
ID   FR716513; SV 1; linear; genomic DNA; STD; HUM; 646 BP.
AC   FR716513;
DT   28-OCT-2010 (Rel. 106, Created)
DT   28-OCT-2010 (Rel. 106, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, allele HLA-B*40_1,
DE   exons 2-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-646
RA   Masson D.M.;
RT   ;
RL   Submitted (25-OCT-2010) to the INSDC.
RL   Masson D.M., EFS Rhone Alpes, HLA Laboratory, BP35, 38701, FRANCE.
RN   [2]
RA   Masson D.;
RT   "x";
RL   Unpublished.
DR   MD5; 17607af053bd7e2b9485748f702361fa.
FH   Key             Location/Qualifiers
FT   source          1..646
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5' : ALA A20, fwd_seq:
FT                   gaggatgcgggtcacggca, rev_name: P3' : Exon5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..>646)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40_1"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:E3Q1I9"
FT                   /db_xref="IMGT/HLA:B*40:163"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:E3Q1I9"
FT                   /protein_id="CBX45597.1"
FT                   VEWLRRHLENGKETLQRA"
FT   exon            <1..270
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40_1"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..>646
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40_1"
FT                   /number=3
SQ   Sequence 646 BP; 112 A; 175 C; 189 G; 70 T; 100 other;
     gctcccactc catgaggtat ttccacaccg ccatgtcccg gcccggccgc ggggagcccc        60
     gcttcatcac cgtgggctac gtggacgaca cgctgttcgt gaggttcgac agcgacgcca       120
     cgagtccgag gaaggagccg cgggcgccat ggatagagca ggaggggccg gagtattggg       180
     accgggagac acagatctcc aagaccaaca cacagactta ccgagagagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagagg atgtacggct gcgacgtggg gccggacggg       420
     cgcctcctcc gcgggcataa ccagtacgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctgc gctcctggac cgccgcggac acggcggctc agatctccca gcgcaagttg       540
     gaggcggccc gtgtggcgga gcagctgaga gcctacctgg agggcacgtg cgtggagtgg       600
     ctccgcagac acctggagaa cgggaaggag acgctgcagc gcgcgg                      646