
EBI Dbfetch

ID   FR690871; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   FR690871;
DT   10-SEP-2010 (Rel. 106, Created)
DT   10-SEP-2010 (Rel. 106, Last updated, Version 1)
DE   Homo sapiens partial HLA-A gene for MHC class I antigen, allele HLA-A*29_1,
DE   exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Masson D.M.;
RT   ;
RL   Submitted (09-SEP-2010) to the INSDC.
RL   Masson D.M., EFS Rhone Alpes, HLA Laboratory, BP35, 38701, FRANCE.
RN   [2]
RA   Masson D.M.;
RT   "x";
RL   Unpublished.
DR   MD5; 2aa9f7199f88530922c9a37b95ac4075.
DR   Ensembl-Gn; ENSG00000231834; homo_sapiens.
DR   Ensembl-Tr; ENST00000450342; homo_sapiens.
DR   Ensembl-Tr; ENST00000456012; homo_sapiens.
DR   Ensembl-Tr; ENST00000470780; homo_sapiens.
DR   Ensembl-Tr; ENST00000550728; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5'LeuT11, fwd_seq:
FT                   aaccctcctcctgctactctt, rev_name: P3'IN6A, rev_seq:
FT                   gcccacagaasatgtggctag"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*29_1"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:E0WN82"
FT                   /db_xref="IMGT/HLA:A*29:02:07"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:E0WN82"
FT                   /protein_id="CBX19770.1"
FT   exon            <1..270
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*29_1"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*29_1"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..>1022
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*29_1"
FT                   /number=4
SQ   Sequence 1022 BP; 165 A; 245 C; 286 G; 126 T; 200 other;
     gctcccactc catgaggtat ttcaccacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggtttgac agcgacgccg       120
     cgagccagag gatggagccg cgggcaccgt ggatagagca ggaggggccg gagtattggg       180
     acctgcagac acggaatgtg aaggcccagt cacagactga ccgagcgaac ctggggaccc       240
     tgcgcggcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn gttctcacac catccagatg atgtatggct gcgacgtggg gtcggacggg       420
     cgcttcctcc gcgggtaccg gcaggacgcc tacgacggca aggattacat cgccttgaac       480
     gaggacctgc gctcttggac cgcggcggac atggcggctc agatcaccca gcgcaagtgg       540
     gaggcggccc gtgtggcgga gcagttgaga gcctacctgg agggcacgtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcacggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnacgc ccccaagacg catatgactc accatgctgt       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgagc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gggaggacca gacccaggac acggagcttg tggagaccag       900
     gcctgcaggg gatggaacct tccagaagtg ggcgtctgtg gtggtgcctt ctggacagga       960
     gcagagatac acctgccatg tgcagcatga gggtctgccc aagcccctca ccctgagatg      1020
     gg                                                                     1022
