
EBI Dbfetch

ID   FN667789; SV 1; circular; genomic DNA; STD; PHG; 175720 BP.
AC   FN667789;
DT   07-APR-2010 (Rel. 104, Created)
DT   21-APR-2010 (Rel. 104, Last updated, Version 2)
DE   Campylobacter phage CPt10, complete genome
KW   complete genome.
OS   Campylobacter phage CPt10
OC   Viruses; dsDNA viruses, no RNA stage; Caudovirales; Myoviridae.
RN   [1]
RP   1-175720
RA   Aslett M.A.;
RT   ;
RL   Submitted (03-FEB-2010) to the INSDC.
RL   Aslett M.A., Pathogen Sequencing Unit, Wellcome Trust Sanger Institute,
RL   Wellcome Trust Genome Campus, Hinxton, Cambridge, Cambridgeshire. CB10 1SA,
RN   [2]
RX   DOI; 10.1186/1471-2164-11-214.
RX   PUBMED; 20353581.
RA   Timms A.R., Cambray-Young J., Scott A.E., Petty N.K., Connerton P.L.,
RA   Clarke L., Seeger K., Quail M., Cummings N., Maskell D.J., Thomson N.R.,
RA   Connerton I.F.;
RT   "Evidence for a lineage of virulent bacteriophages that target
RT   Campylobacter";
RL   BMC Genomics 11:214-214(2010).
DR   MD5; e232d98d255542a19ddad5c1495b2f04.
DR   EuropePMC; PMC2853527; 20353581.
DR   EuropePMC; PMC2993671; 21029436.
DR   EuropePMC; PMC3322345; 22284308.
DR   RFAM; RF00005; tRNA.
FH   Key             Location/Qualifiers
FT   source          1..175720
FT                   /organism="Campylobacter phage CPt10"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:722418"
FT   CDS             78..2273
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0001"
FT                   /product="Putative phage DNA packaging protein (terminase)"
FT                   /db_xref="GOA:D5GVI7"
FT                   /db_xref="InterPro:IPR003586"
FT                   /db_xref="InterPro:IPR004921"
FT                   /db_xref="InterPro:IPR006141"
FT                   /db_xref="InterPro:IPR028992"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVI7"
FT                   /protein_id="CBJ94203.1"
FT   misc_feature    267..332
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1141.000, SD 3.07 at aa 64-85, sequence
FT                   /inference="protein motif:helix-turn-helix motif"
FT   misc_feature    903..926
FT                   /note="PS00881 Protein splicing signature."
FT                   /inference="protein motif:Prosite:PS00881"
FT   CDS             2326..3060
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0011"
FT                   /product="Putative base plate hub assembly catalyst"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVI8"
FT                   /protein_id="CBJ94204.1"
FT   CDS             complement(3088..3507)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0021"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVI9"
FT                   /protein_id="CBJ94205.1"
FT   misc_feature    complement(3436..3507)
FT                   /note="Signal peptide predicted for CPt10_0021 by SignalP
FT                   2.0 HMM (Signal peptide probability 0.857) with cleavage
FT                   site probability 0.794 between residues 24 and 25"
FT                   /inference="protein motif:SignalP 2.0"
FT   misc_feature    complement(3451..3483)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT                   /inference="protein motif:Prosite:PS00013"
FT   CDS             3621..3809
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0031"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ0"
FT                   /protein_id="CBJ94206.1"
FT                   LYCGGYSDSLNKIKYLY"
FT   CDS             3889..5400
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0041"
FT                   /product="Putative phage DNA topoisomerase (large subunit)"
FT                   /db_xref="GOA:D5GVJ1"
FT                   /db_xref="InterPro:IPR001241"
FT                   /db_xref="InterPro:IPR003594"
FT                   /db_xref="InterPro:IPR013506"
FT                   /db_xref="InterPro:IPR013759"
FT                   /db_xref="InterPro:IPR013760"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ1"
FT                   /protein_id="CBJ94207.1"
FT   misc_feature    4015..4443
FT                   /note="HMMPfam hit to PF02518, ATP-binding
FT                   region,ATPase-like, score 1.7e-05"
FT                   /inference="protein motif:PFAM:PF02518"
FT   misc_feature    4579..5037
FT                   /note="HMMPfam hit to PF00204, DNA topoisomerase, type IIA,
FT                   subunit B, region 2, score 4.8e-07"
FT                   /inference="protein motif:PFAM:PF00204"
FT   CDS             5400..5933
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0051"
FT                   /product="hypothetical phage protein"
FT                   /note="nucleoside triphosphate hydrolase motif"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ2"
FT                   /protein_id="CBJ94208.1"
FT                   RILKIIETIKSKTN"
FT   misc_feature    5427..5450
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   CDS             5945..6403
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0061"
FT                   /product="Putative phage dUTP pyrophosphatase"
FT                   /db_xref="GOA:D5GVJ3"
FT                   /db_xref="InterPro:IPR008180"
FT                   /db_xref="InterPro:IPR029054"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ3"
FT                   /protein_id="CBJ94209.1"
FT   misc_feature    5978..6394
FT                   /note="HMMPfam hit to PF00692, DeoxyUTP
FT                   pyrophosphatase,score 3.8e-17"
FT                   /inference="protein motif:PFAM:PF00692"
FT   misc_feature    6377..6400
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   CDS             6445..6687
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0071"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ4"
FT                   /protein_id="CBJ94210.1"
FT   CDS             6700..7776
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0081"
FT                   /product="Putative DNA primase subunit"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ5"
FT                   /protein_id="CBJ94211.1"
FT                   ELVFKKGFGALLHLKSLL"
FT   CDS             join(7773..9008,9007..9384)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0091"
FT                   /product="Type III Restriction Modification Methylase
FT                   (pseudogene)"
FT                   /db_xref="PSEUDO:CBJ94212.1"
FT   misc_feature    8094..8996
FT                   /note="HMMPfam hit to PF01555, DNA methylase N-4/N-6,score
FT                   9.6e-56"
FT                   /inference="protein motif:PFAM:PF01555"
FT   misc_feature    8103..8123
FT                   /note="PS00092 N-6 Adenine-specific DNA methylases
FT                   signature."
FT                   /inference="protein motif:Prosite:PS00092"
FT   CDS             9562..10476
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0101"
FT                   /product="Putative DNA polymerase accessory factor (sliding
FT                   clamp loader)"
FT                   /db_xref="GOA:D5GVJ7"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ7"
FT                   /protein_id="CBJ94213.1"
FT   misc_feature    9706..10017
FT                   /note="HMMPfam hit to PF00004, AAA ATPase, core, score
FT                   1.3e-07"
FT                   /inference="protein motif:PFAM:PF00004"
FT   CDS             10486..11544
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0111"
FT                   /product="Putative phage RNase H"
FT                   /db_xref="GOA:D5GVJ8"
FT                   /db_xref="InterPro:IPR020046"
FT                   /db_xref="InterPro:IPR029060"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ8"
FT                   /protein_id="CBJ94214.1"
FT                   EMTPWNVDFSKI"
FT   misc_feature    10831..10950
FT                   /note="HMMPfam hit to PF02739, 5'-3' exonuclease, score
FT                   3.1e-09"
FT                   /inference="protein motif:PFAM:PF02739"
FT   CDS             11604..12152
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0121"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR016040"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVJ9"
FT                   /protein_id="CBJ94215.1"
FT   CDS             12196..12828
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0131"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK0"
FT                   /protein_id="CBJ94216.1"
FT   CDS             12893..13570
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0141"
FT                   /product="Putative baseplate hub subunit protein"
FT                   /db_xref="InterPro:IPR024364"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK1"
FT                   /protein_id="CBJ94217.1"
FT                   LKR"
FT   CDS             13585..14283
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0151"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK2"
FT                   /protein_id="CBJ94218.1"
FT                   NQASNQTANS"
FT   CDS             14416..15210
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0161"
FT                   /product="hypothetical phage protein"
FT                   /note="note the Radical SAM family domain"
FT                   /db_xref="GOA:D5GVK3"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR024924"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK3"
FT                   /protein_id="CBJ94219.1"
FT   misc_feature    14509..15045
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 0.0059"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             15210..15470
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0171"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK4"
FT                   /protein_id="CBJ94220.1"
FT   misc_feature    join(15270..15338,15381..15449)
FT                   /note="2 probable transmembrane helices predicted for
FT                   CPt10_0171 by TMHMM2.0 at aa 21-43 and 58-80"
FT                   /inference="protein motif:TMHMM 2.0"
FT   misc_feature    15381..15413
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT                   /inference="protein motif:Prosite:PS00013"
FT   CDS             15480..16250
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0181"
FT                   /product="hypothetical phage protein"
FT                   /note="note the sugar dehydrogenase domain"
FT                   /db_xref="GOA:D5GVK5"
FT                   /db_xref="InterPro:IPR008927"
FT                   /db_xref="InterPro:IPR013328"
FT                   /db_xref="InterPro:IPR014026"
FT                   /db_xref="InterPro:IPR016040"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK5"
FT                   /protein_id="CBJ94221.1"
FT   CDS             16275..16652
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0191"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK6"
FT                   /protein_id="CBJ94222.1"
FT   CDS             16652..17590
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0201"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK7"
FT                   /protein_id="CBJ94223.1"
FT   CDS             17625..17786
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0211"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK8"
FT                   /protein_id="CBJ94224.1"
FT                   KTKTKLKV"
FT   CDS             17788..18891
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0221"
FT                   /product="hypothetical phage protein"
FT                   /note="note the Radical SAM family domain"
FT                   /db_xref="GOA:D5GVK9"
FT                   /db_xref="InterPro:IPR007197"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVK9"
FT                   /protein_id="CBJ94225.1"
FT   misc_feature    17812..18294
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 1.2e-05"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             18976..19308
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0231"
FT                   /product="hypothetical phage protein"
FT                   /note="Possible phage clamp loader subunit"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL0"
FT                   /protein_id="CBJ94226.1"
FT                   DSIRRS"
FT   CDS             complement(19336..19941)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0241"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL1"
FT                   /protein_id="CBJ94227.1"
FT   CDS             20006..21517
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0251"
FT                   /product="hypothetical phage protein"
FT                   /note="note the nucleotidylyl transferase domain"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL2"
FT                   /protein_id="CBJ94228.1"
FT   misc_feature    21032..21388
FT                   /note="HMMPfam hit to PF01467, Cytidylyltransferase, score
FT                   0.0044"
FT                   /inference="protein motif:PFAM:PF01467"
FT   CDS             21541..22728
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0261"
FT                   /product="possible virion structural protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL3"
FT                   /protein_id="CBJ94229.1"
FT   CDS             22772..22948
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0271"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL4"
FT                   /protein_id="CBJ94230.1"
FT                   VNEPSNTNIKHKI"
FT   misc_feature    22775..22843
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_0271 by TMHMM2.0 at aa 2-24"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             22958..23488
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0281"
FT                   /product="Possible EndoVII packaging and recombination
FT                   endonuclease"
FT                   /db_xref="GOA:D5GVL5"
FT                   /db_xref="InterPro:IPR004211"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL5"
FT                   /protein_id="CBJ94231.1"
FT                   KTKDLLISYGLYS"
FT   misc_feature    23000..23287
FT                   /note="HMMPfam hit to PF02945, Recombination endonuclease
FT                   VII, score 2.7e-05"
FT                   /inference="protein motif:PFAM:PF02945"
FT   CDS             23549..25246
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0291"
FT                   /product="Possible phage prohead assembly initiator
FT                   protein/portal protein"
FT                   /db_xref="InterPro:IPR010823"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL6"
FT                   /protein_id="CBJ94232.1"
FT   misc_feature    23549..25063
FT                   /note="HMMPfam hit to PF07230, Bacteriophage T4-like capsid
FT                   assembly, score 1.5e-20"
FT                   /inference="protein motif:PFAM:PF07230"
FT   CDS             25319..25612
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0301"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL7"
FT                   /protein_id="CBJ94233.1"
FT   CDS             25643..25852
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0311"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR016133"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL8"
FT                   /protein_id="CBJ94234.1"
FT   CDS             25985..27274
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0321"
FT                   /product="Possible phage DNA ligase"
FT                   /db_xref="GOA:D5GVL9"
FT                   /db_xref="InterPro:IPR012310"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR029319"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVL9"
FT                   /protein_id="CBJ94235.1"
FT   misc_feature    26732..26947
FT                   /note="HMMPfam hit to PF01068, ATP dependent DNA
FT                   ligase,central, score 1.8e-07"
FT                   /inference="protein motif:PFAM:PF01068"
FT   CDS             complement(27291..28841)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0331"
FT                   /product="Probable phage tail sheath protein"
FT                   /db_xref="InterPro:IPR007067"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM0"
FT                   /protein_id="CBJ94236.1"
FT   CDS             complement(28953..30155)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0341"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM1"
FT                   /protein_id="CBJ94237.1"
FT                   V"
FT   CDS             complement(30219..30581)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0351"
FT                   /product="Possible outer wedge baseplate protein and
FT                   lysozyme"
FT                   /db_xref="GOA:D5GVM2"
FT                   /db_xref="InterPro:IPR007048"
FT                   /db_xref="InterPro:IPR015801"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM2"
FT                   /protein_id="CBJ94238.1"
FT                   VETSSFETYTITLNTN"
FT   misc_feature    complement(30252..30545)
FT                   /note="HMMPfam hit to PF04965, GPW/gp25, score 3.9e-13"
FT                   /inference="protein motif:PFAM:PF04965"
FT   CDS             complement(30634..31056)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0361"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM3"
FT                   /protein_id="CBJ94239.1"
FT   CDS             complement(31200..31526)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0371"
FT                   /product="hypothetical phage exported protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM4"
FT                   /protein_id="CBJ94240.1"
FT                   DSKL"
FT   misc_feature    complement(31443..31511)
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_0371 by TMHMM2.0 at aa 6-28"
FT                   /inference="protein motif:TMHMM 2.0"
FT   misc_feature    complement(31464..31526)
FT                   /note="Signal peptide predicted for CPt10_0371 by SignalP
FT                   2.0 HMM (Signal peptide probability 0.649) with cleavage
FT                   site probability 0.632 between residues 21 and 22"
FT                   /inference="protein motif:SignalP 2.0"
FT   CDS             complement(31587..31799)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0381"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM5"
FT                   /protein_id="CBJ94241.1"
FT   misc_feature    complement(31593..31652)
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_0381 by TMHMM2.0 at aa 50-69"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             32050..35694
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0391"
FT                   /product="Possible phage baseplate wedge protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM6"
FT                   /protein_id="CBJ94242.1"
FT   CDS             35763..36431
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0401"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM7"
FT                   /protein_id="CBJ94243.1"
FT                   "
FT   CDS             36442..37107
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0411"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM8"
FT                   /protein_id="CBJ94244.1"
FT   CDS             37164..41324
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0421"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVM9"
FT                   /protein_id="CBJ94245.1"
FT   CDS             41340..42098
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0431"
FT                   /product="Possible phage tail tube protein"
FT                   /db_xref="GOA:D5GVN0"
FT                   /db_xref="InterPro:IPR010667"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN0"
FT                   /protein_id="CBJ94246.1"
FT   misc_feature    41454..41903
FT                   /note="HMMPfam hit to PF06841, T4-like virus tail tube
FT                   gp19, score 2.7e-08"
FT                   /inference="protein motif:PFAM:PF06841"
FT   misc_feature    41454..41480
FT                   /note="PS00177 DNA topoisomerase II signature."
