
ID   GQ472839; SV 1; linear; genomic DNA; STD; HUM; 4348 BP.
AC   GQ472839;
DT   27-SEP-2009 (Rel. 102, Created)
DT   27-SEP-2009 (Rel. 102, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw*070102 allele,
DE   complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-4348
RA   Xu Y., Deng Z., Wang D.;
RT   "Characterization and polymorphism analyses of HLA-C genomic full length in
RT   Chinese Han population";
RL   Unpublished.
RN   [2]
RP   1-4348
RA   Xu Y., Deng Z., Wang D.;
RT   ;
RL   Submitted (11-AUG-2009) to the INSDC.
RL   Immunogenetic laboratory, Shenzhen Blood Center, 2# Meigang South Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; b12f626b8f30b1702cde3f6841411a61.
DR   Ensembl-Gn; ENSG00000233841; homo_sapiens.
DR   Ensembl-Tr; ENST00000424832; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..4348
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: tggactcacacarggaaactc, rev_seq:
FT                   gggacaaggacaatggagcag"
FT                   /db_xref="taxon:9606"
FT   gene            <865..>3765
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070102"
FT   mRNA            join(<865..937,1068..1337,1588..1863,2451..2726,2851..2970,
FT                   3409..3441,3549..3596,3761..>3765)
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070102"
FT                   /product="MHC class I antigen"
FT   CDS             join(865..937,1068..1337,1588..1863,2451..2726,2851..2970,
FT                   3409..3441,3549..3596,3761..3765)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*070102"
FT                   /product="MHC class I antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:O19617"
FT                   /db_xref="HGNC:HGNC:4933"
FT                   /db_xref="IMGT/HLA:C*07:01:02"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR010579"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="UniProtKB/TrEMBL:O19617"
FT                   /protein_id="ACV91119.1"
SQ   Sequence 4348 BP; 877 A; 1198 C; 1303 G; 970 T; 0 other;
     tggctagaga atgaggataa ctttaaatgc aacaacccag agtcacagat ccatagtctg        60
     cgaaagtaaa acaggagctt tgagaattta attgtaatgc agttttgaca caggtctttc       120
     acagattgga attctaatca ttcagggatt accaatattg tgctacctac tgtatcaata       180
     aacaaaaagg aaactggtct ctatgagaat ctctacctgg tgctttcaga caaaacttca       240
     ccaggtttaa agagaaaact cctgactcta cacgtccatt cccagggcga gctcactgtc       300
     tggcatcaag ttccccatgg tgagtttccc tgtacaagag tccaagggga gaggtaagtg       360
     tcctttattt tgctggatgt agtttaatat tacctgaggt gaggtaaggt aaggcaaagg       420
     gtgggaggca gggagtccag ttcagggacg gggattccag gaggagaagt gaaggggaag       480
     gggctgggcg cagccttggg gtctctccct ggtttccaca gacagatcct tgtccaggac       540
     tcaggcacac agtgtgacaa agatgcttgg tgtaggagaa gagggatcag gacgaagtcc       600
     caggtcccgg acggggctct cagggtctca ggctccaagg gccgtgtctg cattggggag       660
     gcgccgcgtt ggggattctc cactcccctg agtttcactt ctcccaacct gcgtcgggtc       720
     cttcttcctg aatactcatg acgcgtcccc aattcccact cccattgggt gtcgggttct       780
     agagaagcca atcagcgtct ccgcagtccc ggttctaaag tccccagtca cccacccgga       840
     ctcacattct ccccagaggc cgagatgcgg gtcatggcgc cccgagccct cctcctgctg       900
     ctctcgggag gcctggccct gaccgagacc tgggcctgtg agtgcggggt tgggagggaa       960
     gcggcctctg cggagaggag cgaggggccc gcccggcgag ggcgcaggac ccggggagcc      1020
     gcgcagggag gtgggtcggg cgggtctcag cccctcctcg cccccaggct cccactccat      1080
     gaggtatttc gacaccgccg tgtcccggcc cggccgcgga gagccccgct tcatctcagt      1140
     gggctacgtg gacgacacgc agttcgtgcg gttcgacagc gacgccgcga gtccgagagg      1200
     ggagccgcgg gcgccgtggg tggagcagga ggggccggag tattgggacc gggagacaca      1260
     gaactacaag cgccaggcac aggctgaccg agtgagcctg cggaacctgc gcggctacta      1320
     caaccagagc gaggacggtg agtgaccccg gcccggggcg caggtcacga cccctcccca      1380
     tcccccacgg acggcccggg tcgccccgag tctccccgtc tgagatccac cccaaggtgg      1440
