
ID   FN908205; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   FN908205;
DT   10-JUN-2010 (Rel. 105, Created)
DT   24-OCT-2011 (Rel. 110, Last updated, Version 2)
DE   Homo sapiens partial HLA-DRB1 gene for MHC class II antigen, allele
DE   HLA-DRB1*14:12 variant, exon 2
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Momynaliev K.;
RT   ;
RL   Submitted (04-JUN-2010) to the INSDC.
RL   Momynaliev K., Biochemistry, National Center for Biotechnology, Valikhanov
RL   str., 13/1, Astana, 010000, KAZAKHSTAN.
RN   [2]
RX   DOI; 10.1111/j.1399-0039.2010.01611.x.
RX   PUBMED; 21299539.
RA   Kuranov A.B., Mukhamedyarov D.A., Momynaliev K.T.;
RT   "Identification of new HLA-DRB1 alleles in Kazakh individuals";
RL   Tissue Antigens 77(3):263-264(2011).
DR   MD5; 0c2c5e0ec5955a7316f43f52b74e402c.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /country="Kazakhstan"
FT                   /PCR_primers="fwd_name: DRB1-52a, fwd_seq:
FT                   cccacagcacgtttcttggagtactctac, rev_name: DRB12, rev_seq:
FT                   gccgctgcactgtgaagctc"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14:12 variant"
FT                   /product="MHC class II antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:D7GN79"
FT                   /db_xref="IMGT/HLA:DRB1*14:12:02"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:D7GN79"
FT                   /protein_id="CBM42732.1"
FT   exon            1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14:12 variant"
FT                   /number=2
SQ   Sequence 270 BP; 59 A; 64 C; 97 G; 50 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga gagatacttc cataaccagg aggagaacgt gcgcttcgac agcgacgtgg       120
     gggagtaccg ggcggtgacg gagctggggc ggcctgatgc cgagtactgg aacagccaga       180
     aggacctcct ggaagacagg cgggccctgg tggacaccta ctgcagacac aactacgggg       240
     ttgtggagag cttcacagtg cagaggcgag                                        270