FT                   /inference="protein motif:Prosite:PS00177"
FT   repeat_region   42227..42298
FT                   /note="repeat region 1.1"
FT   repeat_region   42299..42370
FT                   /note="repeat region 1.2"
FT   repeat_region   42371..42442
FT                   /note="repeat region 1.3"
FT   repeat_region   42443..42514
FT                   /note="repeat region 1.4"
FT   repeat_region   42515..42530
FT                   /note="repeat region 1.5 (truncated)"
FT   CDS             42618..43043
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0441"
FT                   /product="Possible phage head completion protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN1"
FT                   /protein_id="CBJ94247.1"
FT   repeat_region   43268..43291
FT                   /note="repeat region 2.1 (truncated)"
FT   repeat_region   43292..43365
FT                   /note="repeat region 2.2"
FT   repeat_region   43366..43450
FT                   /note="repeat region 2.3"
FT   repeat_region   43451..43535
FT                   /note="repeat region 2.4"
FT   repeat_region   43536..43620
FT                   /note="repeat region 2.5"
FT   repeat_region   43621..43634
FT                   /note="repeat region 2.6 (truncated)"
FT   CDS             43755..44414
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0451"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN2"
FT                   /protein_id="CBJ94248.1"
FT   CDS             44476..45243
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0461"
FT                   /product="hypothetical phage protein"
FT                   /note="note weak similarities to T4 late transcription
FT                   factor"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN3"
FT                   /protein_id="CBJ94249.1"
FT   CDS             45240..45494
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0471"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN4"
FT                   /protein_id="CBJ94250.1"
FT   CDS             45674..46405
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0481"
FT                   /product="Possible prohead core scaffold protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN5"
FT                   /protein_id="CBJ94251.1"
FT   CDS             46477..47811
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0491"
FT                   /product="Possible phage major capsid protein"
FT                   /db_xref="InterPro:IPR010762"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN6"
FT                   /protein_id="CBJ94252.1"
FT   misc_feature    46477..47793
FT                   /note="HMMPfam hit to PF07068, Major capsid Gp23, score
FT                   8.9e-11"
FT                   /inference="protein motif:PFAM:PF07068"
FT   CDS             47986..49602
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0501"
FT                   /product="Possible tail sheath protein"
FT                   /db_xref="InterPro:IPR003343"
FT                   /db_xref="InterPro:IPR017868"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN7"
FT                   /protein_id="CBJ94253.1"
FT   misc_feature    48538..48759
FT                   /note="HMMPfam hit to PF02368, Bacterial Ig-like, group
FT                   2,score 0.11"
FT                   /inference="protein motif:PFAM:PF02368"
FT   misc_feature    48787..49011
FT                   /note="HMMPfam hit to PF02368, Bacterial Ig-like, group
FT                   2,score 0.21"
FT                   /inference="protein motif:PFAM:PF02368"
FT   misc_feature    49036..49272
FT                   /note="HMMPfam hit to PF02368, Bacterial Ig-like, group
FT                   2,score 0.58"
FT                   /inference="protein motif:PFAM:PF02368"
FT   CDS             49606..51342
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0511"
FT                   /product="Possible phage tail sheath protein"
FT                   /db_xref="InterPro:IPR007067"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN8"
FT                   /protein_id="CBJ94254.1"
FT                   VS"
FT   misc_feature    49765..51321
FT                   /note="HMMPfam hit to PF04984, Phage tail sheath
FT                   protein,score 3e-16"
FT                   /inference="protein motif:PFAM:PF04984"
FT   misc_feature    51007..51036
FT                   /note="PS00339 Aminoacyl-transfer RNA synthetases class-II
FT                   signature 2."
FT                   /inference="protein motif:Prosite:PS00339"
FT   CDS             complement(51377..53101)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0521"
FT                   /product="Possible homing endonuclease"
FT                   /db_xref="GOA:D5GVN9"
FT                   /db_xref="InterPro:IPR011335"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVN9"
FT                   /protein_id="CBJ94255.1"
FT   CDS             53235..54266
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0531"
FT                   /product="hypothetical phage protein"
FT                   /note="note the phosphohydrolase domain"
FT                   /db_xref="InterPro:IPR003607"
FT                   /db_xref="InterPro:IPR006674"
FT                   /db_xref="InterPro:IPR006675"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP0"
FT                   /protein_id="CBJ94256.1"
FT                   LWF"
FT   misc_feature    53346..53714
FT                   /note="HMMPfam hit to PF01966, Metal-dependent
FT                   phosphohydrolase, HD region, subdomain, score 4.5e-08"
FT                   /inference="protein motif:PFAM:PF01966"
FT   misc_feature    53805..53828
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   CDS             54369..55145
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0541"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP1"
FT                   /protein_id="CBJ94257.1"
FT   CDS             55187..55729
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0551"
FT                   /product="hypothetical phage protein"
FT                   /note="note the nucleoside triphosphate hydrolase domain"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP2"
FT                   /protein_id="CBJ94258.1"
FT                   ETAVKIINKRFGNLRNF"
FT   misc_feature    55205..55228
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   CDS             56414..57004
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0561"
FT                   /product="Possible phage tail tube protein"
FT                   /db_xref="GOA:D5GVP3"
FT                   /db_xref="InterPro:IPR010667"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP3"
FT                   /protein_id="CBJ94259.1"
FT   misc_feature    56426..56923
FT                   /note="HMMPfam hit to PF06841, T4-like virus tail tube
FT                   gp19, score 5.5e-10"
FT                   /inference="protein motif:PFAM:PF06841"
FT   CDS             57056..57556
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0571"
FT                   /product="hypothetical phage protein"
FT                   /note="note the weak similarities to phage DNA end
FT                   protector proteins"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP4"
FT                   /protein_id="CBJ94260.1"
FT                   SKK"
FT   CDS             join(57667..58817,60261..60642)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0581"
FT                   /product="hypothetical phage protein (pseudogene)"
FT                   /note="note the nucleotide binding domain"
FT                   /note="In comparison to phage CP220 this CDS appears to
FT                   have been disrupted by the CPt10_0591"
FT                   /db_xref="PSEUDO:CBJ94261.1"
FT   misc_feature    58306..58578
FT                   /note="HMMPfam hit to PF02562, PhoH-like protein, score
FT                   4e-07"
FT                   /inference="protein motif:PFAM:PF02562"
FT   misc_feature    58387..58410
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   CDS             59060..60181
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0591"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR015880"
FT                   /db_xref="InterPro:IPR019761"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP6"
FT                   /protein_id="CBJ94262.1"
FT   misc_feature    59285..59359
FT                   /note="PS01030 RNA polymerases M / 15 Kd subunits
FT                   signature."
FT                   /inference="protein motif:Prosite:PS01030"
FT   misc_feature    59633..59668
FT                   /note="PS00962 Ribosomal protein S2 signature 1."
FT                   /inference="protein motif:Prosite:PS00962"
FT   CDS             60708..60920
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0611"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP7"
FT                   /protein_id="CBJ94263.1"
FT   CDS             61102..61611
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0621"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP8"
FT                   /protein_id="CBJ94264.1"
FT                   ANKANK"
FT   CDS             61833..62111
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0631"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVP9"
FT                   /protein_id="CBJ94265.1"
FT   CDS             62185..62604
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0641"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR019096"
FT                   /db_xref="InterPro:IPR023385"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ0"
FT                   /protein_id="CBJ94266.1"
FT   CDS             62605..63342
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0651"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ1"
FT                   /protein_id="CBJ94267.1"
FT   CDS             63345..63551
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0661"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ2"
FT                   /protein_id="CBJ94268.1"
FT   CDS             63812..63949
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0681"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ3"
FT                   /protein_id="CBJ94269.1"
FT                   "
FT   CDS             63951..64199
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0691"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ4"
FT                   /protein_id="CBJ94270.1"
FT   CDS             64335..64949
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0701"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ5"
FT                   /protein_id="CBJ94271.1"
FT   CDS             64951..65172
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0711"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ6"
FT                   /protein_id="CBJ94272.1"
FT   CDS             65153..65530
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0721"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ7"
FT                   /protein_id="CBJ94273.1"
FT   CDS             65668..66162
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0731"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ8"
FT                   /protein_id="CBJ94274.1"
FT                   N"
FT   CDS             66218..67204
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0741"
FT                   /product="hypothetical phage protein"
FT                   /note="note the ATPase domain"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVQ9"
FT                   /protein_id="CBJ94275.1"
FT   CDS             67219..67782
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0751"
FT                   /product="hypothetical phage protein"
FT                   /note="note the tetrahyrobiopterin synthase domain"
FT                   /db_xref="InterPro:IPR007115"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR0"
FT                   /protein_id="CBJ94276.1"
FT   CDS             68009..68677
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0761"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR1"
FT                   /protein_id="CBJ94277.1"
FT                   "
FT   CDS             68741..69277
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0771"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR005046"
FT                   /db_xref="InterPro:IPR011889"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR2"
FT                   /protein_id="CBJ94278.1"
FT                   NTRNADGYSANPFKA"
FT   misc_feature    68795..69265
FT                   /note="HMMPfam hit to PF03382, Protein of unknown function
FT                   DUF285, lipoprotein predicted, score 1.1e-10"
FT                   /inference="protein motif:PFAM:PF03382"
FT   CDS             69311..69676
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0781"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR3"
FT                   /protein_id="CBJ94279.1"
FT                   EIRSLKSSLDITYIKMT"
FT   CDS             69716..70294
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0791"
FT                   /product="hypothetical phage protein"
FT                   /note="note the thiamin diphosphate binding domain"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR4"
FT                   /protein_id="CBJ94280.1"
FT   CDS             70369..71253
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0801"
FT                   /product="Possible base plate lysozyme"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR5"
FT                   /protein_id="CBJ94281.1"
FT                   PSITMSAGVIKLN"
FT   misc_feature    70762..70794
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT                   /inference="protein motif:Prosite:PS00013"
FT   misc_feature    71140..71211
FT                   /note="HMMPfam hit to PF06715, Gp5, C-terminal, score
FT                   0.00049"
FT                   /inference="protein motif:PFAM:PF06715"
FT   CDS             71273..71686
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0811"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR6"
FT                   /protein_id="CBJ94282.1"
FT   misc_feature    join(71297..71356,71366..71434)
FT                   /note="2 probable transmembrane helices predicted for
FT                   CPt10_0811 by TMHMM2.0 at aa 9-28 and 32-54"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             71686..71979
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0821"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR008727"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR7"
FT                   /protein_id="CBJ94283.1"
FT   misc_feature    71752..71862
FT                   /note="HMMPfam hit to PF05488, PAAR, score 0.0024"
FT                   /inference="protein motif:PFAM:PF05488"
FT   misc_feature    71863..71952
FT                   /note="HMMPfam hit to PF05488, PAAR, score 7.4e-06"
FT                   /inference="protein motif:PFAM:PF05488"
FT   CDS             72004..72255
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0831"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR8"
FT                   /protein_id="CBJ94284.1"
FT   CDS             72304..73119
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0841"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVR9"
FT                   /protein_id="CBJ94285.1"
FT   CDS             73138..73461
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0851"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS0"
FT                   /protein_id="CBJ94286.1"
FT                   NKS"
FT   CDS             complement(73567..73755)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0861"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS1"
FT                   /protein_id="CBJ94287.1"
FT                   LLFKFILKSLLKLYYII"
FT   CDS             73874..74818
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0871"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GVS2"
FT                   /db_xref="InterPro:IPR006638"
FT                   /db_xref="InterPro:IPR007197"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS2"
FT                   /protein_id="CBJ94288.1"
FT   misc_feature    73952..74416
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 1.7e-07"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             74820..75401
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0881"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GVS3"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS3"
FT                   /protein_id="CBJ94289.1"
FT   misc_feature    74829..75275
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 0.0056"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             75411..76382
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0891"
FT                   /product="hypothetical phage protain (possible glycine
FT                   amidinotransferase)"
FT                   /db_xref="GOA:D5GVS4"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS4"
FT                   /protein_id="CBJ94290.1"
FT   CDS             76375..77175
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0901"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GVS5"
FT                   /db_xref="InterPro:IPR007197"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS5"
FT                   /protein_id="CBJ94291.1"
FT   misc_feature    76393..76848
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 5.6e-08"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             77181..77972
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0911"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GVS6"
FT                   /db_xref="InterPro:IPR000385"
FT                   /db_xref="InterPro:IPR007197"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS6"
FT                   /protein_id="CBJ94292.1"
FT   misc_feature    77217..77714
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 4.6e-05"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             77965..78597
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0921"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS7"
FT                   /protein_id="CBJ94293.1"
FT   CDS             78617..79429
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0931"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GVS8"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR023885"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS8"
FT                   /protein_id="CBJ94294.1"
FT   misc_feature    78665..79159
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 0.001"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             79473..80111
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0951"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVS9"
FT                   /protein_id="CBJ94295.1"
FT   CDS             complement(80237..80929)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0961"
FT                   /product="hypothetical phage protein"
FT                   /note="note the threonine-phosphate decarboxylase domain"
FT                   /db_xref="GOA:D5GVT0"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT0"
FT                   /protein_id="CBJ94296.1"
FT                   QYFIDKFR"
FT   CDS             80993..81430
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0971"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT1"
FT                   /protein_id="CBJ94297.1"
FT   CDS             81523..82017
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0981"
FT                   /product="hypothetical phage protein"
FT                   /note="note the membrane acid phosphatase domain"
FT                   /db_xref="GOA:D5GVT2"
FT                   /db_xref="InterPro:IPR000326"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT2"
FT                   /protein_id="CBJ94298.1"
FT                   F"
FT   misc_feature    join(81622..81690,81868..81921,81958..82011)
FT                   /note="3 probable transmembrane helices predicted for
FT                   CPt10_0981 by TMHMM2.0 at aa 34-56, 116-133 and 146-163"
FT                   /inference="protein motif:TMHMM 2.0"
FT   misc_feature    81790..81999
FT                   /note="HMMPfam hit to PF01569, Phosphatidic acid
FT                   phosphatase type 2-like, score 1.2e-08"
FT                   /inference="protein motif:PFAM:PF01569"
FT   misc_feature    81805..81837
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT                   /inference="protein motif:Prosite:PS00013"
FT   CDS             82110..82673
FT                   /transl_table=11
FT                   /locus_tag="CPt10_0991"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT3"
FT                   /protein_id="CBJ94299.1"
FT   CDS             82784..83080
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1001"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT4"
FT                   /protein_id="CBJ94300.1"
FT   CDS             83168..83617
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1011"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT5"
FT                   /protein_id="CBJ94301.1"
FT   CDS             83632..83868
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1021"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT6"
FT                   /protein_id="CBJ94302.1"
FT   CDS             83868..84545
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1031"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT7"
FT                   /protein_id="CBJ94303.1"
FT                   AKN"
FT   CDS             84601..85560
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1041"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GVT8"
FT                   /db_xref="InterPro:IPR000385"
FT                   /db_xref="InterPro:IPR007197"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT8"
FT                   /protein_id="CBJ94304.1"
FT   misc_feature    84760..85290
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 2.3e-13"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             85604..86770
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1051"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVT9"
FT                   /protein_id="CBJ94305.1"
FT   CDS             86826..89297
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1061"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU0"
FT                   /protein_id="CBJ94306.1"
FT                   TIEPGDDELEW"
FT   CDS             89472..89900
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1071"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU1"
FT                   /protein_id="CBJ94307.1"
FT   CDS             89980..91494
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1081"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="GOA:D5GVU2"
FT                   /db_xref="InterPro:IPR003610"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU2"
FT                   /protein_id="CBJ94308.1"
FT   CDS             91525..91749
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1091"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU3"
FT                   /protein_id="CBJ94309.1"
FT   CDS             complement(91852..93603)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1101"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU4"
FT                   /protein_id="CBJ94310.1"
FT                   CILLPEI"
FT   CDS             93689..94297
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1111"
FT                   /product="hypothetical phage protein (possible DNA
FT                   methyltransferase)"
FT                   /db_xref="GOA:D5GVU5"
FT                   /db_xref="InterPro:IPR002052"
FT                   /db_xref="InterPro:IPR002296"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU5"
FT                   /protein_id="CBJ94311.1"
FT   misc_feature    93962..93982
FT                   /note="PS00092 N-6 Adenine-specific DNA methylases
FT                   signature."
