
ID   FR775382; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   FR775382;
DT   21-JAN-2011 (Rel. 107, Created)
DT   21-JAN-2011 (Rel. 107, Last updated, Version 1)
DE   Homo sapiens partial HLA-DRB1 gene for MHC class II antigen, allele
DE   HLA-DRB1*11_1, exon 2
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Masson D.M.;
RT   ;
RL   Submitted (17-JAN-2011) to the INSDC.
RL   Masson D.M., EFS Rhone Alpes, HLA Laboratory, BP35, 38701, FRANCE.
RN   [2]
RA   Masson D.;
RT   "x";
RL   Unpublished.
DR   MD5; 16c03f9e4d1be8f6b14d80eecea10cd3.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P 5' : 1RBB40, fwd_seq:
FT                   agcactaaggaagggttcac, rev_name: P3' : 2RB39, rev_seq:
FT                   tgtcacctccccacagagt"
FT                   /db_xref="taxon:9606"
FT   exon            <1..>270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*11_1"
FT                   /number=2
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*11_1"
FT                   /product="MHC class II antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:E9ABI6"
FT                   /db_xref="IMGT/HLA:DRB1*11:74:02"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:E9ABI6"
FT                   /protein_id="CBY93687.1"
SQ   Sequence 270 BP; 58 A; 62 C; 97 G; 53 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga cagatacttc tataaccaag aggagtacgt gcgcttcgac agcgacgtgg       120
     gggagttccg ggcggtgacg gagctggggc ggcctgatga ggagtactgg aacagccaga       180
     aggacttcct ggaagacagg cgggccgcgg tggacaccta ctgcagacac aactacgagg       240
     ttggtgagag cttcacggtg cagcggcgag                                        270