     atctgcggaa cccgcccaga ccctcgaccg gagagagccc cagtcgcctt tacccggttt      1500
     cattttcggt ttaggccaaa atccccgcgg gttggtcggg gcggggcggg gctcggggga      1560
     ctgggctgac cgcgggggcg gggccagggt ctcacaccct ccagaggatg tatggctgcg      1620
     acctggggcc cgacgggcgc ctcctccgcg ggtatgacca gtccgcctac gacggcaagg      1680
     attacatcgc cctgaacgag gacctgcgct cctggaccgc cgcggacacc gcggctcaga      1740
     tcacccagcg caagttggag gcggcccgtg cggcggagca gctgagagcc tacctggagg      1800
     gcacgtgcgt ggagtggctc cgcagatacc tggagaacgg gaaggagacg ctgcagcgcg      1860
     caggtaccag gggcagtggg gagccttccc catctcctat agatctcccg ggatggcctc      1920
     ccacgaggag gggaggaaaa tgggatcagc actggaatat cgccctccct tgaatggaga      1980
     atggcatgag ttttcctgag tttcctctga gggccccctc tgctctctag gacaattaag      2040
     ggatgaagtc tctgaggaaa tggaggggaa gacagtccct ggaatactga tcaggggtct      2100
     cctttgacca ctttgaccac tgcagcagct gtggtcaggc tgctgacctt tctctcaggc      2160
     cttgttctct gcctcacact caatgtgtct gaaggtttga ttccagcttt tctgagtcct      2220
     gcagcctcca ctcaggtcag gaccagaagt cgctgttcct ccctcagaga ctagaacttt      2280
     ccaatgaata ggagattatc ccaggtgcct gtgtccaggc tggcgtctgg gttctgtgcc      2340
     gccttcccca ccccaggtgt cctgtccatt ctcaggatgg tcacatgggc gctgctggag      2400
     tgtcccaaga gagatgcaaa gtgtctgaat tttctgactc ttcccgtcag aacccccaaa      2460
     gacacacgtg acccaccacc ccctctctga ccatgaggcc accctgaggt gctgggccct      2520
     gggcttctac cctgcggaga tcacactgac ctggcagcgg gatggggagg accagaccca      2580
     ggacaccgag cttgtggaga ccaggccagc aggagatgga accttccaga agtgggcagc      2640
     tgtggtggtg ccttctggac aagagcagag atacacgtgc catatgcagc acgaggggct      2700
     gcaagagccc ctcaccctga gctggggtaa ggaggggaat ggggggtcac atctcttatc      2760
     agagaaagca gaagtccttc tggagccctt cagccgggtc agggctgagg cttgggggtc      2820
     agggcccctc accttctcct cctttcccag agccatcttc ccagcctacc atccccatca      2880
     tgggcatcgt tgctggcctg gctgtcctgg ttgtcctagc tgtccttgga gctgtggtca      2940
     ccgctatgat gtgtaggagg aagagctcag gtagggaagg ggtgaagagc ggggtctggg      3000
     ttttcttgtc ccactgggag tttcaagccc caggtagaag tgtgccccgc cttgttactg      3060
     gaagcaccat ccacacatgg gccatcccag cctgggaccc tgtgtgccag cacttactct      3120
     tttgtgacac atgtgacaat gaaggacgga tgtatcacct tgatgattat ggtgttgggg      3180
     tcctgattcc agcattcatg agtcagggga aggtccctgc taaggacaga ccttaggagg      3240
     gcagttggtc cagaacccac aactgctttc cccatgtttc ctgatcctgc cctgggtctg      3300
     cagtcgtagt tctggaaact tctcttgggt ccaagactag gaggttcccc taagatcaca      3360
     tggccctgcc tcctcccagt cccctcatag ggcattttct tcccacaggt ggaaaaggag      3420
     ggagctgctc tcaggctgcg tgtaagtgat ggcggcgggc gtgtggagga gctcacctac      3480
     tccataattc ctcttgtccc acatctcctg cgggctctga ccaggtcttt ttttttgttc      3540
     taccccaggc agcaacagtg cccagggctc tgatgagtct ctcatcactt gtaaaggtga      3600
     gattctgggg agctgaagtg gtcgggggtg gggcagaggg aaaaggcctg ggtaatgggg      3660
     attctttgat tgggacgttt cgagtgtgtg gtgggccgtt cagagtgtca tcacttacca      3720
     tgactgacct gaatttgttc atgactattg tgttctgtag cctgagacag ctgcctgtgt      3780
     gggactgaga tgcaggattt cttcacacct ctcctttgtg acttcaagag cctctggcat      3840
     ctctttctgc aaaggcgtct gaatgtgtct gcgttcctgt tagcataatg tgaggaggtg      3900
     gagagacagc ccacccccgt gtccaccgtg acccctgtcc ccacactgac ctgtgttccc      3960
     tccccgatca tctttcctgt tccagagagg tggggctgga tgtctccatc tctgtctcaa      4020
     attcatggtg cactgagctg caacttctta cttccctaat gaagttaaga acctgaatat      4080
     aaatttgtgt tctcaaatat ttgctatgaa gcgttgatgg attaattaaa taagtcaatt      4140
     cctagaagtt gagagagcaa ataaagacct gagaaccttc cagaatttgc atgttcgctg      4200
     tgctgagtct gttgcaggtg ggggtgggga aggctgtgag gagccgagtg tggacggggc      4260
     ctgtgcctag ttgctgttca gttcttcatg ggctttatgt ggtcagtcct cagctgggtc      4320
     accttcactg ctccattgtc cttgtccc                                         4348