FT                   /inference="protein motif:Prosite:PS00092"
FT   CDS             94297..95016
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1121"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU6"
FT                   /protein_id="CBJ94312.1"
FT                   MVSLGLDFLTIDRSQAT"
FT   CDS             95085..95345
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1131"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU7"
FT                   /protein_id="CBJ94313.1"
FT   CDS             95385..97484
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1141"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU8"
FT                   /protein_id="CBJ94314.1"
FT                   LMIKD"
FT   CDS             complement(97481..98263)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1151"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVU9"
FT                   /protein_id="CBJ94315.1"
FT   misc_feature    complement(join(97781..97840,97850..97906,97967..98035,
FT                   98093..98161))
FT                   /note="4 probable transmembrane helices predicted for
FT                   CPt10_1151 by TMHMM2.0 at aa 35-57, 77-99, 120-138 and
FT                   142-161"
FT                   /inference="protein motif:TMHMM 2.0"
FT   repeat_region   complement(98433..98529)
FT                   /note="repeat region 3.6"
FT   repeat_region   complement(98530..98614)
FT                   /note="repeat region 3.5"
FT   repeat_region   complement(98615..98699)
FT                   /note="repeat region 3.4"
FT   repeat_region   complement(98700..98784)
FT                   /note="repeat region 3.3"
FT   repeat_region   complement(98785..98869)
FT                   /note="repeat region 3.2"
FT   repeat_region   complement(98870..98900)
FT                   /note="repeat region 3.1 (truncated)"
FT   CDS             99030..99392
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1161"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV0"
FT                   /protein_id="CBJ94316.1"
FT                   PLFLGNIGKTQISNQK"
FT   misc_feature    99039..99092
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_1161 by TMHMM2.0 at aa 4-21"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             99402..99680
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1171"
FT                   /product="hypothetical phage lipoprotein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV1"
FT                   /protein_id="CBJ94317.1"
FT   misc_feature    99402..99461
FT                   /note="Signal peptide predicted for CPt10_1171 by SignalP
FT                   2.0 HMM (Signal peptide probability 0.980) with cleavage
FT                   site probability 0.446 between residues 20 and 21"
FT                   /inference="protein motif:SignalP 2.0"
FT   misc_feature    99423..99455
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT                   /inference="protein motif:Prosite:PS00013"
FT   CDS             99677..100435
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1181"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV2"
FT                   /protein_id="CBJ94318.1"
FT   CDS             100435..100713
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1191"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV3"
FT                   /protein_id="CBJ94319.1"
FT   repeat_region   100852..100935
FT                   /note="repeat region 4.1"
FT   repeat_region   100936..101020
FT                   /note="repeat region 4.2"
FT   repeat_region   101021..101093
FT                   /note="repeat region 4.3"
FT   repeat_region   101094..101166
FT                   /note="repeat region 4.4"
FT   repeat_region   101167..101226
FT                   /note="repeat region 4.5"
FT   CDS             101336..101995
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1201"
FT                   /product="hypothetical phage protein"
FT                   /note="note the queuosine biosynthesis domain"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR018317"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV4"
FT                   /protein_id="CBJ94320.1"
FT   misc_feature    101342..101866
FT                   /note="HMMPfam hit to PF06508, Exoenzyme S synthesis
FT                   protein B/queuosine synthesis, score 3.9e-34"
FT                   /inference="protein motif:PFAM:PF06508"
FT   CDS             102127..104775
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1211"
FT                   /product="Possible phage DNA polymerase"
FT                   /note="dna polymerase (ec"
FT                   /db_xref="GOA:D5GVV5"
FT                   /db_xref="InterPro:IPR006133"
FT                   /db_xref="InterPro:IPR006134"
FT                   /db_xref="InterPro:IPR006172"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR023211"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV5"
FT                   /protein_id="CBJ94321.1"
FT                   LHKETETLEEW"
FT   misc_feature    102187..102933
FT                   /note="HMMPfam hit to PF03104, DNA polymerase
FT                   B,exonuclease, score 0.00075"
FT                   /inference="protein motif:PFAM:PF03104"
FT   misc_feature    102772..102795
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   misc_feature    103273..103884
FT                   /note="HMMPfam hit to PF00136, DNA polymerase, B
FT                   region,score 8.3e-23"
FT                   /inference="protein motif:PFAM:PF00136"
FT   misc_feature    103750..103815
FT                   /note="Predicted helix-turn-helix motif with score 973.000,
FT                   SD 2.50 at aa 542-563, sequence QKYQALATELDVNQLTFKILIN"
FT                   /inference="protein motif:helix-turn-helix motif"
FT   CDS             104775..105038
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1221"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV6"
FT                   /protein_id="CBJ94322.1"
FT   misc_feature    join(104856..104924,104934..105002)
FT                   /note="2 probable transmembrane helices predicted for
FT                   CPt10_1221 by TMHMM2.0 at aa 28-50 and 54-76"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             105086..105817
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1231"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV7"
FT                   /protein_id="CBJ94323.1"
FT   CDS             105860..106462
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1241"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV8"
FT                   /protein_id="CBJ94324.1"
FT   CDS             106462..107169
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1251"
FT                   /product="Possible phage neck protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVV9"
FT                   /protein_id="CBJ94325.1"
FT                   SNKFTEPAVFIVG"
FT   CDS             107232..107552
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1261"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW0"
FT                   /protein_id="CBJ94326.1"
FT                   EL"
FT   CDS             107542..108216
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1271"
FT                   /product="hypothetical phage protein"
FT                   /note="note the lysozyme-like domain"
FT                   /db_xref="InterPro:IPR008258"
FT                   /db_xref="InterPro:IPR023346"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW1"
FT                   /protein_id="CBJ94327.1"
FT                   NS"
FT   misc_feature    107566..107619
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_1271 by TMHMM2.0 at aa 9-26"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             108335..108646
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1281"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW2"
FT                   /protein_id="CBJ94328.1"
FT   CDS             108643..109335
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1291"
FT                   /product="Possible sliding clamp"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW3"
FT                   /protein_id="CBJ94329.1"
FT                   ILISKIAD"
FT   CDS             109379..109810
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1301"
FT                   /product="hypothetical phage protein"
FT                   /note="note the iron binding domain"
FT                   /db_xref="GOA:D5GVW4"
FT                   /db_xref="InterPro:IPR002177"
FT                   /db_xref="InterPro:IPR008331"
FT                   /db_xref="InterPro:IPR009078"
FT                   /db_xref="InterPro:IPR012347"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW4"
FT                   /protein_id="CBJ94330.1"
FT   CDS             109820..110599
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1311"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="GOA:D5GVW5"
FT                   /db_xref="InterPro:IPR001474"
FT                   /db_xref="InterPro:IPR020602"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW5"
FT                   /protein_id="CBJ94331.1"
FT   misc_feature    110237..110551
FT                   /note="HMMPfam hit to PF01227, GTP cyclohydrolase I, score
FT                   8.4e-16"
FT                   /inference="protein motif:PFAM:PF01227"
FT   CDS             110755..112092
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1321"
FT                   /product="Possible phage ATP-dependent primase-helicase"
FT                   /note="similarities to ATP-dependent helicase 41 (ec
FT                   3.6.1.-) (primase-helicase) protein gp41"
FT                   /db_xref="GOA:D5GVW6"
FT                   /db_xref="InterPro:IPR007694"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW6"
FT                   /protein_id="CBJ94332.1"
FT   misc_feature    111325..111348
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   tRNA            112367..112440
FT                   /product="transfer RNA-Arg"
FT                   /anticodon="(pos:112388..112390,aa:Arg)"
FT                   /note="tRNA Arg anticodon TCT, Cove score 66.81"
FT   tRNA            112455..112537
FT                   /product="transfer RNA-Tyr"
FT                   /anticodon="(pos:112460..112462,aa:Tyr)"
FT                   /note="tRNA Tyr anticodon GTA, Cove score 50.47"
FT   CDS             112667..113089
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1331"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="GOA:D5GVW7"
FT                   /db_xref="InterPro:IPR013800"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW7"
FT                   /protein_id="CBJ94333.1"
FT   CDS             complement(113213..113833)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1341"
FT                   /product="hypothetical phage protein"
FT                   /note="some simililarity with host and campylobacter
FT                   prophage seq"
FT                   /db_xref="InterPro:IPR025484"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW8"
FT                   /protein_id="CBJ94334.1"
FT   CDS             complement(113843..115474)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1351"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVW9"
FT                   /protein_id="CBJ94335.1"
FT   CDS             complement(115484..115747)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1361"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX0"
FT                   /protein_id="CBJ94336.1"
FT   CDS             complement(115769..116458)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1371"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX1"
FT                   /protein_id="CBJ94337.1"
FT                   ENLVSKW"
FT   CDS             116548..117177
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1381"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX2"
FT                   /protein_id="CBJ94338.1"
FT   CDS             117226..117672
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1391"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX3"
FT                   /protein_id="CBJ94339.1"
FT   CDS             join(117773..119377,120359..121840)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1401"
FT                   /product="Probable phage ribonucleotide-diphosphate
FT                   reductase alpha subunit (pseudogene)"
FT                   /note="note that in comparison to phage CP220 this gene has
FT                   been disrupted by CDS CPt10_1411 and CPt10_1421"
FT                   /note="ribonucleotide-diphosphate reductase alpha subunit
FT                   (ec"
FT   misc_feature    117788..118054
FT                   /note="HMMPfam hit to PF03477, ATP-cone, score 3.8e-10"
FT                   /inference="protein motif:PFAM:PF03477"
FT   misc_feature    118190..118423
FT                   /note="HMMPfam hit to PF00317, Ribonucleotide reductase
FT                   large subunit, N-terminal, score 1.9e-09"
FT                   /inference="protein motif:PFAM:PF00317"
FT   misc_feature    118427..119359
FT                   /note="HMMPfam hit to PF02867, Ribonucleotide reductase
FT                   large subunit, C-terminal, score 0.0029"
FT                   /inference="protein motif:PFAM:PF02867"
FT   CDS             119359..119700
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1411"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX4"
FT                   /protein_id="CBJ94341.1"
FT                   EEVIRNGKF"
FT   CDS             119821..120339
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1421"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX5"
FT                   /protein_id="CBJ94342.1"
FT                   NINLSNYIL"
FT   misc_feature    120359..121777
FT                   /note="HMMPfam hit to PF02867, Ribonucleotide reductase
FT                   large subunit, C-terminal, score 6e-07"
FT                   /inference="protein motif:PFAM:PF02867"
FT   misc_feature    120929..120997
FT                   /note="PS00089 Ribonucleotide reductase large subunit
FT                   signature."
FT                   /inference="protein motif:Prosite:PS00089"
FT   misc_feature    121424..121447
FT                   /note="PS00881 Protein splicing signature."
FT                   /inference="protein motif:Prosite:PS00881"
FT   CDS             121954..122631
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1441"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX6"
FT                   /protein_id="CBJ94343.1"
FT                   LKI"
FT   CDS             122668..123498
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1451"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX7"
FT                   /protein_id="CBJ94344.1"
FT   CDS             123552..123761
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1461"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX8"
FT                   /protein_id="CBJ94345.1"
FT   misc_feature    join(123555..123623,123651..123719)
FT                   /note="2 probable transmembrane helices predicted for
FT                   CPt10_1461 by TMHMM2.0 at aa 5-27 and 37-59"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             123774..124439
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1471"
FT                   /product="Possible phage DNA methylase"
FT                   /db_xref="GOA:D5GVX9"
FT                   /db_xref="InterPro:IPR001091"
FT                   /db_xref="InterPro:IPR002052"
FT                   /db_xref="InterPro:IPR002941"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVX9"
FT                   /protein_id="CBJ94346.1"
FT   misc_feature    123831..124421
FT                   /note="HMMPfam hit to PF01555, DNA methylase N-4/N-6,score
FT                   3.2e-35"
FT                   /inference="protein motif:PFAM:PF01555"
FT   misc_feature    123840..123860
FT                   /note="PS00092 N-6 Adenine-specific DNA methylases
FT                   signature."
FT                   /inference="protein motif:Prosite:PS00092"
FT   CDS             124462..125418
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1481"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GVY0"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY0"
FT                   /protein_id="CBJ94347.1"
FT   misc_feature    124594..125049
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 2.4e-06"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             125457..125846
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1491"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY1"
FT                   /protein_id="CBJ94348.1"
FT   CDS             125963..126502
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1501"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY2"
FT                   /protein_id="CBJ94349.1"
FT                   FIKSSNEYLDLINKSL"
FT   CDS             126523..126774
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1511"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY3"
FT                   /protein_id="CBJ94350.1"
FT   misc_feature    126550..126618
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_1511 by TMHMM2.0 at aa 10-32"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             126789..127085
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1521"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY4"
FT                   /protein_id="CBJ94351.1"
FT   CDS             complement(127168..128082)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1531"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY5"
FT                   /protein_id="CBJ94352.1"
FT   repeat_region   complement(128121..129496)
FT                   /note="IS200/IS605 family insertion sequence element
FT                   ISCaje2 (TnpB component only). Similar to ISCaje3 in CP220
FT                   in non-synonymous location"
FT   CDS             complement(128187..129401)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1541"
FT                   /product="ISCaje3 transposase"
FT                   /db_xref="InterPro:IPR001959"
FT                   /db_xref="InterPro:IPR010095"
FT                   /db_xref="InterPro:IPR021027"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY6"
FT                   /protein_id="CBJ94353.1"
FT                   TTLKN"
FT   misc_feature    complement(128244..128456)
FT                   /note="HMMPfam hit to PF07282, Transposase, IS605
FT                   OrfB,C-terminal, score 4.9e-31"
FT                   /inference="protein motif:PFAM:PF07282"
FT   misc_feature    complement(128490..129359)
FT                   /note="HMMPfam hit to PF01385, Transposase
FT                   (probable),IS891/IS1136/IS1341, score 2.3e-55"
FT                   /inference="protein motif:PFAM:PF01385"
FT   misc_feature    complement(128652..128717)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1090.000, SD 2.90 at aa 238-259, sequence
FT                   /inference="protein motif:helix-turn-helix motif"
FT   CDS             129894..130358
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1551"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY7"
FT                   /protein_id="CBJ94354.1"
FT   misc_feature    129918..129983
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1500.000, SD 4.30 at aa 9-30, sequence
FT                   /inference="protein motif:helix-turn-helix motif"
FT   CDS             130377..130625
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1561"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY8"
FT                   /protein_id="CBJ94355.1"
FT   CDS             130639..131331
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1571"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR011335"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVY9"
FT                   /protein_id="CBJ94356.1"
FT                   DFKGKPKC"
FT   CDS             131325..132743
FT                   /transl_table=11
FT                   /gene="uvsW"
FT                   /locus_tag="CPt10_1581"
FT                   /product="Probable phage ATP-dependent DNA/RNA helicase
FT                   (uvsW)"
FT                   /note="atp-dependent dna helicase uvsw (ec 3.6.1.-) (dar
FT                   protein)"
FT                   /db_xref="GOA:D5GVZ0"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR006935"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ0"
FT                   /protein_id="CBJ94357.1"
FT                   EPEGYEIKRFEYNI"
FT   misc_feature    131598..132038
FT                   /note="HMMPfam hit to PF04851, Restriction
FT                   endonuclease,type I, R subunit/Type III, Res subunit,score
FT                   9.4e-16"
FT                   /inference="protein motif:PFAM:PF04851"
FT   misc_feature    131670..131693
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   misc_feature    132381..132608
FT                   /note="HMMPfam hit to PF00271, DNA/RNA helicase,C-terminal,
FT                   score 0.0048"
FT                   /inference="protein motif:PFAM:PF00271"
FT   CDS             133132..133560
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1591"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ1"
FT                   /protein_id="CBJ94358.1"
FT   CDS             133571..134302
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1601"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ2"
FT                   /protein_id="CBJ94359.1"
FT   CDS             134364..135692
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1611"
FT                   /product="Possible DNA topoisomerase (medium subunit)"
FT                   /note="dna topoisomerase medium subunit (ec"
FT                   /db_xref="GOA:D5GVZ3"
FT                   /db_xref="InterPro:IPR002205"
FT                   /db_xref="InterPro:IPR013757"
FT                   /db_xref="InterPro:IPR013758"
FT                   /db_xref="InterPro:IPR013760"
FT                   /db_xref="InterPro:IPR024946"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ3"
FT                   /protein_id="CBJ94360.1"
FT   misc_feature    134454..135683
FT                   /note="HMMPfam hit to PF00521, DNA topoisomerase, type IIA,
FT                   subunit A or C-terminal, score 1.2e-13"
FT                   /inference="protein motif:PFAM:PF00521"
FT   misc_feature    134889..135014
FT                   /note="HMMPfam hit to PF02781, Glucose-6-phosphate
FT                   dehydrogenase, score 0.0043"
FT                   /inference="protein motif:PFAM:PF02781"
FT   CDS             135704..136576
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1621"
FT                   /product="Probable phage ClpP protease"
FT                   /db_xref="GOA:D5GVZ4"
FT                   /db_xref="InterPro:IPR023562"
FT                   /db_xref="InterPro:IPR029045"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ4"
FT                   /protein_id="CBJ94361.1"
FT                   NEIESKDLS"
FT   misc_feature    135983..136051
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_1621 by TMHMM2.0 at aa 94-116"
FT                   /inference="protein motif:TMHMM 2.0"
FT   misc_feature    135998..136030
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT                   /inference="protein motif:Prosite:PS00013"
FT   CDS             136649..138835
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1631"
FT                   /product="hypothetical phage protein"
FT                   /note="note helicase domain"
FT                   /db_xref="GOA:D5GVZ5"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR003450"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ5"
FT                   /protein_id="CBJ94362.1"
FT   misc_feature    137588..137611
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   CDS             138920..139345
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1641"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR016133"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ6"
FT                   /protein_id="CBJ94363.1"
FT   misc_feature    139031..139066
FT                   /note="HMMPfam hit to PF02420, Insect antifreeze
FT                   protein,score 5.6"
FT                   /inference="protein motif:PFAM:PF02420"
FT   misc_feature    139067..139102
FT                   /note="HMMPfam hit to PF02420, Insect antifreeze
FT                   protein,score 2.1"
FT                   /inference="protein motif:PFAM:PF02420"
FT   misc_feature    139103..139129
FT                   /note="HMMPfam hit to PF02420, Insect antifreeze
FT                   protein,score 25"
FT                   /inference="protein motif:PFAM:PF02420"
FT   misc_feature    139130..139165
FT                   /note="HMMPfam hit to PF02420, Insect antifreeze
FT                   protein,score 2"
FT                   /inference="protein motif:PFAM:PF02420"
FT   misc_feature    139133..139252
FT                   /note="PS00652 TNFR/NGFR family cysteine-rich region
FT                   signature."
