
EBI Dbfetch

ID   FR716516; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   FR716516;
DT   28-OCT-2010 (Rel. 106, Created)
DT   28-OCT-2010 (Rel. 106, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, allele HLA-B*15,
DE   exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Masson D.M.;
RT   ;
RL   Submitted (25-OCT-2010) to the INSDC.
RL   Masson D.M., EFS Rhone Alpes, HLA Laboratory, BP35, 38701, FRANCE.
RN   [2]
RA   Masson D.;
RT   "x";
RL   Unpublished.
DR   MD5; e1ff724ff25bf3281369a7b2c15aefe9.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5' : GlyA10, fwd_seq:
FT                   cctcctgctgctctcggga, rev_name: P3' : Exon5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:E3Q1J2"
FT                   /db_xref="IMGT/HLA:B*15:01:21"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:E3Q1J2"
FT                   /protein_id="CBX45600.1"
FT   exon            <1..270
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..>1022
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15"
FT                   /number=4
SQ   Sequence 1022 BP; 179 A; 257 C; 272 G; 110 T; 204 other;
     gctcccactc catgaggtat ttctacaccg ccatgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cccagttcgt gaggttcgac agcgacgccg       120
     cgagtccgag gatggcgccc cgggcgccat ggatagagca ggaggggccg gagtattggg       180
     accgggagac acagatctcc aagaccaaca cacagactta ccgagagagc ctacggaacc       240
     tgcgcggcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagagg atgtacggct gcgacgnggg gccggacggg       420
     cgcctcctcc gcgggcatga ccagtccgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctga gctcctggac cgcggcggac acggcggctc agatcaccca gcgcaagtng       540
     gaggcggccc gtgaggcgga gcagtggaga gcctacctgg agggcctgtg cnnggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcgcggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaccc cccaaagaca catgtgaccc accaccccat       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gcgaggacca aactcaggac accgagcttg tggagaccag       900
     accagcagga gatagaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagaaga       960
     gcagagatac acatgccatg tacagcatga ggggctgccg aagcccctca ccctgagatg      1020
     gg                                                                     1022
