
EBI Dbfetch

ID   FR716504; SV 1; linear; genomic DNA; STD; HUM; 2281 BP.
AC   FR716504;
DT   28-OCT-2010 (Rel. 106, Created)
DT   28-OCT-2010 (Rel. 106, Last updated, Version 1)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, allele
DE   HLA-C*07New, exons 1-7
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-2281
RA   Tourne S.;
RT   ;
RL   Submitted (23-OCT-2010) to the INSDC.
RL   Tourne S., Laboratoire d Histocompatibilite, EFS Alsace, 10 rue Spielmann,
RL   67065 Strasbourg Cedex, FRANCE.
RN   [2]
RA   Weschler B., Bert S., Leisenbach R., Schell A., Froelich N., Tourne S.,
RA   Hanau D.;
RT   "The new HLA-C*07 allele has a nucleotide change from HLA-C*07:01 alleles
RT   (a C to T ) at position 477 (exon 3), which is silent";
RL   Unpublished.
DR   MD5; 9af1ea90ee37d57483e5bd99fa645ba6.
FH   Key             Location/Qualifiers
FT   source          1..2281
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: GlyG-9 (intron 1), fwd_seq:
FT                   ctgctgctctcgggaggc, rev_name: P3'UT (3'UT), rev_seq:
FT                   aaatcctgcatctcagtccca"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..26,157..426,677..952,1142..1417,1542..1655,
FT                   2093..2125,2234..>2281)
FT                   /codon_start=2
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:E3Q1I0"
FT                   /db_xref="IMGT/HLA:C*07:01:27"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:E3Q1I0"
FT                   /protein_id="CBX45566.1"
FT                   ESLITCK"
FT   exon            <1..26
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=1
FT   intron          27..156
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=1
FT   exon            157..426
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=2
FT   intron          427..676
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=2
FT   exon            677..952
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=3
FT   intron          953..1141
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=3
FT   gap             977..1076
FT                   /estimated_length=unknown
FT   exon            1142..1417
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=4
FT   intron          1418..1541
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=4
FT   gap             1442..1541
FT                   /estimated_length=unknown
FT   exon            1542..1655
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=5
FT   intron          1656..2092
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=5
FT   exon            2093..2125
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=6
FT   intron          2126..2233
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=6
FT   exon            2234..>2281
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07New"
FT                   /number=7
SQ   Sequence 2281 BP; 385 A; 627 C; 689 G; 380 T; 200 other;
     cctggccctg accgagacct gggcctgtga gtgcggggtt gggagggaag cggcctctgc        60
     ggagaggagc gaggggcccg cccggcgagg gcgcaggacc cggggagccg cgcagggagg       120
     tgggtcgggc gggtctcagc ccctcctcgc ccccaggctc ccactccatg aggtatttcg       180
     acaccgccgt gtcccggccc ggccgcggag agccccgctt catctcagtg ggctacgtgg       240
     acgacacgca gttcgtgcgg ttcgacagcg acgccgcgag tccgagaggg gagccgcggg       300
     cgccgtgggt ggagcaggag gggccggagt attgggaccg ggagacacag aactacaagc       360
     gccaggcaca ggctgaccga gtgagcctgc ggaacctgcg cggctactac aaccagagcg       420
     aggacggtga gtgaccccgg cccggggcgc aggtcacgac ccctccccat cccccacgga       480
     cggcccgggt cgccccgagt ctccccgtct gagatccacc ccaaggtgga tctgcggaac       540
     ccgcccagac cctcgaccgg agagagcccc agtcgccttt acccggtttc attttcggtt       600
     taggccaaaa tccccgcggg ttggtcgggg cggggcgggg ctcgggggac tgggctgacc       660
     gcgggggcgg ggccagggtc tcacaccctc cagaggatgt atggctgcga cctggggccc       720
     gacgggcgcc tcctccgcgg gtatgaccag tccgcctacg acggcaagga ttacatcgcc       780
     ctgaacgagg acctgcgctc ctggaccgct gcggacaccg cggctcagat cacccagcgc       840
     aagttggagg cggcccgtgc ggcggagcag ctgagagcct acctggaggg cacgtgcgtg       900
     gagtggctcc gcagatacct ggagaacggg aaggagacgc tgcagcgcgc aggtaccagg       960
     ggcagtgggg agccttnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn      1020
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnntggg      1080
     cgctgctgga gtgtcccaag agagatgcaa agtgtctgaa ttttctgact cttcccgtca      1140
     gaacccccaa agacacacgt gacccaccac cccctctctg accatgaggc caccctgagg      1200
     tgctgggccc tgggcttcta ccctgcggag atcacactga cctggcagcg ggatggggag      1260
     gaccagaccc aggacaccga gcttgtggag accaggccag caggagatgg aaccttccag      1320
     aagtgggcag ctgtggtggt gccttctgga caagagcaga gatacacgtg ccatatgcag      1380
     cacgaggggc tgcaagagcc cctcaccctg agctggggta aggaggggaa tggggggtca      1440
     cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn      1500
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ncttcccagc ctaccatccc      1560
     catcatgggc atcgttgctg gcctggctgt cctggttgtc ctagctgtcc ttggagctgt      1620
     ggtcaccgct atgatgtgta ggaggaagag ctcaggtagg gaaggggtga agagcggggt      1680
     ctgggttttc ttgtcccact gggagtttca agccccaggt agaagtgtgc cccgccttgt      1740
     tactggaagc accatccaca catgggccat cccagcctgg gaccctgtgt gccagcactt      1800
     actcttttgt gacacatgtg acaatgaagg acggatgtat caccttgatg attatggtgt      1860
     tggggtcctg attccagcat tcatgagtca ggggaaggtc cctgctaagg acagacctta      1920
     ggagggcagt tggtccagaa cccacaactg ctttccccat gtttcctgat cctgccctgg      1980
     gtctgcagtc gtagttctgg aaacttctct tgggtccaag actaggaggt tcccctaaga      2040
     tcacatggcc ctgcctcctc ccagtcccct catagggcat tttcttccca caggtggaaa      2100
     aggagggagc tgctctcagg ctgcgtgtaa gtgatggcgg cgggcgtgtg gaggagctca      2160
     cctactccat aattcctctt gtcccacatc tcctgcgggc tctgaccagg tctttttttt      2220
     tgttctaccc caggcagcaa cagtgcccag ggctctgatg agtctctcat cacttgtaaa      2280
     g                                                                      2281