FT                   /inference="protein motif:Prosite:PS00652"
FT   misc_feature    139196..139228
FT                   /note="HMMPfam hit to PF02420, Insect antifreeze
FT                   protein,score 29"
FT                   /inference="protein motif:PFAM:PF02420"
FT   misc_feature    139238..139273
FT                   /note="HMMPfam hit to PF02420, Insect antifreeze
FT                   protein,score 3.8"
FT                   /inference="protein motif:PFAM:PF02420"
FT   CDS             139379..139924
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1651"
FT                   /product="hypothetical phage protein"
FT                   /note="note phosphatase domain"
FT                   /db_xref="InterPro:IPR024654"
FT                   /db_xref="InterPro:IPR029052"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ7"
FT                   /protein_id="CBJ94364.1"
FT                   IDRNPEVIGTLIPFELKT"
FT   misc_feature    139382..139822
FT                   /note="HMMPfam hit to PF00149,Metallophosphoesterase,score
FT                   6.7e-05"
FT                   /inference="protein motif:PFAM:PF00149"
FT   CDS             139949..140134
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1661"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ8"
FT                   /protein_id="CBJ94365.1"
FT                   KPLADYLLKHNLISGL"
FT   CDS             140159..141175
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1671"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GVZ9"
FT                   /db_xref="InterPro:IPR006638"
FT                   /db_xref="InterPro:IPR007197"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GVZ9"
FT                   /protein_id="CBJ94366.1"
FT   misc_feature    140237..140722
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 6.5e-25"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             141268..141816
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1681"
FT                   /product="hypothetical phage protein"
FT                   /note="note thymidine kinase domain"
FT                   /db_xref="GOA:D5GW00"
FT                   /db_xref="InterPro:IPR001267"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW00"
FT                   /protein_id="CBJ94367.1"
FT   misc_feature    141268..141768
FT                   /note="HMMPfam hit to PF00265, Thymidine kinase, score
FT                   1.2e-10"
FT                   /inference="protein motif:PFAM:PF00265"
FT   misc_feature    141289..141312
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   repeat_region   142012..142035
FT                   /note="repeat region 5.1 (truncated)"
FT   repeat_region   142036..142108
FT                   /note="repeat region 5.2"
FT   repeat_region   142109..142181
FT                   /note="repeat region 5.3"
FT   repeat_region   142182..142253
FT                   /note="repeat region 5.4"
FT   repeat_region   142254..142348
FT                   /note="repeat region 5.5"
FT   repeat_region   142349..142363
FT                   /note="repeat region 5.6 (truncated)"
FT   CDS             143005..143877
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1691"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW01"
FT                   /protein_id="CBJ94368.1"
FT                   NVRDFISMN"
FT   CDS             143944..144852
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1701"
FT                   /product="hypothetical phage protein"
FT                   /note="note NAD-dependent epimerase-dehydratase domain"
FT                   /db_xref="GOA:D5GW02"
FT                   /db_xref="InterPro:IPR001509"
FT                   /db_xref="InterPro:IPR016040"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW02"
FT                   /protein_id="CBJ94369.1"
FT   misc_feature    143950..144630
FT                   /note="HMMPfam hit to PF01370, NAD-dependent
FT                   epimerase/dehydratase, score 2.4e-14"
FT                   /inference="protein motif:PFAM:PF01370"
FT   CDS             144890..145462
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1711"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR003737"
FT                   /db_xref="InterPro:IPR024078"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW03"
FT                   /protein_id="CBJ94370.1"
FT   misc_feature    144902..145219
FT                   /note="HMMPfam hit to
FT                   PF02585,N-acetylglucosaminylphosphatidylinositol
FT                   deacetylase,score 6.8e-07"
FT                   /inference="protein motif:PFAM:PF02585"
FT   CDS             145499..146044
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1721"
FT                   /product="hypothetical phage protein"
FT                   /note="note polysaccharide deacetylase domain"
FT                   /db_xref="GOA:D5GW04"
FT                   /db_xref="InterPro:IPR002509"
FT                   /db_xref="InterPro:IPR011330"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW04"
FT                   /protein_id="CBJ94371.1"
FT                   FKDLDIFGNNRVPIESKF"
FT   CDS             146110..146745
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1731"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="GOA:D5GW05"
FT                   /db_xref="InterPro:IPR003669"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW05"
FT                   /protein_id="CBJ94372.1"
FT   misc_feature    146119..146727
FT                   /note="HMMPfam hit to PF02511, Thymidylate synthase
FT                   ThyX,score 6.7e-25"
FT                   /inference="protein motif:PFAM:PF02511"
FT   CDS             146761..147072
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1741"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW06"
FT                   /protein_id="CBJ94373.1"
FT   misc_feature    146980..147085
FT                   /note="possible CRISPR DR consensus
FT                   AAAAAATTAATTGATTTTATAAAAGA with 1 spacer"
FT   repeat_region   147077..148388
FT                   /note="IS200/IS605 family insertion sequence element
FT                   ISCaje1 (TnpB component only). 97% DNA ID to ISCaje1
FT                   element in CP220 in non-synonymous location"
FT   CDS             147098..148342
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1761"
FT                   /product="ISCaje1 transposase"
FT                   /db_xref="InterPro:IPR001959"
FT                   /db_xref="InterPro:IPR010095"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW07"
FT                   /protein_id="CBJ94374.1"
FT                   EKNRLLKIQKMNITL"
FT   misc_feature    147110..148015
FT                   /note="HMMPfam hit to PF01385, Transposase
FT                   (probable),IS891/IS1136/IS1341, score 3.9e-05"
FT                   /inference="protein motif:PFAM:PF01385"
FT   misc_feature    148058..148264
FT                   /note="HMMPfam hit to PF07282, Transposase, IS605
FT                   OrfB,C-terminal, score 1.1e-09"
FT                   /inference="protein motif:PFAM:PF07282"
FT   CDS             148423..149532
FT                   /transl_table=11
FT                   /gene="NrdB"
FT                   /locus_tag="CPt10_1771"
FT                   /product="Probable ribonucleotide reductase (small
FT                   subunit)"
FT                   /note="ribonucleoside-diphosphate reductase subunit beta
FT                   (ec (ribonucleotide reductase) (b2 protein)"
FT                   /db_xref="GOA:D5GW08"
FT                   /db_xref="InterPro:IPR000358"
FT                   /db_xref="InterPro:IPR009078"
FT                   /db_xref="InterPro:IPR012348"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW08"
FT                   /protein_id="CBJ94375.1"
FT   misc_feature    148483..149400
FT                   /note="HMMPfam hit to PF00268, Ribonucleotide
FT                   reductase,score 2.6e-07"
FT                   /inference="protein motif:PFAM:PF00268"
FT   CDS             149714..150121
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1781"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW09"
FT                   /protein_id="CBJ94376.1"
FT   CDS             complement(150191..151339)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1791"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW10"
FT                   /protein_id="CBJ94377.1"
FT   CDS             complement(151339..152034)
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1801"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR021674"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW11"
FT                   /protein_id="CBJ94378.1"
FT                   NSDDVFGRF"
FT   CDS             152100..154919
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1811"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW12"
FT                   /protein_id="CBJ94379.1"
FT                   SYIYAFNIN"
FT   CDS             154976..155065
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1821"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW13"
FT                   /protein_id="CBJ94380.1"
FT                   /translation="METSLLFLIHFIKENRDIYIVFIIINKVR"
FT   CDS             155218..156588
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1831"
FT                   /product="Possible phage tail sheath completion protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW14"
FT                   /protein_id="CBJ94381.1"
FT   CDS             156597..157349
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1841"
FT                   /product="Possible phage tail tube protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW15"
FT                   /protein_id="CBJ94382.1"
FT   CDS             157531..158037
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1851"
FT                   /product="hypothetical phage protein"
FT                   /note="note topoisomerase subunit domain"
FT                   /db_xref="GOA:D5GW16"
FT                   /db_xref="InterPro:IPR001241"
FT                   /db_xref="InterPro:IPR013759"
FT                   /db_xref="InterPro:IPR013760"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW16"
FT                   /protein_id="CBJ94383.1"
FT                   SIASL"
FT   CDS             158202..159122
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1861"
FT                   /product="Probable phage ssDNA binding protein"
FT                   /db_xref="GOA:D5GW17"
FT                   /db_xref="InterPro:IPR012339"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW17"
FT                   /protein_id="CBJ94384.1"
FT   CDS             159191..159463
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1871"
FT                   /product="hypothetical phage protein"
FT                   /note="note chaperonin domains"
FT                   /db_xref="GOA:D5GW18"
FT                   /db_xref="InterPro:IPR011032"
FT                   /db_xref="InterPro:IPR020818"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW18"
FT                   /protein_id="CBJ94385.1"
FT   misc_feature    159206..159457
FT                   /note="HMMPfam hit to PF00166, Chaperonin Cpn10, score
FT                   0.00037"
FT                   /inference="protein motif:PFAM:PF00166"
FT   CDS             159463..159924
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1881"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW19"
FT                   /protein_id="CBJ94386.1"
FT   misc_feature    159610..159678
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_1881 by TMHMM2.0 at aa 50-72"
FT                   /inference="protein motif:TMHMM 2.0"
FT   CDS             160086..161690
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1891"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW20"
FT                   /protein_id="CBJ94387.1"
FT                   EYKYVTDYTQFQNKKYN"
FT   repeat_region   160964..160982
FT                   /note="repeat region x.1 (truncated)"
FT   repeat_region   160983..161003
FT                   /note="repeat region x.2"
FT   repeat_region   161004..161024
FT                   /note="repeat region x.3"
FT   repeat_region   161025..161045
FT                   /note="repeat region x.4"
FT   repeat_region   161046..161066
FT                   /note="repeat region x.5"
FT   repeat_region   161067..161087
FT                   /note="repeat region x.6"
FT   CDS             161851..162930
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1901"
FT                   /product="Probable phage RNA ligase"
FT                   /db_xref="GOA:D5GW21"
FT                   /db_xref="InterPro:IPR019039"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW21"
FT                   /protein_id="CBJ94388.1"
FT   CDS             163073..163486
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1911"
FT                   /product="hypothetical phage protein"
FT                   /note="note purine phosphoribosyltransferase domain"
FT                   /db_xref="InterPro:IPR029057"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW22"
FT                   /protein_id="CBJ94389.1"
FT   CDS             163496..163837
