
EBI Dbfetch

ID   GQ266700; SV 1; linear; genomic DNA; STD; HUM; 1862 BP.
AC   GQ266700;
DT   27-JUL-2009 (Rel. 101, Created)
DT   28-OCT-2009 (Rel. 102, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw*07 variant allele,
DE   exons 1 through 4 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1862
RX   DOI; 10.1111/j.1399-0039.2009.01370.x.
RX   PUBMED; 19845904.
RA   Wang D.M., Gao S.Q., Xu Y.P., Deng Z.H.;
RT   "Identification of a novel HLA-Cw*070206 allele";
RL   Tissue Antigens 74(5):457-458(2009).
RN   [2]
RP   1-1862
RA   Deng Z.H.;
RT   "Identification of a novel HLA-Cw*07 variant allele with codon 143 ACC>ACT
RT   synonymous mutation on the Cw*07020101 basis";
RL   Unpublished.
RN   [3]
RP   1-1862
RA   Deng Z.H.;
RT   ;
RL   Submitted (13-JUN-2009) to the INSDC.
RL   Immunogenetics Laboratory, Shenzhen Blood Center, Nigang Xi Road, Meigang
RL   Nan Street, Shenzhen, Guangdong 518035, China
DR   MD5; 083e7d397ba83474578b5fc509ad5174.
DR   Ensembl-Gn; ENSG00000204525; homo_sapiens.
DR   Ensembl-Tr; ENST00000376228; homo_sapiens.
DR   Ensembl-Tr; ENST00000383329; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..1862
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.31"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: ccaatcagcgtctccgcagtc, rev_seq:
FT                   accccycatycccctccttac"
FT                   /note="Chinese Han Individual"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>1862
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07 variant"
FT   mRNA            join(<1..73,204..473,724..999,1587..>1862)
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07 variant"
FT                   /product="MHC class I antigen"
FT   CDS             join(1..73,204..473,724..999,1587..>1862)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07 variant"
FT                   /product="MHC class I antigen"
FT                   /db_xref="GOA:C7EDP3"
FT                   /db_xref="IMGT/HLA:C*07:02:06"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:C7EDP3"
FT                   /protein_id="ACT66300.1"
FT                   TCHMQHEGLQEPLTLSW"
FT   exon            <1..73
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07 variant"
FT                   /number=1
FT   exon            204..473
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07 variant"
FT                   /number=2
FT   exon            724..999
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07 variant"
FT                   /number=3
FT   variation       881
FT                   /gene="HLA-Cw"
FT                   /replace="c"
FT                   /compare=FJ515904.1
FT                   /note="T143T"
FT   exon            1587..1862
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07 variant"
FT                   /number=4
SQ   Sequence 1862 BP; 343 A; 580 C; 616 G; 323 T; 0 other;
     atgcgggtca tggcgccccg agccctcctc ctgctgctct cgggaggcct ggccctgacc        60
     gagacctggg cctgtgagtg cggggttggg agggaagcgg cctctgcgga gaggagcgag       120
     gggccctccc ggcgagggcg caggacccgg ggagccgcgc agggaggtgg gtcgggcggg       180
     tctcagcccc tcctcgcccc caggctccca ctccatgagg tatttcgaca ccgccgtgtc       240
     ccggcccggc cgcggagagc cccgcttcat ctcagtgggc tacgtggacg acacgcagtt       300
     cgtgcggttc gacagcgacg ccgcgagtcc gagaggggag ccgcgggcgc cgtgggtgga       360
     gcaggagggg ccggagtatt gggaccggga gacacagaag tacaagcgcc aggcacaggc       420
     tgaccgagtg agcctgcgga acctgcgcgg ctactacaac cagagcgagg acggtgagtg       480
     accccggccc ggggcgcagg tcacgacccc tccccatccc ccacggacgg cccgggtcgc       540
     ccagagtctc cccgtctgag atccacccca aggtggatct gcggaacccg cccagaccct       600
     cgaccggaga gagccccagt cgcctttacc cggtttcatt ttcggtttag gccaaaatcc       660
     ccgcgggttg gtcggggcgg ggcggggctc gggggactgg gctgaccgcg ggggcggggc       720
     cagggtctca caccctccag aggatgtctg gctgcgacct ggggcccgac gggcgcctcc       780
     tccgcgggta tgaccagtcc gcctacgacg gcaaggatta catcgccctg aacgaggacc       840
     tgcgctcctg gaccgccgcg gacaccgcgg ctcagatcac tcagcgcaag ttggaggcgg       900
     cccgtgcggc ggagcagctg agagcctacc tggagggcac gtgcgtggag tggctccgca       960
     gatacctgga gaacgggaag gagacgctgc agcgcgcagg taccaggggc agtggggagc      1020
     cttccccatc tcctatagat ctcccgggat ggcctcccac gaggagggga ggaaaatggg      1080
     atcagcactg gaatatcgcc ctcccttgaa tggagaatgg catgagtttt cctgagtttc      1140
     ctctgagggc cccctctgct ctctaggaca attaagggat gaagtctctg aggaaatgga      1200
     ggggaagaca gtccctggaa tactgatcag gggtctcctt tgaccacttt gaccactgca      1260
     gcagctgtgg tcaggctgct gacctttctc tcaggccttg ttctctgcct cacactcaat      1320
     gtgtctgaag gtttgattcc agcttttctg agtcctgcag cctccactca ggtcaggacc      1380
     agaagtcgct gttcctccct cagagactag aactttccaa tgaataggag attatcccag      1440
     gtgcctgtgt ccaggctggc gtctgggttc tgtgccgcct tccccacccc aggtgtcctg      1500
     tccattctca ggatggtcac atgggcgctg ctggagtgtc ccaagagaga tgcaaagtgt      1560
     ctgaattttc tgactcttcc cgtcagaacc cccaaagaca cacgtgaccc accaccccct      1620
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac      1680
     actgacctgg cagcgggatg gggaggacca gacccaggac accgagcttg tggagaccag      1740
     gccagcagga gatggaacct tccagaagtg ggcagctgtg gtggtgcctt ctggacaaga      1800
     gcagagatac acgtgccata tgcagcacga ggggctgcaa gagcccctca ccctgagctg      1860
     gg                                                                     1862
