
ID   GQ241930; SV 1; linear; genomic DNA; STD; HUM; 1858 BP.
AC   GQ241930;
DT   14-JUL-2009 (Rel. 101, Created)
DT   28-OCT-2009 (Rel. 102, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw* 08 variant allele,
DE   exons 1 through 4 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1858
RX   DOI; 10.1111/j.1399-0039.2009.01354.x.
RX   PUBMED; 19845905.
RA   Deng Z.H., Wang D.M., Xu Y.P.;
RT   "Cloning and sequencing analysis of a novel HLA-Cw*08 variant allele,
RT   Cw*0827";
RL   Tissue Antigens 74(5):458-460(2009).
RN   [2]
RP   1-1858
RA   Deng Z., Wang D.;
RT   "Identification of a novel HLA-Cw*08 variant allele with 5 nucleotide
RT   changes on the Cw*0802 allele basis";
RL   Unpublished.
RN   [3]
RP   1-1858
RA   Deng Z., Wang D.;
RT   ;
RL   Submitted (03-JUN-2009) to the INSDC.
RL   Immunogenetics laboratory, Shenzhen Blood Center, Nigang Xi Road, Meigang
RL   Nan Street, Shenzhen, Guangdong 518035, China
DR   MD5; 65bb4dd54bafbbef116cf3fa4f7632b2.
FH   Key             Location/Qualifiers
FT   source          1..1858
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.31"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: ccaatcagcgtctccgcagtc, rev_seq:
FT                   accccycatycccctccttac"
FT                   /note="Chinese Han Individual"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>1858
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw* 08 variant"
FT   mRNA            join(<1..73,204..473,720..995,1583..>1858)
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw* 08 variant"
FT                   /product="MHC class I antigen"
FT   CDS             join(1..73,204..473,720..995,1583..>1858)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw* 08 variant"
FT                   /product="MHC class I antigen"
FT                   /db_xref="IMGT/HLA:C*08:27"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:C7E2U5"
FT                   /protein_id="ACT22749.1"
FT                   TCHVQHEGLPEPLTLRW"
FT   exon            <1..73
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw* 08 variant"
FT                   /number=1
FT   exon            204..473
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw* 08 variant"
FT                   /number=2
FT   variation       503
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0802"
FT                   /replace="a"
FT   exon            720..995
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw* 08 variant"
FT                   /number=3
FT   variation       861
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0802"
FT                   /replace="a"
FT   variation       914
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0802"
FT                   /replace="c"
FT   variation       1137
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0802"
FT                   /replace="t"
FT   variation       1338
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0802"
FT                   /replace="a"
FT   exon            1583..>1858
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw* 08 variant"
FT                   /number=4
SQ   Sequence 1858 BP; 352 A; 571 C; 612 G; 323 T; 0 other;
     atgcgggtca tggcgccccg aaccctcatc ctgctgctct cgggagccct ggccctgacc        60
     gagacctggg cctgtgagtg cgaggttggg agggaaacgg cctctgcgga gaggagcgag       120
     gggcccgccc ggcgagggcg caggacccgg ggagccgcgc agggaggagg gtcgggcggg       180
     tctcagcccc tcctcgcccc caggctccca ctccatgagg tatttctaca ccgccgtgtc       240
     ccggcccggc cgcggagagc cccgcttcat cgcagtgggc tacgtggacg acacgcagtt       300
     cgtgcagttc gacagcgacg ccgcgagtcc aagaggggag ccgcgggcgc cgtgggtgga       360
     gcaggagggg ccggagtatt gggaccggga gacacagaag tacaagcgcc aggcacagac       420
     tgaccgagtg agcctgcgga acctgcgcgg ctactacaac cagagcgagg ccggtgagtg       480
     accccggccc ggggcgcagg tcccgacccc tccccatccc ccacggacgg cccgggtcgc       540
     cccgagtctc ccggtctgag atccaccccg aggctgcgga acccgcccag accctcgacc       600
     ggagagagcc ccagtcacct ttacccggtt tcattttcag tttaggccaa aatccccgcg       660
     ggttggtcgg ggctggggcg gggctcgggg gacggggctg accacggggg cggggccagg       720
     gtctcacacc ctccagagga tgtatggctg cgacctgggg cccgacgggc gcctcctccg       780
     cgggtataac cagttcgcct acgacggcaa ggattacatc gccctgaatg aggacctgcg       840
     ctcctggacc gccgcggaca cggcggctca gatcacccag cgcaagtggg aggcggcccg       900
     tgaggcggag cagtggagag cctacctgga gggcacgtgc gtggagtggc tccgcagata       960
     cctggagaac gggaagaaga cgctgcagcg cgcgggtacc aggggcagtg gggagccttc      1020
     cccatctcct gtagatctcc cgggatggcc tcccacgagg aggggaggaa aatgggatca      1080
     gcgctggaat atcgccctcc cttgaatgga gaatgggatg agttttcctg agtttcctct      1140
     gagggccccc tctgctctct aggacaatta agggatgaag tccttgagga aatggagggg      1200
     aagacagtcc ctggaatact gatcaggggt cccctttgac cactttgacc actgcagcag      1260
     ctgtggtcag gctgctgacc tttctctcag gccttgttct ctgcctcacg ctcaatgtgt      1320
     ttaaaggttt gattccagct tttctgagtc cttcggcctc cactcaggtc aggaccagaa      1380
     gtcgctgttc ctccctcaga gactagaact ttccaatgaa taggagatta tcccaggtgc      1440
     ctgtgtccag gctggcgtct gggttctgtg cccccttccc caccccaggt gtcctgtcca      1500
     ttctcaggat ggtcacatgg gcactgttgg agtgtcgcaa gagagataca aagtgtctga      1560
     attttctgac tcttcccgtc agaacaccca aagacacacg tgacccacca tcccgtctct      1620
     gaccatgagg ccaccctgag gtgctgggcc ctgggcttct accctgcgga gatcacactg      1680
     acctggcagc gggatggcga ggaccaaact caggacaccg agcttgtgga gaccaggcca      1740
     gcaggagatg gaaccttcca gaagtgggca gctgtggtgg tgccttctgg agaagagcag      1800
     agatacacgt gccatgtgca gcacgagggg ctgccagagc ccctcaccct gagatggg        1858