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1921"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW23"
FT                   /protein_id="CBJ94390.1"
FT                   KKNAFKLWC"
FT   CDS             164010..165179
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1931"
FT                   /product="hypothetical phage protein (Radical SAM family)"
FT                   /db_xref="GOA:D5GW24"
FT                   /db_xref="InterPro:IPR007197"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW24"
FT                   /protein_id="CBJ94391.1"
FT   misc_feature    164061..164597
FT                   /note="HMMPfam hit to PF04055, Radical SAM, score 3.3e-06"
FT                   /inference="protein motif:PFAM:PF04055"
FT   CDS             165275..168793
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1941"
FT                   /product="hypothetical phage membrane protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW25"
FT                   /protein_id="CBJ94392.1"
FT                   DSFVLS"
FT   misc_feature    165797..165865
FT                   /note="1 probable transmembrane helix predicted for
FT                   CPt10_1941 by TMHMM2.0 at aa 175-197"
FT                   /inference="protein motif:TMHMM 2.0"
FT   misc_feature    166649..166681
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT                   /inference="protein motif:Prosite:PS00013"
FT   misc_feature    166943..166966
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   CDS             168821..169753
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1951"
FT                   /product="hypothetical phage protein (possible baseplate
FT                   tail tube cap)"
FT                   /db_xref="InterPro:IPR024389"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW26"
FT                   /protein_id="CBJ94393.1"
FT   CDS             169762..170253
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1961"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW27"
FT                   /protein_id="CBJ94394.1"
FT                   "
FT   repeat_region   complement(170260..170277)
FT                   /note="repeat region 6.5 (truncated)"
FT   repeat_region   complement(170278..170374)
FT                   /note="repeat region 6.4"
FT   repeat_region   complement(170375..170476)
FT                   /note="repeat region 6.3"
FT   repeat_region   complement(170477..170569)
FT                   /note="repeat region 6.2"
FT   repeat_region   complement(170570..170594)
FT                   /note="repeat region 6.1 (truncated)"
FT   repeat_region   171132..171154
FT                   /note="repeat region 7.1 (truncated)"
FT   repeat_region   171155..171252
FT                   /note="repeat region 7.2"
FT   repeat_region   171253..171336
FT                   /note="repeat region 7.3"
FT   repeat_region   171337..171349
FT                   /note="repeat region 7.4 (truncated)"
FT   CDS             171467..171970
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1971"
FT                   /product="Probable phage tail completion and stabilizer
FT                   protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW28"
FT                   /protein_id="CBJ94395.1"
FT                   VIKS"
FT   CDS             171980..172399
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1981"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW29"
FT                   /protein_id="CBJ94396.1"
FT   CDS             172598..173791
FT                   /transl_table=11
FT                   /locus_tag="CPt10_1991"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW30"
FT                   /protein_id="CBJ94397.1"
FT   CDS             173869..174381
FT                   /transl_table=11
FT                   /locus_tag="CPt10_2001"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW31"
FT                   /protein_id="CBJ94398.1"
FT                   IIKEIEA"
FT   misc_feature    174244..174267
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT                   /inference="protein motif:Prosite:PS00017"
FT   CDS             174390..174704
FT                   /transl_table=11
FT                   /locus_tag="CPt10_2011"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW32"
FT                   /protein_id="CBJ94399.1"
FT                   "
FT   CDS             174732..175454
FT                   /transl_table=11
FT                   /locus_tag="CPt10_2021"
FT                   /product="Probable phage prohead core protein precursor"
FT                   /db_xref="InterPro:IPR005082"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW33"
FT                   /protein_id="CBJ94400.1"
FT                   ILKEYFLEFIEILKNKNK"
FT   misc_feature    174864..175157
FT                   /note="HMMPfam hit to PF03420, Peptidase U9, prohead core
FT                   protein, score 2.5e-12"
FT                   /inference="protein motif:PFAM:PF03420"
FT   CDS             175476..175682
FT                   /transl_table=11
FT                   /locus_tag="CPt10_2031"
FT                   /product="hypothetical phage protein"
FT                   /db_xref="UniProtKB/TrEMBL:D5GW34"
FT                   /protein_id="CBJ94401.1"
SQ   Sequence 175720 BP; 68274 A; 21536 C; 26501 G; 59409 T; 0 other;
     aattactaaa atgttagctc tttagcttta aatttcaaat tttaatatat aatataatca        60
     taataaaaag atttataatg ttaagtaaag aagaaataaa atattttcaa acacataaaa       120
     atgaaataac agatgaactc ttagaaacca ttagagctca aggaaaacta ggaaaagcac       180
     aagccttaga aatcttagat ttgcctaaag actctgataa ctattactta gatgcgtata       240
     atacgagaat tagttataat ggatctcgtg gtcttaaaaa agcttacaca aaattaaact       300
     taagtccgat acatattagc gagcttgaaa aatgtgcgaa cgacccactt tatttcttaa       360
     gaaattatgt tcgaatgact acaccaaagg gttttgattt cgtagattct aggccatacc       420
     aggatgaatt tatacaatta ctaagtgacg attctataga aaatgtgata tcaatgcagc       480
     ctcgtcaatg cattgaagca aatactaaaa taaatgtaaa tggtaatgaa actactatta       540
     ttgaattatt caataaccaa gaatctaata aaagattata ttttaatagt tctaagttta       600
     ttgaaagtta tgaatgtaaa gacaaatatg tagaaacgcc tataggtaaa gtcaaaattc       660
     tcgaagtcca taaaactatt aaatacaata tttttgagat agaaactgaa aatggattca       720
     agttacaagc atctgaattg cacgtattaa tagacgaaaa tggtaatgaa ttatatgtca       780
     aagattgttt aaataaggtg attaaaacaa aatcaggacc ttctaaaata atatctaaaa       840
     catttataaa atatgatcat tgttatgatt taactttaga gcatcatcac ctttattaca       900
     ccaatggtgt tttaagtcat aattcatcta aatcaactac aacaagtgta aaacttgcgc       960
     atttatactg ttttaagaaa gatatcaaca taggcatagt tgcttacagt ggtaactcgg      1020
     cacgagagtt cttagacaaa acaaagaaaa tgttgatagg cttaccgata tggatgcaac      1080
     ccgggacagt tacctggaat aaaggctcta tagaatgtga aaataatata aagattttaa      1140
     cggacgtacc aagttcggac gcattccgcg gaacgtccac aaatataatc gttgtagatg      1200
     aatgtgcata tttagatcct gccggatgga tagatttcac tgacggtgtt ttaccatcac      1260
     aagctggttt agctttcaaa aaattagtca ttttatctac acctaaaggt aagaatcatt      1320
     tctacgatat ttggcaaggt gctggcgaca ctttagaaac ttctattaat ggatttgtga      1380
     gacacagagt agattggaga ttagtcccaa ggttcaaatc tgatggtact aagtacgacc      1440
     ctgaagaatt caaacaacaa caaattaaaa ccggtggttt agttgtttgg aattctgcat      1500
     atgaatgtaa atttgaaggt tctgcaatga cattgatacc tagtgaaata ttagatactt      1560
     ataaaccaca agaaccaata gaagttgata atattaagga ttctaaaata ctaatatacg      1620
     aagaaccaat acccgggcat aaatacgtta tgggtgttga cactgctaaa gaaggtgctg      1680
     attttactgg agttcaaata ttcgatatta cagatttaaa tttcagacaa gtagcatcag      1740
     caaaacttaa aatagattat atgttattac cagagttact caatgagtat ggtttaaggt      1800
     tcaatcaagc tttaataatt gtagaaaata atgaaggttc tggtcaagtg gttgctgata      1860
     ttctcaaaag agattatgaa tatgagaact tatattatga tgtcaataaa caaaaacaaa      1920
     gattaaaata tcctgggttt agaactacaa aattatctag ggatgttatt ttacaaactg      1980
     tagcaacctt agcacaagct aataaattat tattagtaga taaagaaact attaaagaat      2040
     ttggtgtatt cacattaaac gataatggta aatatcaagc agctgtagga tatcacgatg      2100
     atttagtgat ggcttgttgt ctatgttttg gtatttttac aaatgttaag aactttgaag      2160
     atatgaaaga aatagtagat tctttaaaaa gtgccgaagg aaaaagtttt gagtatttaa      2220
     catttggggc ttttgcagat ggtttagatg tagaaccaga ttctaacacc taataaagat      2280
     tacaatctca gtaatttgga atattattaa aattttggat tctaaatgaa agaatatatt      2340
     aaatataatg atagaaaatt tattttaaca gcatataaag ttaaaaccga acgtgactta      2400
     ctattaactg caagttcaga tgatactaca tacagtaaag atctaaatga tttaaattta      2460
     gatatttact taagaatctt agaaccttat atagattcta atataaacat ttataattta      2520
     tatccggaag aaaaattatt tttactttat agattaagag caacttcagt ttctgaccaa      2580
     ttatctttaa atactaggtg tgattgtggc tgcactttca aatctaacat agatttgggt      2640
     aaaattggag aactacatag tattgataca aatatatatc cagatttgaa agacgtttat      2700
     agcccaaatt tagccgatat atacggtgat tcttacttag aatctaacat tatggattgt      2760
     gattcagaat tagatacgta tttagaagct aatactacta aatttaactt tattaaagtt      2820
     gttaaatgtt ataattgtaa gaaagacctt gaaattgatt taacaaaccc agaaatatat      2880
     aaaaatatat tttcagagaa tcctataggt gagttctaca aaagtttaac aaggttatca      2940
     tttctaggta agtttaccat agatggtatt ttaaatgatt tatatccgtt tgaaagagaa      3000
     atctttataa gtttaataaa tgatgaagta gaagaacaaa ataaagcact taaaaaataa      3060
     tcttagtctt taagtgctta gtgcaagtta ttttatatgt tttttgtctg atctatcctt      3120
     aatactttca ttgatttcgg tagttatttc agattttaag tcattcttga cttctgactt      3180
     aacttcagac tttatagcat ccttaacatc attcttaata ttttcagcaa gtttagctaa      3240
     atctttattt ttttgttttt ctttgagttg atcaataata acttctggtt ttttagaaca      3300
     accaattaaa ctaccattaa gatcttgttg tggtgttaca taatttcctg ttgataagta      3360
     taaaacaccg tctacacaaa cttgattaat tctggaatct gaagttccgc gaacttcttt      3420
     acctgtttta tcactggaat aatcagaccc acagcctatt acaaacaaag ctgacaaagc      3480
     tataacgaag tattttagat tcttcataga ccctctttta atattattta tgattttacg      3540
     atttttgatt taaaacttta gtttcgaatt aagatacttt taagatattt tacaatataa      3600
     ttattataaa ggagtttaaa atgaaagaat ttttttataa tttaatagct caaatcaaag      3660
     gactcaaaat acataaaaat gaaaaagata cttggtattt aaaatgggat ttaaacactg      3720
     gatattatat agaaggtcta aatactaaac gcagactata ttgtggtggc tattctgaca      3780
     gtttaaacaa aataaaatat ttgtattgaa gctttgtgtt agttcgaata ctaaaacgtt      3840
     aagatacttt taagatattt tataatataa ttacacaaag gagatataat gatcaaaaaa      3900
     ttaaccgata gagaacacat tctaaaaaga cctagtatgt atataggtgc tatcgattct      3960
     acaaatactg aagattttat catagaatct ggtaaaatta aatatactac tttgaattat      4020
     gtacccggtt taattaaaat aatcaatgag attatcgata attcagtaga tgctgcaatt      4080
     agatctaaat ttaaatctgg cttaaatatc agtgttaaaa tatctaatga tactgttagc      4140
     attgaagatg atggaactgg cataccagta ataaaatcag gtgatcacta tatgccagaa      4200
     ctagcttgga atcacgctaa agcaggttct aacttcgatg atgatgctaa tcgtgtaaca      4260
     ataggtacca acggagttgg aagttattgt acaaatgttt ggagtattaa ttttaaaggt      4320
     attacagacg atggtaaaaa tagatatatt tttaaatcta aaaacaatgc tgaaacttat      4380
     agtgaaaata tagaagcttc taaaaaatca ggaactttag tagaatttaa accagattta      4440
     gaaagattta atcttaaaga aattgatgaa acacataaga atataatcta tcaaagatta      4500
     ttaaacttag ctatttgtta cccagaaatt aattttaaat ttaattctaa gaaaatagat      4560
     tttaaatctt ttaagaatta tttaaatatg tttagttcag attttgaact atatgaaaac      4620
     caaaatatta aaattggtat aatcccaaat gaattggatg actttaaaca atttagtttt      4680
     gttaatggtt taaaaatacc agacggtggt gtccacatag atactattat gagtaacgta      4740
     gttcaaggta taagagacaa attagttaaa aaatataaaa gtattaaacc tggcgatatt      4800
     aaaaataaat taatgattgt ttgttttatt aatggaatgc caaatcttaa atttaattcg      4860
     caatctaaag aaaaaattac aaactcagta aaagaattta atgatttttc taatatagat      4920
     tataatttta tcaataaaat tcttaaaaat aaatctatta tagatcctat tatagacata      4980
     tataaagtta aagaagcttt aaatgcagat aaagctctta agagtgtaga aaaatctaag      5040
     aagttaaaat ctgaaaaata ttttagagct acaaaaagcc aaaaatatct ttgtatttgc      5100
     gaaggatttt ctgcgtatgg tggtatatca caagttcttg gaaatgaaca tacgagcttc      5160
     tatgttctta aaggcaaacc attaaattct tgggatgtta ccaatcaaaa atttgcagcc      5220
     aatcgtgaat tatctgaatt ataccaaata ctttccgaga acgcagaatt tgaagatctg      5280
     caagacggca agttttacga gattaaaatt gatggtaaaa cttatatcat gaatgaaaat      5340
     gatacaattg aaattaataa tattaaatat aatttcgaag atctacaaaa aggattgtaa      5400
     tgagaccaat cagaatagca atttcaggag ctcaatgttc tggtaaaact acattaatta      5460
     atttaatgaa gaaacacagt tattttaaga attttgattt catagaatca ttttctaata      5520
     aaatagctaa aacaaacaag aaacactcag aaaatacaaa cttggtgact cagttacaaa      5580
     tgttgtatta tagtataagt gctttaaaaa gtataagcat acctactgta cacgataggt      5640
     gtattttaga tgttatagta tatacaggta ttaacaaaga catcgattta agattattca      5700
     cagattcttt aataaaatat tataaacagt tcgattttat ttttgtttta gattctgaaa      5760
     atataccatt agaatcaaat ggtgttagat caatagatcc tgaatttaga tctaaaataa      5820
     acaatatttt taagaaagta gatttagaaa acgtcgttca cttagattct aaattagatc      5880
