
ID   GQ472840; SV 1; linear; genomic DNA; STD; HUM; 4335 BP.
AC   GQ472840;
DT   27-SEP-2009 (Rel. 102, Created)
DT   27-SEP-2009 (Rel. 102, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw*080301 allele,
DE   complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-4335
RA   Xu Y., Deng Z., Wang D.;
RT   "Characterization and polymorphism analyses of HLA-C genomic full length in
RT   Chinese Han population";
RL   Unpublished.
RN   [2]
RP   1-4335
RA   Xu Y., Deng Z., Wang D.;
RT   ;
RL   Submitted (11-AUG-2009) to the INSDC.
RL   Immunogenetic laboratory, Shenzhen Blood Center, 2# Meigang South Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; 3050924ee7c7b6da068440bfbfc6622e.
FH   Key             Location/Qualifiers
FT   source          1..4335
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: tggactcacacarggaaactc, rev_seq:
FT                   gggacaaggacaatggagcag"
FT                   /db_xref="taxon:9606"
FT   gene            <860..>3754
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*080301"
FT   mRNA            join(<860..932,1063..1332,1579..1854,2442..2717,2839..2958,
FT                   3398..3430,3538..3585,3750..>3754)
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*080301"
FT                   /product="MHC class I antigen"
FT   CDS             join(860..932,1063..1332,1579..1854,2442..2717,2839..2958,
FT                   3398..3430,3538..3585,3750..3754)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*080301"
FT                   /product="MHC class I antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:Q53X46"
FT                   /db_xref="IMGT/HLA:C*08:03:01"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR010579"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="UniProtKB/TrEMBL:Q53X46"
FT                   /protein_id="ACV91120.1"
SQ   Sequence 4335 BP; 883 A; 1190 C; 1295 G; 967 T; 0 other;
     gggctagaga atgaggataa ctttaaatgc aacaacccag agtcacagat ccatagtctg        60
     cgaaagtaaa acaggagctt tgagaattta attgtaatgc agttttgaca caggtctttc       120
     acagattgga attctaatca ttcagggatt accaatattg tgctacctac tgtatcaata       180
     aacaaaaagg aaactggtct ctatgagaat ctctacctgg tgctttcaga caaaacttca       240
     ccaggtttaa agagaaaact cctgactcta cacgtccatt cccagggcga gctcactgtc       300
     tggcatcaag ttccccatgg tgagtttccc tgtacaagag tccaagggga gaggtaagtg       360
     tcctttattt tgctggatgt agtttaatat tacctgaggt aaggtaaggc aaagagtggg       420
     aggcagggag tccagttcag ggacggggat tccaggagaa gtgaagggga aggggctggg       480
     cgcagcctgg gggtctctcc ctggtttcca cagacagatc cttggccagg actcaggcac       540
     acagtgtgac aaagatgctt ggtgtaggag aagagggatc aggacgaagt cccaggtccc       600
     gggcggggct ctcagggtct caggctccaa gggccgtgtc tgcactgggg aggcgccgcg       660
     ttgaggattc tccactcccc tgagtttcac ttcttcttcc aacctgcgtc gggtccttct       720
     tcctgaatac tcatgacgcg tccccaattc ccactcccat tgggtgtcgg gttctagaga       780
     agccaatcag cgtctccgca gtcccggttc taaagtcccc agtcacccac ccggactcgg       840
     attctcccca gacgccgaga tgcgggtcat ggcgccccga accctcatcc tgctgctctc       900
     gggagccctg gccctgaccg agacctgggc ctgtgagtgc gaggttggga gggaaacggc       960
     ctctgcggag aggagcgagg ggcccgcccg gcgagggcgc aggacccggg gagccgcgca      1020
     gggaggaggg tcgggcgggt ctcagcccct cctcgccccc aggctcccac tccatgaggt      1080
     atttctacac cgccgtgtcc cggcccggcc gcggagagcc ccgcttcatc gcagtgggct      1140
     acgtggacga cacgcagttc gtgcagttcg acagcgacgc cgcgagtcca agaggggagc      1200
     cgcgggcgcc gtgggtggag caggaggggc cggagtattg ggaccgggag acacagaagt      1260
     acaagcgcca ggcacagact gaccgagtga gcctgcggaa cctgcgcggc tactacaacc      1320
     agagcgaggc cggtgagtga ccccggcccg gggcgcaggt cccgacccct ccccatcccc      1380
     cacggacggc ccgggtcgcc ccgagtctcc cggtctgaga tccaccccga ggctgcggaa      1440
     cccgcccaga ccctcgaccg gagagagccc cagtcacctt tacccggttt cattttcagt      1500
