
ID   FR682908; SV 1; linear; genomic DNA; STD; HUM; 1101 BP.
AC   FR682908;
DT   26-AUG-2010 (Rel. 105, Created)
DT   26-AUG-2010 (Rel. 105, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, allele
DE   HLA-B*51new, exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1101
RA   Tourne S.;
RT   ;
RL   Submitted (17-AUG-2010) to the INSDC.
RL   Tourne S., EFS Alsace, Laboratoire d'Histocompatibilite, 10 rue Spielmann,
RL   67065 Strasbourg Cedex, FRANCE.
RN   [2]
RA   Froelich N., Weschler B., Schell A., Leisenbach R., Tourne S., Hanau D.;
RT   "The new HLA-B*51 allele has a nucleotide change from HLA-B*51:01:01 at
RT   position 375 in exon 2";
RL   Unpublished.
DR   MD5; f3646a8b48db4f2c5ca32c0d56bbe8d8.
FH   Key             Location/Qualifiers
FT   source          1..1101
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="Blood"
FT                   /PCR_primers="fwd_name: Int1B (T75A77), fwd_seq:
FT                   caggaaacagctagaccgggggcgcaggacctga, rev_name: Exon 5B,
FT                   rev_seq: gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,426..701,826..>1101)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:B*51:105"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="UniProtKB/TrEMBL:E0WMN3"
FT                   /protein_id="CBW47478.1"
FT   exon            1..270
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /number=2
FT   intron          271..425
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /number=2
FT   gap             299..398
FT                   /estimated_length=unknown
FT   exon            426..701
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /number=3
FT   intron          702..825
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /number=3
FT   gap             714..813
FT                   /estimated_length=unknown
FT   exon            826..>1101
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /number=4
SQ   Sequence 1101 BP; 192 A; 281 C; 302 G; 126 T; 200 other;
     gctcccactc catgaggtat ttctacaccg ccatgtcccg gcccggctgc ggggagcccc        60
     gcttcattgc agtgggctac gtggacgaca cccagttcgt gaggttcgac agcgacgccg       120
     cgagtccgag gacggagccc cgggcgccat ggatagagca ggaggggccg gagtattggg       180
     accggaacac acagatcttc aagaccaaca cacagactta ccgagagaac ctgcggatcg       240
     cgctccgcta ctacaaccag agcgaggccg gtgagtgacc ccggcccggg gcgcaggtnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnncg gtgctgaccg cggggccggg       420
     gccagggtct cacacttggc agacgatgta tggctgcgac gtggggccgg acgggcgcct       480
     cctccgcggg cataaccagt acgcctacga cggcaaagat tacatcgccc tgaacgagga       540
     cctgagctcc tggaccgcgg cggacaccgc ggctcagatc acccagcgca agtgggaggc       600
     ggcccgtgag gcggagcagc tgagagccta cctggagggc ctgtgcgtgg agtggctccg       660
     cagacacctg gagaacggga aggagacgct gcagcgcgcg ggtaccaggg gcannnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       780
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnntcttccc atcagacccc ccaaagacac       840
     acgtgaccca ccaccccgtc tctgaccatg aggccaccct gaggtgctgg gccctgggct       900
     tctaccctgc ggagatcaca ctgacctggc agcgggatgg cgaggaccaa actcaggaca       960
     ctgagcttgt ggagaccaga ccagcaggag atagaacctt ccagaagtgg gcagctgtgg      1020
     tggtgccttc tggagaagag cagagataca catgccatgt acagcatgag gggctgccga      1080
     agcccctcac cctgagatgg g                                                1101