     cagattctag gatattaaaa ataattgaaa ctataaaatc taaaactaat taataggaga      5940
     aacaatggat ttaaatcttt acatacacaa aacaaacgaa gctgcagtaa taccggaaat      6000
     tgcttataat gggacttcag cagcatttga tattacttgt actgaaacaa ctgaaattaa      6060
     accaggagaa tcaaaagtag ttccaaacgg actaagaatt tcaatcgatg aaaaagatcc      6120
     tttttatatg acagtacatt taagaagttc tttaggtttc aaaaaagacc taattccaca      6180
     tattggtatc attgatgctg gttatactgg tgattttgga gttaaaatta ataatattgg      6240
     taaagaacct atagttattg aaaaaggatc tcgttacgca caagttttaa ttcatagaaa      6300
     atatagtttt aagttcgttg aactcaatga tgctgaattc aaggattttg aagctaagca      6360
     agaaaggggt tctaaaggat ttgggtcaag tggtaaatct taaaagattt actcatttta      6420
     ataattctta ataaggattt aagtatgaat acaataaaat tttatcatag acaaaaggaa      6480
     tatgtcgttc aatctcaaaa tattaatcaa cacacattta ataagaacta taataaagtt      6540
     ctagcattat taaatgaaaa tgaaattaaa tctattaatg aatgtgaatt aataccagct      6600
     ggtaaaactg atattttaaa attatctgca atgggtggtg atgggttaat acaagagttt      6660
     gaattaagat tagaaaacgt ttactaatag gagatatagg tgttagactt tgtagatatt      6720
     aagtatttta agttagcagt tcctggccct tataaagaaa gttctttgga tattgctgtt      6780
     aaatgtccaa tttgcggaga ctcaaaatat aaaaaatctg ttaaaagact acacctatat      6840
     gaaaaacaag gagttacttt agtccattgt tttaatggtg attgtgaatt aaatactcaa      6900
     atgagtttaa gtaatttctt aaagatttat aaaccagaat tattattgcc gtataaatca      6960
     gagaatttta aatttaaaat taattcaatt gattctagtg ccaaatctaa catagaaagt      7020
     aataatgaaa tagagactat gaagtcttgt tttgattcta gtgctagcaa tactagcgat      7080
     tctaatgaat ctagcaatac aagtattgaa aacattgcta gctctactag cattgaaagc      7140
     gccaacaatg agttcaaata tattaactta acttcagtgt tagacactaa tacaagtaaa      7200
     caaatagagt ttttaaaatc tcgtgggttt aacgatgata ctattaactt tttagatttc      7260
     tataatggaa ctaaatcttt taatttaaat ggtgtttatt atggaatcaa agactatctt      7320
     gtaattccat tttctaaaga ctctaattat tatggattct atgcaagatc tttaactgaa      7380
     aaaagattta ttaattttac attgaatcaa aattatggag tttggaatct atttaatgtt      7440
     gatttaaata aaccagtttt tatatttgaa gctattctcg atgctttgtc ttttagacaa      7500
     acatacagaa ctaatcaaat aatagcttta aatacttcca caatagcaaa gaatgtttta      7560
     gatttaataa agtacccttt cttttgttta gataacgaca aagttggaat tgaaaaaatg      7620
     ataaaatata attcgatacc aaatagtcat tttatatgtt atccaaatga tttaacacaa      7680
     aaagatttta atgaaatgct tcaaaataat attaaaatag aacttgtttt taagaaaggc      7740
     ttcggcgctt tattacattt aaaatcttta ttatgatttt aattataaat aaaaaggata      7800
     acaaaatggt aaaaagacaa aagagtaccg aaaatatagt acttaatttt ccatccaaaa      7860
     attgtgtatt aaaggaagtt ccgtcaaaag gtgagaaaaa taatgagatt ttctttgata      7920
     atattttaaa taaaaatgaa atagacacac ttttcagtcc aaaagtttta gggagttttg      7980
     aattaattgg cgacggtgat ttgaaaacca ctcttaaaaa taatcctaat ttattaataa      8040
     aaggtgacaa tttaattggc ttacattctt taaaaaagaa atttgtgaat aaagttaaac      8100
     ttatctatat tgacccacct tataatacag gcaatactag ttttaattat aacgacaaat      8160
     ttaaacacac tacttggctt acttttatga aaaatcgcct tgaaattgct agagaatttt      8220
     taagagatga tggtgtaata ttcgttcaat gtgacgataa tgaacaagca tatttaaaag      8280
     tacttatgga tgagatattt ggtagagaga attttgttaa ttgtattgta gtcaagatga      8340
     acgaatctaa aggattaaaa aatgctaatt gtcataaaaa attaccgaaa aataaagaat      8400
     acattctact ttataaaaaa caagataata aatctgtatt aaaacaaatt agattaaaaa      8460
     aatcacaaaa taaattatca tcatatatta aattttataa caaatacatc ccaaatattg      8520
     agagcgatta taaagaatgg gaaataaaat attttgatcc aaaattaaat aaacaagatt      8580
     attttaaaaa cttgatatat ttagtaaaac ctgataataa cattaatatt aatatgaaag      8640
     aagggacttt tgaaaaaata ataaattcaa aaggtaaaac acattattat tatatgaata      8700
     atggtgtaat tatgaaagtt ttgtttttaa atgaaaatct tgattatact ttaggtgatt      8760
     tatggacaga catatctaca attaacattt gtaaagaagg actgaaaaca actattaaaa      8820
     atggacaaaa acctgaagca ttattacaaa gaattataga atcaagtaca aatgaaaacg      8880
     acatagtaat ggattttttt gcgggaagtg gcactactct agccgttgct cataaaatga      8940
     aacgcaaatg gataggcata gaacaaatgg attatataga aactatcaca aaagaaagac      9000
     tcaaaaaaag tcatagaagg tgagcaaggt ggtatcagca aagcaataaa ttggcaaggt      9060
     ggtggaaatt ttgtttatgc tgaacttatg cctttaaatg caatttataa agaaaaaata      9120
     caaaatttaa atgatgaaaa agaattagat aatatttatc aagagttaaa aactaaagct      9180
     tttttagatt atagagtaga tataaataaa attttaaaag ataaagaatt tgaaaattta      9240
     gacttagaaa gcaaaaaaga aattttaaaa cttgttttag attctaatat ggattatgtt      9300
     ttgtatggtg atataaaaga tgaagattat gtcatatctg aagaaataat aaaacttaat      9360
     aaaatatttt atggggtatg ctaaacattc ttaagatata aaatctgtaa aaatttgtat      9420
     tatttcatag atttgggtcg tatttaaatt ttataattca ctatggtgta agtttatatt      9480
     aatgttataa ttttaaatta aattttaatt ttgtattaag ctaaaatata ttataattaa      9540
     gaaaatatta aaaggagttc aatgacagta gatttaaaac acgatatttg ggtagaaaaa      9600
     tatcgccctc aaaaaattga tgacttaatt ttaccaaatg tttatttaga taaatttaga      9660
     aaatatattg aaaaaccatc aaatatttta ttaagttcag taaacccagg aacaggaaaa      9720
     acaagcacag cacaagctat tataaaagaa ggtaatttcg aatctttata tatcaatgct      9780
     tcattagaat ctggtattga tactatgaga agtaaaatct tacaatttgc tagcactgaa      9840
     agcttcgatg gaaaacctaa aattgtttta gcggatgaat ttgactactt tggccaaaat      9900
     ggtcaagcag ccgcaagagc acttatagaa gaagttgctg ctaattgtag atttatatta      9960
     acttgtaatt atgtttctaa tataatgcca ccaatcgtta atagattcga agtatttgat     10020
     tttgatgcag ttcacgcctc taataaacaa gaacttgttc aaaaatcttt caatttattg     10080
     aaagaaattc tggataatga aaaagtttct catacaaatg aagatctcgt taatattatt     10140
     aagaattatt atccaagtat aagaggtatg attgcttgct tacaaaaatg taattttaat     10200
     aataaattaa ttctggatat tcaaaaagat tcagattttg agggtttgat taacttaatt     10260
     agatcacgtg attttgataa tttaatgaaa gtaatctatg gcttaacaaa cccagatgct     10320
     ttttatgaat acgcatttaa aaaattagat attcaaaact ctaataaacc acaagctatc     10380
     ataatactag ctaaatatca ataccaaagt gctttctcaa gagatagaaa cttaaattta     10440
     gctgcttgta ttatggaatt agcaccatta ttataaggat tatatatgat tttatatgat     10500
     ttaagttcgt tgattcacag agctttacat actagtatta agcaaatgaa tccacacaaa     10560
     aaagacggta agtatattac tgaagaattc ataagtggaa ctatttttag aattatagaa     10620
     gaattattag aaaattatag actttataga gtcaaatata atactatggt tatttgcata     10680
     gacgatcata gtgttccata ttggcgaaaa tctttatacc cagattataa agctcagaga     10740
     aaaactcaaa gagaagaatc agaagttaat tttaaagaag tttataaaca tattaatata     10800
     ctaattagaa ttctaaatga ttatacacca tttaaagcta ttggtgtccc aggagctgaa     10860
     gctgatgata tcattggtgt attaactagg aagttctgca aagcagaatc tattttaatt     10920
     ctaagccccg ataaagactt taaacaatta cataaattag gtgatataaa acaatattca     10980
     gcaataacca ataaatgggt tgttaatgac gatccagaag gctgggaaag aatacattgt     11040
     tgtttgggtg atgctgccga taatgtacca cgcgttgtgg atttttcgga atttacgcct     11100
     gagtttaaag cttattatca aggaactgaa ttagatttct ataagttaga cgaaaactta     11160
     aaactaggca ttattaataa ctttaatgaa gtttatcctg atgttgaagt ttataaaaaa     11220
     caaagatttg gtgaagctgc tttaaataaa aagattaaag agtttgggtc tttagatgcc     11280
     ttcttagatt ctaacgaaat atatagactt aattataatc gtaattataa gttagttatg     11340
     gatagtgaaa tacctataga tattgaatta gaaatcttaa agaaatatac agaatctagt     11400
     acagatttca atatggaaaa tcttaataag tatttttcat tttataatat aactacttgt     11460
     agccagtggt ttagtcaatt atggaatgaa atgagtaaac ctatagaaat gactccttgg     11520
     aatgtggatt ttagtaaaat ctaaaatcca ctcataatcg cacaaaaaca aggtttaaat     11580
     cgattttaat ttaaaggtat attatgatat tcttaactgg tggaaatggt tatttagcta     11640
     atttattgtg taattatatt agtcatatag attatgttgc tattttcggg tgtcctagca     11700
     gtacaaaaga catagattca gacccgaaga aattagcttc tacattagat actattgttt     11760
     tagccaaaga gtttaaacac aaggttattt ttgcaagttc agtgggttct aattatcctg     11820
     gtttaccagg aacccaaggt tattacaatc gttataaaaa tgtcgcggag cattatataa     11880
     caaatatgta tgataattat ttgatttata aaattccaag agtttatggc cctaataaag     11940
     ttaaaggtat ttttaagaca ttaaaagacg gaacatacgc tggctcatta gaaactaaaa     12000
     tagattatat taatgaagat gatttcgtta cttggtttat ggaaaactta agttcaaata     12060
     ataaaataat tgaatataat aaagatttta gaagtattaa agttaaagat cttaaagatt     12120
     taatacttaa taatacttta tatttgctat aaattgtatt gtagatcgga aataaatatc     12180
     caaaaaggct cagcagtgaa tgtaagatta cgtattatta ataatcagca agtaccagaa     12240
     ttaccaagtt tcacagattc taatgaagac aacttaacta cagatgttaa attagatgtc     12300
     ttaacgcacc aagaagtaga tagaaacttt gctaatatta ttacgtggtt aaaaactgtc     12360
     agtgataaaa taattgagca atctacagtt ctaaaacaat tagatcctga aaatatggag     12420
     aaacttttaa aagctgctga acaaatacaa acaatttctg atgatatcaa aagcttagaa     12480
     actaagtata accaagttaa taatgattta acaaattaca aaacttcaaa tgatttagct     12540
     ttatctagga aattagattc agtaaaaact ataaatggta cagatattaa gggttctgga     12600
     aatgttgata ttaatataac aagaacgcaa tttacaaatc acttaactaa tattggtatc     12660
     aatgaaattg gcagtatagc tatattagat tcaaaaacaa ctttagtttt taataattta     12720
     tatgcgggtt ctagcttgtc cacggataca tatgcatata tgcaaggtac ttggaaatgt     12780
     actggtaaat taagtgataa taaaggctta ttcatcagag tatcgtaatc aaaaacttaa     12840
     gcaaaactta agcatttata taatataata taataacaaa taaggagatt tgatggtatt     12900
     agaatataac cctattaaat taggtaatag atctattaaa gttcgtaatt ggaaagtcaa     12960
     agaccgcgag ctctacaaag gtaaattaaa aaatactagt tcctcagaag atgaacttaa     13020
     agcaagatat gaatgttttg ttacaaatgt tttagaaaca cctactgctt taaataatga     13080
     tgaattagag tacttatttc tattattaag aattataaat cttggtgatg atttaaatta     13140
     tcattggtgg tgtagaagtt gcgaaaaaac tactgattct aaaattaaat taagtaaatt     13200
     atttacaaca aaatctggta aaatacaaga tattgatatt ggtggtatca aaattgaact     13260
     tcaagatgtt caaaatgttg aactctataa taataaatta agaacttcag attcaccaag     13320
     cacagatgat ttaatttttc atattaaatc tattaatggt gataatacaa aaggcttcca     13380
     agatattaaa aactacttcg atgagttaga tattaataca atggataaga tttctgaagc     13440
     attcgaaaaa atgatattta aaattgaatc tagggaacac acagtaactt gttcccattg     13500
     tggtgctaat tcaactttta atttcgatga aataccagat attataccac caaaatggtt     13560
     aaaacgttaa gaaaggatta aattatgagt atgtatataa catatataga tcaaggtgct     13620
     tataatatga ttgtttctgc tcaaagagac aatgcttttt tattaccggg gtctagcaca     13680
     ttagaagttt ttgacagtaa attatttaca gcagttttag aagcattagc agataaaaaa     13740
     acttgtaaat tctacaaaga tgttgatgta ttaactttag aaaacttgga aattgacgag     13800
     agtgctaact tagttaagaa ttcgtatatt ttccaattaa cttctgcaat gggtcagatt     13860
     tttacaaaga taccacaata tacttatttt agattccaat atcttaataa tatatttgca     13920
     tcaatgggat actttataac tgaaaaaaat cgtgaagaaa tatatattaa aattcttgaa     13980
     actgatgacg acgcattgat tgcaaatctt gaagaatatc tcaagattgt aaatcaatta     14040
     aaccagtatg aaaaaatgta tcaagaattc ttaaatggtt tagatgaaat ggaaatgaca     14100
     gatgatgaag caactttaga tcaaatctta caagaagctt taaattattt tacaaatgct     14160
     caaaagaact ttgtaactat ggattataag gggtggtttt caacaattaa agcagattat     14220
     gaaaatcgtc aaaattcagc acaaccttca aatcaagctt ctaatcaaac tgctaatagc     14280
     taaaaataaa gatctaaatt gttttagatc tttcttattt tatgatttta aaatactaaa     14340
     atttctaaac gctaaattct aaaactcaaa aaactttaag ttattttatt atataatact     14400
     ataaaaggag attaaatgat tttcaaaaca agaactaaga aagttccatt ctatgaattt     14460
     tttggtgaca caattcaagg tgaaggacca agattaaaat ctgcagtatt tgttagagtt     14520
     gctggttgta ataatacttg caaaggtttt gggtgctctg cagtagctcc tgatggttcg     14580
     gcagtaacag gttgtgatac tattcgggca gtatcaccaa aatttaaatc acaatggaaa     14640
     tactttgata atttcaaaga cttaacatca attattgatc cattagttgc atttaaaaac     14700
     tctgaaatta aacataccaa agacatcatt ttaactggcg gtgaaccttt attatattgg     14760
     aatactaatg ttattcaaga tttcttagct tattacattt caagaaaaca tcaaataaca     14820
     atagaaacta atgcaagttt ggatattgag ttctttaaag aatatcaaaa agaaattatg     14880
     ttcagtatgt cagttaaatt aagttgttca ggagaaccta aaaagaaaag aattaatata     14940
     aaaacaatca gtaagattct tgaaaattgc cctaaatctt atcttaaatt tgtagtcaat     15000
     ccagaaactt gggatacaga ctatgctgaa ataaaagaaa tactttatga tttacctata     15060
     tacactgaag tatatttaat gcctatgggt gaaactcgtg aattacaaat taagaataca     15120
     ccatttgtat ttgaaaaatg tgctgaacac ggatttagtt ttagcccgag agctcatatt     15180
     ttagcttttg atactaagga gggtatctaa tgttaagtaa ttgtgtacaa tataatatat     15240
     tagaaacaac tggtttaatt attattaaat ttttgttatt attagttgaa ttaggcttct     15300
     atgtatcagc tttattttta gcagttctta gcattattag tgtgtttaaa ataccaggag     15360
     tattttataa gttattcgtt tttattgttt taggtttagc agcgtttgct tgtttaagtt     15420
     taggctatac tataggttta actaatattg aatttatatt taagatttaa ggagttaata     15480
     tgaacttaat aattggtttt ggtgtagtcg ggcaaagctt aggaaattat tttgattcta     15540
     aaggcattga atataatata atagatccaa gatttaatga taaagatctt aatgaaattg     15600
     gtttaaattg ttatagcaag atttttatat gcattaatgt gttaaatgat aatattgatt     15660