     ttaggccaaa atccccgcgg gttggtcggg gctggggcgg ggctcggggg acggggctga      1560
     ccacgggggc ggggccaggg tctcacaccc tccagaggat gtatggctgc gacctggggc      1620
     ccgacgggcg cctcctccgc gggtataacc agttcgccta cgacggcaag gattacatcg      1680
     ccctgaatga ggacctgcgc tcctggaccg ccgcggacac ggcggctcag atcacccagc      1740
     gcaagtggga ggcggcccgt acggcggagc agctgagagc ctacctggag ggcacgtgcg      1800
     tggagtggct ccgcagatac ctggagaaca ggaagaagac gctgcagcgc gcgggtacca      1860
     ggggcagtgg ggagccttcc ccatctcctg tagatctccc gggatggcct cccacgagga      1920
     ggggaggaaa atgggatcag cgctggaata tcgccctccc ttgaatggag aatgggatga      1980
     gttttcctga gtttcctctg agggccccct ctgctctcta ggacaattaa gggatgaagt      2040
     ccttgaggaa atggagggga agacagtccc tggaatactg atcaggggtc ccctttgacc      2100
     actttgacca ctgcagcagc tgtggtcagg ctgctgacct ttctctcagg ccttgttctc      2160
     tgcctcacgc tcaatgtgtt taaaggtttg attccagctt ttctgagtcc ttcggcctcc      2220
     actcaggtca ggaccagaag tcgctgttcc tccctcagag actagaactt tccaatgaat      2280
     aggagattat cccaggtgcc tgtgtccagg ctggcgtctg ggttctgtgc ccccttcccc      2340
     accccaggtg tcctgtccat tctcaggatg gtcacatggg cactgttgga gtgtcgcaag      2400
     agagatacaa agtgtctgaa ttttctgact cttcccgtca gaacacccaa agacacacgt      2460
     gacccaccat cccgtctctg accatgaggc caccctgagg tgctgggccc tgggcttcta      2520
     ccctgcggag atcacactga cctggcagcg ggatggcgag gaccaaactc aggacaccga      2580
     gcttgtggag accaggccag caggagatgg aaccttccag aagtgggcag ctgtggtggt      2640
     gccttctgga gaagagcaga gatacacgtg ccatgtgcag cacgaggggc tgccagagcc      2700
     cctcaccctg agatggggta aggaggggga tgaggggtca tgtgtcttct cagggaaagc      2760
     agaagtcctg gagcccttca gccgggtcag ggctgaggct tgggggtcag ggcccctcac      2820
     cttcccctcc tttcccaggg ccatcttccc agcccaccat ccccatcgtg ggcatcgttg      2880
     ctggcctggc tgtcctggct gtcctagctg tcctaggagc tgtgatggct gttgtgatgt      2940
     gtaggaggaa gagctcaggt agggaagggg tgaggagtgg ggtctgggtt ttcttgtccc      3000
     actgggagtt tcaagcccca ggtagaagtg tgccccacct cgttactgga agcaccatcc      3060
     acacatgggc catcccagcc tgggaccctg tgtgctagca cttactctgt tgtgaagcac      3120
     atgacaatga aggacagatg tatcaccttg atgattatgg tgttggggtc cttgattcca      3180
     gcattcatga gtcaggggaa ggtccctgct aaggacagac cttaggaggg cagttgctcc      3240
     agaacccaca gctgctttcc ccgtgtttcc tgatcctgcc ctgggtctgc agtcatagtt      3300
     ctggaaactt ctcttgggtc caagactagg aggttcccct aagatcgcat ggccctgcct      3360
     cctccctgtc ccctcacagg gcattttctt cccacaggtg gaaaaggagg gagctgctct      3420
     caggctgcgt gtaagtgatg gcggtgggcg tgtggaggag ctcacccacc ccataattcc      3480
     tcttgtccca catctcctgc gggctctgac caggtctttt tttttgttct accccagcca      3540
     gcaacagtgc ccagggctct gatgagtctc tcatcgcttg taaaggtgag attctgggga      3600
     gctgaagtgg tcgggggtgg ggcagaggga aaaggcctag gtaatgggga tcctttgatt      3660
     gggacgtttc gaatgtgtgg tgagctgttc agagtgtcat cacttaccat gactgacctg      3720
     aatttgttca tgactattgt gttctgtagc ctgagacagc tgcctgtgtg ggactgagat      3780
     gcaggatttc ttcacacctt tcctttgtga cttcaagagc ctctggcatc tctttctgca      3840
     aaggcatctg aatgtgtctg cgttcctgtt agcataatgt gaggaggtgg agagacagcc      3900
     cacccccgtg tccaccgtga cccctgtccc cacactgacc tgtgttccct ccccgatcat      3960
     ctttcctgtt ccagagaagt gggctggatg tctccatctc tgtctcaact ttacgtgtac      4020
     tgagctgcaa cttcttactt ccctactgaa aataagaatc tgaatataaa tttgttttct      4080
     caaatatttg ctatgagagg ttgatggatt aattaaataa gtcaattcct ggaagttgag      4140
     agagcaaata aagacctgag aaccttccag aatccgcatg ttcgctgtgc tgagtctgtt      4200
     gcaggtgggg gtggggaagg ctgtgaggag acgagtgtgg acggggcctg tgcctagttg      4260
     ctgttcagtt cttcatgggc tttatgtggt cagtcctcag ctgggtcacc ttcactgctc      4320
     cattgtcctt gtccc                                                       4335