"
FT   CDS             join(862..934,1065..1334,1581..1856,2444..2719,2844..2981,
FT                   3420..3452,3560..3607,3772..3776)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*1701 variant allele"
FT                   /product="MHC class I antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:C9E8W1"
FT                   /db_xref="IMGT/HLA:C*17:01:01:02"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR010579"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:C9E8W1"
FT                   /protein_id="ACV91124.1"
SQ   Sequence 4359 BP; 884 A; 1199 C; 1305 G; 971 T; 0 other;
     tggctagaga atgaggataa ctttaaatgc aacaacccag agtcacagat ccatagtctg        60
     cgaaagtaaa acaggagctt tgagaattta attgtaatgc agttttgaca caggtctttc       120
     acagattgga attctaatca ttcagggatt accaatattg tgctacctac tgtatcaata       180
     aacaaaaagg aaactggtct ctatgagaat ctctacctgg tgctttcaga caaaacttca       240
     ccaggtttaa agagaaaact cctgactcta cacgtccatt cccagggcga gctcactgtc       300
     tggcatcaag ttccccatgg tgagtttccc tgtacaagag tccaagggga gaggtaagtg       360
     tcctttattt tgctggatgt agtttaatat tacctgaggt aaggtaaggc aaagagtggg       420
     aggcagggag tccagttcag ggacggggaa tccaggagga gaagtgaagg ggaaggggct       480
     gggcgcagcc tgggggtctc tccctggttt ccacagacag atccttggcc aggactcagg       540
     cacacagtgt gacaaagatg cttggtgtag gagaagaggg atcaggacga agtcccaggt       600
     cccgggcggg gctctctggg tctcaagctc ccagggccgt gtctgcattg gggaggcgca       660
     gcgttgggga ttccccactc ccactcccct gagtttcact tcttctccca acctgcgtcg       720
     ggtccttctt cctgaatact catgacgcgt ccccaattcc cactcccatt gggtgtcggg       780
     ttctagagaa gccaatcagc gtctacgcag tcccggttct gaagtcaccc acccggactc       840
     agattctccc cagacgccga gatgcgggtc atggcgcccc aagccctcct cctgctgctc       900
     tcgggagccc tggccctgat cgagacctgg gccggtgagt gcggggttgg gagggaaacg       960
     gcctctgcgg agaggagcga ggggcccgcc cggcgagggc gcaggacccg gggagccgcg      1020
     cagggaggag ggtcgggcgg gtctcagccc ctcctcgccc ccaggctccc actccatgag      1080
     gtatttctac accgccgtgt cccggcccgg ccgcggagag ccccgcttca tcgcagtggg      1140
     ctacgtggac gacacgcagt tcgtgcggtt cgacagcgac gccgcgagtc cgagagggga      1200
     gccgcgggcg ccgtgggtgg agcaggaggg gccggagtat tgggaccggg agacacagaa      1260
     gtacaagcgc caggcacagg ctgaccgagt gaacctgcgg aaactgcgcg gctactacaa      1320
     ccagagcgag gccggtgagt gaccccagcc cggggcgcag gtcacgaccc ctccccatcc      1380
     cccacggacg gcccgggtcg ccccgagtct cccggtctga gatcctcccc gaggctgcgg      1440
     aacccgccca gaccctcgac cggagagagc cctagtcgcc tttacccggt ttcattttca      1500
     gtttaggcca aaatccccgc gggttggtcg gggctggggc ggggctcggg ggacggggct      1560
     gaccacgggg gcggggccag gttctcacac catccagagg atgtatggct gcgacctggg      1620
     gcccgacggg cgcctcctcc gcgggtataa ccagttcgcc tacgacggca aggattacat      1680
     cgccctgaac gaggacctgc gctcctggac cgcggcggac acggcggctc agatctccca      1740
     gcgcaagttg gaggcggccc gtgaggcgga gcagctgaga gcctacctgg agggcgagtg      1800
     cgtggagtgg ctccgcggat acctggagaa cgggaaggag acgctgcagc gcgcgggtac      1860
     caggggcagt ggggagcctt ccccatctcc tatagatctc ccgggatggc ctcccacgag      1920
     gaggggagga aaatgggatc agcgctagaa tatcgccctc ccttgaatgg agaatgggat      1980