     caaatcaaga cacaaaaaca ttatacgaaa ttttaaatac catagaatca aaagatttta     15720
     gtggtttagt tgttattaga tcaacattgt tacctagcaa tgtagatttt atagaatctg     15780
     aatacaattt aaaatttgta gcctggccag aatttctaac agaagttgaa tcattgaaac     15840
     gagcaaaata tcatataata ggtgctaata atattatgta tgctaaagaa attgctgaat     15900
     taatagatac gccttatgat ttttgtagtc tcagagaagc aatggaagtt aaatacgcta     15960
     gaaatgcttt aggtgcttta aaggtattat tctttcacga attaaatgaa gctgggttca     16020
     atgttagaaa aatagaatta ttattaaatg agttcgaaga ttttgattct caaggattaa     16080
     tggctaagtt atgtgtagat ggtaaaaaag gttttggtgg taaatgtttt cctaaagata     16140
     tccaagcatt gatatttgag tctaataaac aatctaaaca agcaggcaat ttctttagaa     16200
     atattttaga agctaataat caacttagat attgttgtaa aaaatcataa atatattaaa     16260
     tttaaaggtg taaaatgaat atgaatgtac aaaatccaaa attttctttt actgaagatc     16320
     aaacaaaaca agttcttatg acagcctatc atctaagtca agcttcagaa tatatccaag     16380
     aaactaacgg tatgatgtct ttaatgttta attctatggc tattgaatta ttagaccaag     16440
     ctggattatc tcaagcattt ttagatgaat taggatatac taaaacaact gaacctaaga     16500
     ttcaacttaa taagaaagaa caagcagaag tagactcttt attcgatgag attttaaatg     16560
     ggtctaaatc tacaacaaag gtagaaactg aagtcaaaga tttaaaatgt gatcacgaga     16620
     gttgtggttg taaggattcg aaaggaatat aatggttcaa caagaattaa gaaaaataat     16680
     ttttatattg tttgacgaac atttactttc acaagttgta gaaatgttcg aaaaatacga     16740
     atatatcata gaaaataacc cagaaggtat agaaacgaaa accgcgtatt taatttcgaa     16800
     aatatacaca actggtgata aatctaaagt tttagattat ttaaaacaat taggtgaatt     16860
     agaagctact gatatttttc cagatatcaa aatgctccaa tgtaaattag ctatgaattg     16920
     ttacgaaaac aatttaattg aatatagcaa attaatagca acattcgata aaaatgatct     16980
     ggattatgca caagcaaata acccagtagt ttacaacaca ccagcattgt acagagtttc     17040
     tatcaatggt aaagattttg acgacaacat caataatatc aacaaatgtt tgacttattt     17100
     gggtgataag gttgtattta gacaaacaat cgataaagta gatagaccaa gttataaaaa     17160
     ttatcttaag attagacatt ctttagaact tggtgattat gaatacgggt ttgaagcagt     17220
     tagaaattta caagaattat tttatcaaga aggattagat gctaaaataa actctgttaa     17280
     ttataaagaa cttttaagtg attatattat aattatggat tttatgagtg ctttccaatt     17340
     acttggatat aagtttactg acaaaccaga atataacaaa ttaaaacaaa tgtttaaaga     17400
     tattattata gaattaagtg tagattcttt attaatttta gaaacttctc aagaaaatgt     17460
     tcttaaaatt attgcagaaa ctaaaaaacg tctcataaat gatgtaaaat atgatgctag     17520
     tgaagttgat gcttatatgg gtccaatttt acaaaggata aaggataatg gtaaaagatt     17580
     taatagataa aaatcaagcc gaagttcagt taaaaataca agatttgcaa gacattagag     17640
     taggtataaa atatgctttg tgttgtgcta aaaagttaga ttcagaatct aactcaagtt     17700
     tagattcggg tttaagccaa gaagaactaa actttttagc ttgtttgact tgcttaccta     17760
     aaaccaaaac taaactcaag gtttaaaatg gctggtaaac tgatagtaga atttagctta     17820
     gatactaaat gtaacttagc ttgtaaatac tgttatagtg ctcatacgcc accaaatcct     17880
     atgtctatag acacagctat gaaattcttt gatagaatta attatatgtt agattattat     17940
     gataaagata gctatcatat ttcatacttt ggtggtgaac ctttgttgaa ctgggaagtg     18000
     attgaagcaa ctttaccaaa atttcaagaa gatccaagat gtgcaagcta tgttgtgata     18060
     actaatggtg cactattaga ccctaaaaaa gttcagttct taaaggctca taattgtgga     18120
     atttcactga gttttgatgg gctgtggcaa aatactaatc gcccagtggc tgaaggtact     18180
     tttgaaggga ctttagatta ttttaagcaa aacaaagcat taattcataa tattacagat     18240
     acctgtaaag ttatgataca acccaagaac ttcacaacaa tgactgaaaa ttttgagttt     18300
     tttgttaacg attatgaatt cttaagacct gatttttgtt tagttcgtga taacatttat     18360
     actaaaagtc aaatagaaac atttgctata gaagttgaaa gattagcaca taaagtactt     18420
     gaatatcaac ataaaggaat accagcaagt gtaggattat ttgatttata tgctttagat     18480
     attttagcag gtgctagatt tggtaaaaga gaccacggtt gtttcgtagg aaataacggt     18540
     tgtttatatg cggtagatgg taaattctgg ccttgtgagc gatacagatc aactaataaa     18600
     atggttctat atagtccaga atctggatta aatctaaaga atcttaagtt tatgtctaaa     18660
     tacgcagacc caagaaaatt caagaaatgt atgaagtgtg aaattcgtga gtattgtaat     18720
     gttgggtgta cacaccaaga aatgagagaa gctaaattcg aaggtagaga accaatagat     18780
     tctgtatgcc atttatttaa acattctttt aagtgggcta tgtttgtttt taagaactct     18840
     actaaagaat ataaagatta tctgtataga aggcttgaag ttggatcttg atatctttta     18900
     gcatctaaca ctcgagtgtt atttttttta agagccttta atcaaaattt aaacaaaatt     18960
     aggatataat taattatggc aaatatattc gaacaattta caaactgtct taaggacaaa     19020
     gattataacg agagtttagg ttttaatagc tttatgtttt gtagattctt agggtcaagc     19080
     cctaacactt tacaattagc taatgttatt aatatattat ataaaagctt gcctaacgaa     19140
     gctcaatata atttagtgag atatacaaaa aataaaccaa aatttataag atttacgaaa     19200
     gcattatccg aatcggaatc tgttaaagaa atacaattaa aatataaggt aaataaagaa     19260
     gtagctaaat tatatgcaag tattttagat tctatacgta gatcttaatc aaaggagcta     19320
     tgtcagctcc aataattaaa acattacact ccattgaatt ctgaatgcga ctgttgattc     19380
     ttttacttta cctttaaagg ttctcatagc aatcaaattt gtgtcactat acaaaccagc     19440
     ttcggtataa actacaccat cattagcaca gttaaaagca tcttgtgcga tattaatagt     19500
     ataagttact acaggctctg cttgctcaat accagtaact gtaatatcta ctgtagagtt     19560
     attattagca ccatcctgaa catttgtggc agcagtgtta accatattac cacttggtgt     19620
     aaaaattact tggttccaag ttctattaat atcaccttgt tcttgcccac tgaaaatatt     19680
     agtaacagac gcagtaaatc cagtagtttc atcctttggt gttaaaatat cagaaccttg     19740
     atgtcctttg gtgcccataa caaatctatt aatagcattg ctttcattga taccggcaat     19800
     caatttagca aattcagctc ttgctacatt tgtaataaga tttttctgtt cgaatttatc     19860
     gataacatta ccattagcat ctaaactttc aatacaaaaa taacctctgg caggtgtttt     19920
     ttgagcttct ttaaaattca tattaggcct ttatgatttt ttgatatatt tatttgggta     19980
     ataaataaaa caaaaagtga atacaatgca aaaagatcaa attgatatat ctatattaaa     20040
     tgtaaacaaa tatttgacta gccaagcaag aaaagaagct tttatctacg ataaagttaa     20100
     agtagaagaa aaatatgacg gtattaaagt aaccatagtt catatagata aaactggtga     20160
     ttataaacaa gattttattg tttcatacaa atccaatatt atatatcctg atgagtttga     20220
     atacgcagtc aaatccaaaa taagacctga aagcattaat aattcacaat ttacatttat     20280
     tttcgatatt cttaaaaaat gtgattcaaa gagtttacct ttaaattatg aattctttgt     20340
     agaattcttg atgaaaaaac ctacattaca acataagtat aagaagatgg gtgcaatttt     20400
     attagcttat agcccttgta cttatgaagt caaatttggg agattattca caaaaccaaa     20460
     aggtttctat acagattcaa gagaaactta tgctaagaaa ttaggatttg attacccaag     20520
     aactatattt gaaggtaatt tcgctaattt tgaacgtggt atcaaatcac aagaactcaa     20580
     tgatattttt agaacttata aaaatattct taaaatagaa aacatagatt tatatataca     20640
     acaaatatct gaaatgtttc ttaaaatgga atctaagtat ggtggtaaac ctgaaggtta     20700
     tgttttaact tatcccggat tcttattaaa aattcaacaa ccttatcaag tggatcctaa     20760
     agcaagagca gaaacccgtt cacaatatca aggagatcct gatactgaaa atgcttattg     20820
     ggctaacgtt agattagcag ctttaaatat tatcggagcc agtaatatta aaggttcttt     20880
     aaatgaaata cttcaaaagt atggcgaagc tcttaagaaa tataagttga attttacgca     20940
     tcctaaaaag acacaatttc aaataaaaga tgatattcaa ggtaatatca aaatgatcgt     21000
     tattaaaaga cttaaaggaa ataataactt tttattctta ggtaagttta gaattttaac     21060
     taaagctcat tataatatta ttaaaaatgg attaaaaaaa tacgataatg gtgtggtctg     21120
     tttagtgact tcaaaagata ctaaagagtt tgaagatctt agattagaaa tgttaaaatc     21180
     ttgctttcct gaaattgaaa ttatacaaca tagtacagga aatattatta gtattatgaa     21240
     taaatctaaa atgaatataa atgctgtttt atgcggtagt gataggtata atgactacgt     21300
     aaatcaatta agagctaacc cagatattca agttgttgaa acacctagag acactggtgc     21360
     gatttctgcg actgcagtaa ttgagaatct aaattcagaa gttttcttta aaagaaatac     21420
     accaagcgaa atacattcta tgtataataa aatattaaaa agatttaaaa gcttgggttt     21480
     agtatcagat ttgtctaaag aaccagaaaa taaataacaa aaacatcaaa tggaattaaa     21540
     atgactgagt taagattaaa tgtagattct aaagatatcg tagaagccgg agattataaa     21600
     tctacccaaa gaggtatgtt aacattttct aaaaatgccg tgtatttggg tgatggtgat     21660
     aaagctaata aaattataga tgcagaaagc ttaaaaactg aaatagaaaa agttcaaaac     21720
     aatgtaaata ctactataac tcagcaaata caaaatgtaa ataacactat aactcaagtt     21780
     caaaacacgc caacagttca atttttaaat atatgtgata atgcaactga tttagctacg     21840
     ttaaaatcaa gcgttacatt aaaaaacgtt tttgataatt gggtaaggca ctctactatg     21900
     aattctgcta gcggccccaa attagatgat gctgcaggga aagcagaagc tgctaaatgg     21960
     tcttacatag aagcagaaga tgctatagca agtaatataa attcaaatta ttataacatg     22020
     tttttaagta atgatatcaa agatacttat agtgtgcaaa tatcagccac tggtcaagat     22080
     ggggatgacg atgttttaag tattgttgta gcagctaaaa taattaatgg taaattatat     22140
     acattaagtg cagtgagatc tttacaatta aacactttac caggtggtac ttcctggggt     22200
     ctatttttta attattgtgg taacaatgaa gaaccttata caacttatag gttattagct     22260
     tctaaaggtg atatcaccaa taattatcct aaaacaactt ggcaagcagg caaacattta     22320
     ttaaaagtga ctagaactaa aaatagagta caatgttgga cttcagatct aaaccaagca     22380
     ttggatgaca actcattaat tgattataca ttaccaacaa caaaacctag tgttttatcc     22440
     gataatgaat ttaatatatt gaaagaatta ttaaattcac cttgtcaaat gggttttggt     22500
     aattggtctc aaaatattaa attttatttt gattctcaat caggtgtgta cgatgatact     22560
     ataatagata tattaaacaa tcaaaaatgg acatacaata gttctaacaa aaattgggta     22620
     gcgtctgcat tagataactc aataatacca gaaaatgttt taattagttc taagaaaact     22680
     aaaaaattgt tttataataa tggtattgaa atatcaagtt taaactagga tttaacactt     22740
     gccaaaccat ttaattaaaa ctttcttaaa tatggctata gccgtatcag taggtataat     22800
     ttgtttttta attgattttt atatacatca tacattatct tggaaaatgt tcttaatatt     22860
     ttgtataata actatatatt acgatattaa attaatttgt gatgttgtta atgaaccatc     22920
     aaatactaat ataaaacata aaatataaag actaaaaatg caagatttaa aacctcgaga     22980
     actaaaaact tatgaaatag aagaacttat agttctaaat acaaaaactg caaaagaact     23040
     cagagattct atggtagaat caaacccaat ttgcccttta tgcggttcta agatcttcaa     23100
     tcctgtactt gatcacaaac atagtaaaaa acaagaaaat ttaggtgtac aaggcgccgg     23160
     cttagtcaga aatgttattt gcagtacttg taatattttc ttaggtaaaa tggaaaataa     23220
     ttataaaaga tatagaattc aaaacttgtc tgatttttta agaaatgctg caaattattt     23280
     ggaaactgat acaacaccat atgtataccc aagcgaagca aaaaaattaa aagaaatttt     23340
     tccgaagtct ttatataata aactgattaa agcaattcat ttagaaacca aaaaagatat     23400
     taattatatt aaaaagaaaa ttaagcacac aaaatatctt agccaaaaaa caaaagattt     23460
     attaatatct tatggtttat attcttaaag tttaaagtat aactaaagtt taaaagttta     23520
     gtacataaat attaaaaaaa ggttaataat ggggttatta gaaagtataa aaaatagtat     23580
     tataggtgaa aaaatagata gaccattctt agaacaacct attaataaaa tagatactac     23640
     agttccattc ggtagagtaa taaacacttt atctgatgac gaacctttaa gattccaaac     23700
     cttttttgat aatgtaaatg acataactta tgttgataat ctacaaaaag catcagaaca     23760
     agctcaaaaa attgatatct acagacaaac tgctaagatt gctgaatgtt ggagtggttt     23820
     aacagaaatt gtagacgaag tcgcatattg tagagatttc aaagatccta ttaaattaga     23880
     agttgatact tcgaataaga aaatagacat agcaatatct aatgcttttg aaaaaataat     23940
     gaaattattt gggacccaaa aatatctaca ttcttttatc agacaatctt atatagacgg     24000
     ccaaatgaat atattaatta aataccacga tgataagaaa aaaggtataa aagaattata     24060
     ttatttagat cctagatatc tttggtatga tttaacagat tctaaataca aatacataga     24120
     tataaattct tcagtagctc ttaaaaacaa tttcttaggg aatcaaagat atatcaatat     24180
     caatggtaaa gctccagttc gaatagatca agctgcttta gaatacgata tagaagaaat     24240
     agttcatcaa aattttggtt tgttttcaga ttctggtatt tgtttaagtg aattagaagc     24300
     ttctgttaaa acagctaatc aattaaaaac acttgaagat ttgttaatac ctttaagatt     24360
     ttcaagatca atttcaagac gtgtgtttaa tatagattta agtgaattac ctaattctaa     24420
     agcagaagct tatatgaggg atttgactaa taagttcaaa tataaaaaac aatacaatcc     24480
     agaaactggt gaagtaacta ataaccaaca cattgtcact atggtcgaag attattggat     24540
     tggtaataaa gctggtgcta aaggtatgca agtagatatc ttagacgaaa ctggtaactt     24600
     aggagaactt ggtgatatta tgttcttcta caagttatta tatagatcta tgggaatacc     24660
     agttaataga atctacttag atgaccaatc acaacaacca ttatttgatt tgcaagcaga     24720
     tgctatcaca aacgaagaca tcaaattctt ccaaaaaata actaggattc gccaagtata     24780
     cactgaattc tttgtgcaaa ttctaaaaag agaattaatt tgtactaaag tttgtactga     24840
     aaaacaattt caagaactta aagattctat taatatatac tttagtgaag aaaatcaatt     24900
     tattgaaaga atgaacctaa cattgtttat gaaacgtata gatgcattct caacagctaa     24960
     agattttgga ggaacagttt tacctgtaga tacgttatat aaagaaatct ttagatttaa     25020
     tgatgttgaa atcaaaaaga atcttaaagc tattcaaaaa gaatctaaga acccattgta     25080
     taaacaattt tatagagatt ttgaaagtgg tgatgaattt agttcagatt ctgattctga     25140
     ttcaaacgcc ggccctaaat atgacgatca agattctgat aataccgata cagaagaaga     25200
     atatgataag acaggtttat ctattaaaaa agactcatta atttaaaact tttgaacttc     25260
     agaaattttt aagctatttt atgttataat tatttcatta aaagataaag gagccataat     25320
     gaataaaata gctaaagacc ctaacaacta tgcacacaat gttatgaacg atttaataga     25380
