
ID   GQ365730; SV 1; linear; genomic DNA; STD; HUM; 921 BP.
AC   GQ365730;
DT   30-AUG-2009 (Rel. 102, Created)
DT   19-JAN-2011 (Rel. 107, Last updated, Version 2)
DE   Homo sapiens isolate QD-B575 HLA class I antigen (HLA-B) gene, exons 2, 3
DE   and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-921
RX   DOI; 10.1111/j.1399-0039.2010.01586.x.
RX   PUBMED; 21214529.
RA   Miao F., Sun H., Pan N., Shen Y., Xie W., Zhang J.;
RT   "Two novel HLA class I alleles, HLA-B*40:122 and HLA-B*40:127";
RL   Tissue Antigens 77(2):156-157(2011).
RN   [2]
RP   1-921
RA   Zhang J., Xie W., Miao F., Sun H., Pan N.;
RT   ;
RL   Submitted (06-JUL-2009) to the INSDC.
RL   Department of Genetics and Developmental Biology, Southeast University
RL   Medical School, No. 87 DingJiaQiao Road, Nanjing, Jiangsu 210009, China
DR   MD5; e2f0d376914ca730a00c5e436713d93a.
FH   Key             Location/Qualifiers
FT   source          1..921
FT                   /organism="Homo sapiens"
FT                   /isolate="QD-B575"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_seq: aggcgggggcgcaggacccgg, rev_seq:
FT                   ggaggccatccccggcgacctat"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>921
FT                   /gene="HLA-B"
FT   mRNA            join(<74..343,588..>863)
FT                   /gene="HLA-B"
FT                   /product="HLA class I antigen"
FT   CDS             join(<74..343,588..>863)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /product="HLA class I antigen"
FT                   /note="human leukocyte antigen"
FT                   /db_xref="IMGT/HLA:B*40:127"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="UniProtKB/TrEMBL:C8C3Y8"
FT                   /protein_id="ACU86977.1"
FT                   VEWLRRYLENGKETLQRA"
FT   exon            74..343
FT                   /gene="HLA-B"
FT                   /number=2
FT   exon            588..863
FT                   /gene="HLA-B"
FT                   /number=3
SQ   Sequence 921 BP; 156 A; 306 C; 341 G; 118 T; 0 other;
     ggcgggggcg caggacccgg ggagccgcgc cgggaggagg gtcgggcggg tctcagcccc        60
     tcctcgcccc caggctccca ctccatgagg tatttccaca cctccgtgtc ccggcccggc       120
     cgcggggagc cccgcttcat caccgtgggc tacgtggacg acacgctgtt cgtgaggttc       180
     gacagcgacg ccacgagtcc gaggaaggag ccgcgggcgc catggatgga gcaggagggg       240
     ccggagtatt gggaccggga gacacagatc tccaagacca acacacagac ttaccgagag       300
     agcctgcgga acctgcgcgg ctactacaac cagagcgagg ccggtgagtg accccggccc       360
     ggggcgcagg tcacgactcc ccatccccca cgtacggccc gggtcgcccc gagtctccgg       420
     gtccgagatc cgcccccgag gccgcgggac ccgcccagac cctcgaccgg cgagagcccc       480
     aggcgcgttt acccggtttc attttcagtt gaggccaaaa tccccgcggg ttggtcgggg       540
     cggggcgggg ctcgggggga cggggctgac cgcgggggcg gggccagggt ctcacacttg       600
     gcagacgatg tatggctgcg acgtggggcc ggacgggcgc ctcctccgcg ggcataacca       660
     gtacgcctac gacggcaagg attacatcgc cctgaacgag gacctgcgct cctggaccgc       720
     cgcggacacg gcggctcaga tcacccagcg caagtgggag gcggcccgtg tggcggagca       780
     gctgagagcc tacctggagg gcgagtgcgt ggagtggctc cgcagatacc tggagaacgg       840
     gaaggagacg ctgcagcgcg cgggtaccag gggcagtggg gagccttccc catctcctat       900
     aggtcgccgg ggatggcctc c                                                 921