     gagttttccc gagtttcctc tgagggcccc gtctgctctc taggacaatt aagggatgaa      2040
     gtccctgagg aaatggaggg gaagacagtc cctggaatac tgatcagggg tcccctttga      2100
     ccactttgac cactgcggca gctgtggtca ggctgctgac ctttctctca ggccttgttc      2160
     tctgcctcac actcaatgtg tctgaaggtt tgattccagc ttttctgagt ccttcggcct      2220
     ccactcaggt caggaccaga agtcgctgtt cctccctcag agactagaac tttccaaaga      2280
     ataggagatt atcccaggtc cctgtgtcca ggctggcgtc tgggttctgt gcccccttcc      2340
     ctaccccagg tgtcctgtcc attctcagga tggtcacatg ggcgctgctg gagtgtcgca      2400
     agagagatac aaagtgtctg aattttctga ctcttcccgt cagaacgccc aaagacacac      2460
     gtgacccacc atcccgtctc tgaccatgag gccaccctga ggtgctgggc cctgggcttc      2520
     taccctgcgg agatcacact gacctggcag cgggatgggg aggaccaaac tcaggacacc      2580
     gagcttgtgg agaccaggcc agcaggagat ggaaccttcc agaagtgggc agctgtggtg      2640
     gtgccttctg gacaagaaca gagatacacg tgccatgtgc agcacgaggg gctgcaggag      2700
     ccctgcaccc tgagatggag taaggagggg gatgaggggt catgtgtctt ctcagggaaa      2760
     gcagaagtcc ttctggagcc cttcagccgg gtcagggctg aggcttgggt gtaagggccc      2820
     ctcaccttcc cctcctttcc cagagccgtc ttcccagccc accatcccca acttgggcat      2880
     cgtttctggc ccagctgtcc tggctgtcct ggctgtcctg gctgtcctag ctgtcctagg      2940
     agctgtggtc gctgctgtga tacataggag gaagagctca ggtagggaag gggtgaggag      3000
     tggggtctgg gttttcttgt cccactggga gtttcaagcc ccaggtagaa gtgtgcccca      3060
     cctcgttact ggaagcacca tccacacctg ggccatccca gcctgggacc ctgtgtgcca      3120
     gcacttactc tgttgtgaag cacatgacaa cgaaggacag atgtatcacc ttgatgatta      3180
     tggtgttggg gtcctgattc cagcattcgt gagtcagggg aaggtccctg ctaaggacag      3240
     accttaggag ggcagttgct ccagaaccca cagctgcttt ccccgtgttt cctgatcctg      3300
     ccctgggtct gcagtcatag ttctggaaac ttctcttggg tccaagacta ggaggttccc      3360
     ctaagatcgc atggccctgc ctcctccctg tcccctcaca gggcattttc ttcccacagg      3420
     tggaaaagga gggagctgct ctcaggctgc gtgtaagtga tggcggtggg cgtgtggagg      3480
     agctcaccta ccccataatt cctcttgtcc cacatctcct gcgggctctg accaggtctt      3540
     tttttttgtt ctaccccagc cagcaacagt gcccagggct ctgatgagtc tctcatcgct      3600
     tgtaaaggtg agattctggg gagctgaagt ggtcgggggt ggggcagagg gaaaaggcct      3660
     gggtaatggg gatcctttga ttgggacgtt tcgagtgtgt ggtggactgt tcagagtgtc      3720
     atcacttacc atgactgacc tgaatttgtt catgactatt gtgttctgta gcctgagaca      3780
     gctgcctgtg tgggactgag atgcaggatt tcttcacacc tctcctttgt gacttcaaga      3840
     gcctctggca tctctttctg caaaggcatc tgaatgtgtc tgcgttcctg ttagcataat      3900
     atgaggagtt ggagagacag ctcacccccg tgtccaccgt gacccctgtc cccatactga      3960
     cctgtgttcc ctccccgatc atctttcctg ttccagagag gtggggctgg atgtctccat      4020
     ctctgtctca acttcatggt gcactgagct gcagcttctt acttccctaa tgaagttaag      4080
     aacctgaata taaatttgtg ttctcaaata tttgctatga agcgttgatg ggttaattaa      4140
     ataagtcaat tcctagaagt tgagagagca aataaagacc tgagaacctt ccagaatcca      4200
     catgttcact gtgctgagtc agttgcaggt gggggtggag aaggctgtga ggaaccgagt      4260
     gtggacgggg cctgtgccta gttgctgttc agttcttcat gagctttatg tggtcagtcc      4320
     tcagctgggt caccttcact gctccattgt ccttgtccc                             4359