     tcgcgttaga aatgaaaaat taatatttac attcaatggt aaaaaatatt ttttagatca     25440
     cgtagattct tatcaacacg gtgaagattt tggtctattc tttagagggt tggattcaga     25500
     atcagatcga tgttgtatgg aagtacttgg ttgtgaactt tttatattca ataagaaaga     25560
     ttatataaat ttagattcat ttgaagttta tgaaggctgg ctatcatttt aggttttaaa     25620
     ttataatatt aaaggagtta aaatgcaatt aatagatggt tattatatag attctaacaa     25680
     caataaatgg gattcttcta ggtatacaga agagcaagct aaaaaagctt cagaatcttt     25740
     ggtgaactgt aaaaattgta ttaattgttc aaactgtaaa aattgctttg attgtgaaga     25800
     ctgtattaat tgttcaaact gcaaaaactg tattaaatgt gaagactgtt gagaatgtgt     25860
     aaaatgttta gattgtgaaa gttgcgatta ttgttttggg tgttatggga ttctaaaaca     25920
     agaaaatgta taatttaata attttttaag ttcaattata ttataattat caaaaggaga     25980
     taaaatgcaa attataacag attttttaaa tgaattaaat gcttcaaata gttctaatta     26040
     taaattagaa gttcttaaaa aatataacaa tgaaatcatt aaagaatttc tttcattagt     26100
     ttatgataaa gtcaaatatt cttacggaat taaaaaagta ccagaattcc aaaataataa     26160
     tgaaaccata gatttcaata caattaaaaa tacgttcata gcgttgcata atcgcgattt     26220
     tacagggaat aaagcgatta gcgtcataca tacattactt aataataaaa caccggaaat     26280
     aaccaggatt attacttgta ttttagatag agatatccat tcaggaattt caaccaaaca     26340
     aatcaacaaa gttcataaaa aacttataac agaatttcca tatatgcgtt gttcactaat     26400
     ggataaattt aagaatatta gattcccagc aatgattcaa ataaaagcag atggaactta     26460
     tagaactttt attaaaaaag gtgataatat tcaagcattt tcaagatctg gtgaaagtta     26520
     tgatcaccct aaagtatatt cagcattatt gaatctgcca gatggtgctt atattggtga     26580
     attaatttgt aacgaagttg aaggtgctaa ttcaactgaa attagatata aatctaatgg     26640
     tttacttaat agtttaacac cacctgaaaa tgtaactttt tatatgtggg attatttgac     26700
     tttagaagaa tttgaaaatg gaaatagtaa aacaccatat aaagaaagat ttgagtttgt     26760
     ttggagatta actgaatctt tagaatctaa tacattaact gttgttagaa ccagagttat     26820
     tgataatata gaagctgcta atgagtattt aaatacttgg ttaaaagaag gtgaagaagg     26880
     tgctatatta aaaaattgtg acgctgtatt taagaatggt actagtacag aacaaataaa     26940
     attaaaacca gaaatagaag ttgaagttcg ttgtattgat tttacagaag gtaatggtaa     27000
     gtttaaggat acttttggtg ctattgtttt taaaacagat gatgaattaa ttcaaggtaa     27060
     agtttctggg attagcgata ctgaaagagc tgaaatattt aaaaatagtt ctaagtattt     27120
     aaataaagtt tttacagtta aagcaacagc attgacaaaa tctgaagatt ctgaaatata     27180
     tgctttaatg catccaagat ttaatggatt tagagaagat aaagattata cagatacttt     27240
     agatagagtt aaaaatatgg gattaaaatt ttaagaaatc aatttagaat tcaactaggc     27300
     aattcactag ctgcttgaat tctaaataca acttcttcaa ttaaatactt aggtttataa     27360
     taaacatcta cataaatgtt attatcctga gtaggattat tagaaatatc acaaactatt     27420
     ttaaaatctt ctatattatt atctgcaaca taacttctac aaatttcttt tatttttgaa     27480
     gctaaatcat ttcttgtata ttcatcatta ttttcaaata cataatataa tgcagcattt     27540
     tcacattctc gaactaaatt gaaatatatt attctatttg ttaatttaga tccttttaag     27600
     gtattttcac ttaaagcgta tataccggaa tatccttttt taacaatatt aatatttaaa     27660
     tcatataaat cttttatttg tgattctgtt aaatatatat ccaaatctat tgtatttaag     27720
     aaactataaa ttgttttaca gtgagatact gataattctt gtgaattaat taatctggtt     27780
     cttaaaccaa caatatcacc tatgcaatta acatatatat tttgattatt aaatggattt     27840
     aattgtaatt tagaaccata gtagacaaca gcattgtttg aaatttgtaa ttgtttaata     27900
     tattcttcag gtttgatacc tctaggtatg cctacgaaag cgcagcaatc accacgagta     27960
     tctgctaaat tgatagcaga atttggactt tgtgtattag caattataaa atcaaatata     28020
     taatcgttag attcaccgac atttttatat gtttcatcta tttgagctgc acttggtaaa     28080
     cttgcgtacc cgttacttaa tttaagacta ttagaaccgt aaaaaactgt tttatctgag     28140
     ttaggttcat ttccatcagc taagcgattt aagccatcca catagtgtat attaccatca     28200
     tataacttgt attttttagg atcgaaaata atgaatatat aattagaatt ttcattaata     28260
     gtatctacca tatcctcagc ttcttttaag atatattttt ccattaatgt atcttttaag     28320
     aacacacaaa tacaatattg atttgaactc attgaatttt gaatatcttt tgctaaataa     28380
     ttgctgtgta ttaacatatt attaagaact tcatattgtg taaaaataca aactgttaaa     28440
     tcatttcccc actctcctgg gtttctagca atgattctta agaaattatt ttcagaaatt     28500
     atgggtttat ttctaaaatc atctaagtta tctattctaa catcaaagtc attaaatgga     28560
     tagctaatac ttgcgttaac tgaattttcg ccgatagatc tcgaaataac tatttcatta     28620
     ttatcatata aaaaataatt ataaatttga aaccagtcat ttatattatt tttgtttggt     28680
     ttaccaaatt ttgttttaaa atctaatata gaataaacgg gtgttagagt gtctggcgaa     28740
     cctttatcga aatatccagc atagaatact cttctttgtt gtgaataatt tgttgtggaa     28800
     ctagcatcgc tatcgataaa cctaacgctt gggactggca tcataatcct ttatacaaaa     28860
     atatataaaa tgaatgtaac tactaaaagc agtattaaca aatctactat tattaattgt     28920
     tcatattctt ggtcattatg tgttaacata ttttatactt tagtgtttac taagccaact     28980
     agttcagatt ctttagattc taaagctata cctataaaat atttttcttc ttttttgctt     29040
     ggatttacac aagcataacc gtcatactca gcgtataatt catcaccagc tcttacagaa     29100
     cctttaacaa ttacaggtgt ttggcccttt aaagctatta acacaccttt acaatcttta     29160
     ttaagaataa accctggttt atctgaaacg acacctaaag gtctattatg tttatagata     29220
     tcgaaatatt caatttctga attttcatta atgcctagaa cagcgccaac ttcaaactct     29280
     ttgccggttt cgtagacctc agctaagtca gcgtattttg cttttaaagc agttcctata     29340
     aaatcttgag catacatagc tttaaattgt tgggttgttg agccaattgt agatactaag     29400
     tttaatcctg gtaataatcc agcttctgtg gttaaccaag cttctttttt acttttgcga     29460
     gtttgtaatt gcttagattt agaatcgaca aatacataat ctgttaataa atcatctata     29520
     ttagtaatac tttgttttac ttcatctatt aaattatcta cgtatttttt agttgtgacg     29580
     tgagtaggtt tagatatttc taaatctatt ttattatctt gtttgatata gatacctgct     29640
     agataactat ctaagaaatc tttgaattgt tctaaagccc atttaagata ctttaagtta     29700
     ataacatcgt aatcatcaac aataggccaa tctttatcat tgtctgtttt agtagggtaa     29760
     ttatctacgt ctaaccaagg atataattca tttaaagtga cttttttcca catatcagag     29820
     ttagtatctg ggtaatatcc ttgattttca atatcgctag gtaatgctaa ataatatgaa     29880
     tttttaatag tttctatatc tggattatct tctgttatat aagaaacaat ttcacctgct     29940
     tcataaatta tgctagcatc ccatctgata gattcttttg aagtcaatat tttgaattga     30000
     ccaattaatt ggttaacctc tcttttgagt ttgttaaccg acttgtttag tgcgtctgcg     30060
     ctagctcttt ggttatccat aatattgaat tcttgaacga actctctaaa actagttaag     30120
     ttaaaattat agccttggta tctaaaatca gacattaaat ctcctgctta tatttttagt     30180
     atttattttt gatcagaggc ttaaatgatt taaataggtt aattagtatt taaggttatt     30240
     gtataagttt cgaagcttga agtttctacg cctgtaaaat tataattaat acttaatata     30300
     accctattga attctggttg tgaataaatg tctacacttt gaactttgat tctaggttcg     30360
     taaactttta aacatcttgt aatttcggtt tgtatactat taatagtaat atgatcaatc     30420
     atttcaaaca aataagcata taaattacaa ccaaattctg gtttaccagc taaggaacct     30480
     tttctagtag ttaatatgtt aaaaatactt tgttctatag cttgtttatc tataactaca     30540
     ttatttaaag aatcgttatg aaaatcttta taagttgcca tttatatacc tatcgtatta     30600
     ttttaaggca taagccgata ttaaatcgac ttgttagcct tgtccagcgc ctgcagcagc     30660
     ttcagttact tcaacactta atttaacaac cttttcagaa ccaccttgag ctgtagcttt     30720
     tacagtaatt tcagaagttc ctttagttgc agcagttata gtaaatttac cagaaccttt     30780
     ttcaactgta gcgtttgtgt tgttcgattc aactgtgaaa tcgctagcat ttgtagttac     30840
     agtgatatct ttagtttggc ctttttcgat agtttgtttg tttgcaggtt ttaaagataa     30900
     agtagtttct actgatggtg tactcacttc attatctgct aagtttgctt cagttctttc     30960
     agctataata gctttaacct ctgcttgtga tttttcatag attgaaccgt ttatatcgac     31020
     tttaaccgga tctacagtaa tatgttctaa tgccataaaa tacctttcat aattattaat     31080
     tattagatat ttatttttac actaaagtgt tatatgtttt agaactaaaa tgctatattc     31140
     aaaacattct aatgttatat gttttagaac taaaatgcta tattcaaaac attctaatgt     31200
     tataatttag aatctttgtc tttaggtgat atattatcta ataatctatc aattatactt     31260
     tgtatttttt catacccagc aaacgctata aaaatcgata aacctattct gctcgaataa     31320
     gttaaatcaa aattatcagt tattaaaaaa gaagataatg ctaaaatacc ggaggttgtt     31380
     gatgttttaa aaaaaagttt gaatctcgtt aaaaacttgg tttcatgttt agcagttttg     31440
     tctatatgta agaattgtac agcacctata acagcaccta taaatagtat gggaagggag     31500
     acaaacaaag catcataaaa gttcaacgtt ttactccctt taaaaattta tgttatttat     31560
     tacataaaat attagcaatc tatgggttaa ccaacataat caaaaaagct agctattgca     31620
     tatatcaacg aaaatgtaat aacaccccat acggttctat tgcatatttt ccaaacagtt     31680
     cttaatgaaa tagtataatg ttcaccacta gaacaatggt atctgcctat taaaaaccat     31740
     ctaaaaacaa accaataata tcttagtttc ttttttaaat cttctgcttg ttcacccatt     31800
     ctaagcctta tttattatca tatttttctt ttaattcgtc atattctttt ttaagtgctt     31860
     cataaagagc ttcagctttt ttagagccat tgacacgaat acaataacct atagcaaggc     31920
     caacaacgaa tatagcaacg taaatagcaa tacttaacat tcataatcct ttaatatttt     31980
     ttattattta ttaaactaaa aaaatcggtc gaaaaatcaa ataaatatta taaaaatcag     32040
     gatttttaaa tggctattat aaaagaaaca ttacctttta cgtatgatga aatatatcaa     32100
     gatatagcta aaagattaat tgaaaaaggc tgggatggtg gagcttacga aggctctaat     32160
     ggagcaatct tagcatctgt tttatcttat attgtaagtt ctttgaactt caatacagca     32220
     gtaaatgtta atgagaatgt tttaactttg gcaaccaaac gtaaaaatgt tatacaagat     32280
     gctagggttt tgtcttatga accttatcat aaaaaatcta caatacttga aataacatta     32340
     agttttacaa gaactggtta ttttaaaata ccaaagtata gtacatttac cataaatggt     32400
     tttacttaca attatttagg tgatgattta gaatttaata tagataaaat aggaaccaca     32460
     actacaatac aagtaaaaga aggtgcatta attaaaaacg aagaatatcc tgatatttta     32520
     acttataaaa tagatgaaaa atttgaatac atagatatac cttggaatga cgtagaagat     32580
     gatggtgtag aatgctacgt tacttattat gatacttttg gaaatttgtc ggataatgcg     32640
     acttttgtaa aatcttcttt taatttaatt gatattaagg atagtactaa taataaattc     32700
     ttcagaaaag atgatgtaga tactggtaat gctaggatat atttccaact aggaactgct     32760
     ggtactaagt taccttctaa tacaagagtt tatattaatg ttttaagaac ttctggtaaa     32820
     gatgcttatt atgagagatg tgattcagct tccgttaatg gagatcttgg ctctttttgt     32880
     aaaatattaa cttctggtaa agatgtgcca gtattagttt ctcaagctca ggatgaagaa     32940
     agcattgaat ccatcaaaac aaatgcacca atgttttata atagtgcttc aagaacagta     33000
     actatacacg attataattc agttataaaa acacactcga gtgttaaaaa tgtagtgact     33060
     tgggggggtg aagacgaata cccagtcgcg ccaggtaatt tgtatttttc agctgagccc     33120
     cgaagaaaag aaccagaatt tacaatcttt aaaaaagttc aacaaagtga tggaacatat     33180
     acttataaaa aagaaaactc tactttagca aacggtgaat tattgaatac tactgaaata     33240
     agtactaatc aatactatat aaaagaatct tataatgatc ctgacacatt atatttaaat     33300
     gatggtgaag tcgtttctgc agaaaaagat gctaacggtt ataaaaaccc aggtattttt     33360
     gacttagtag atacatataa tttaccagca cttaagaata atcttaaaaa tccaacatat     33420
     gttaatatag atttacaagt tcttattaaa caatatccat ttggtactcc aaaatcagat     33480
     attcgtaaaa aaatctatgc aaagattcgc gaaaaaatgg cggaaattga aaaatttgaa     33540
     ggtgaattta tccattctaa cttagttagg catttagaca atgaattggg tctgggtaat     33600
     ggtatagaag taaaaccata ttttagttta ttactaagcg aagaaaactg tgtaaaacaa     33660
     tttaaagaaa ataaagactt tagtaaagta aattgttttt atgctaaatc atatgacaaa     33720
     ttatctaaga atttagttct tagtgtttat tttagtttat tggctagtgt aggtgataaa     33780
     ttagaagttt attttaataa agaaagtttg ccgtttattt tagacaatac agatcattat     33840
     acttatgaat taacagatac tgacgttaac caatcttata aatcttttta ttttaaggat     33900
     gtgggatttg atgaagaatc attaaatgtt agaatagtat catatgacgg attaacaacc     33960
     tatggtggta acgacattaa tttatataac ttaaaaaata aaaccgtatt ttttaatgtt     34020
     aatataggta atgaattatc agttattaaa atagcattac caagatttgt tagtgtgagt     34080
     gatagtttta aagtttatgg tttatacggt tctcgaaaag cagaacaatt aatatatgat     34140
     ttctatatca cagaagagat gctttcgcaa ggctatctac aatgtgatga tttacaaagg     34200
     ggtcaatatg caggttttgt gggggcaagt gattataaag ttgtctatac ttgtaacaaa     34260
     gaatctttaa aaccaagtga tgatgaagaa cctgatagca atgggttaaa atctaatcaa     34320
     ttattaggaa ctgctagtgg ttcttgggaa tctgcagtca accaaactga aagtcaagat     34380
     aatgtttttg gtgatataga aacttctaat ttatattata actggtatga ggattctgat     34440
     ggtcaaatag atattagagt ttggatacca agttcagtaa aagccaatga tacattatta     34500
     atagactatg ctcaaaaaac tacaagtatt actataacag acactatgat agcccaaagg     34560
     cagtttgata caaaaataga tggtatatta ttagatatta caaaaatttc atttggtagt     34620
     gtagatggtt ctattggtat atatcctact tatatagaaa ggcaaaatga attaacacct     34680
     gtagaagatg acagaatcca atttgttgct aaacagtttg aaaatataac agaatataca     34740
     cctactacca catttgatag agaagttcaa ttaaaatcca atgaaaaaat tacattttat     34800
     gttaattata ataataaatt cgacgtcaga aatttaattg caaatcacga tgattcatta     34860
     gattcatatg cagttagcat accagatgat tctccattaa aatacgaagc tccttatata     34920
     gtattaaata attatagaaa aacaggaact tttaatttta atttagacgt tcaagtaaaa     34980
     cgcggtgatt tattgtatca aaatcaaata gtatatgtta aagaagctgc ggtagattta     35040
     tcagtagatg aaggacctgg tggggcttat gtatatttag atttaccaat tgaaggtata     35100
     tatgatgcta agggacaaat aataccagaa aatataccag caatagaatg ggctttattt     35160
     gctaaagcaa atcctgcaga aagtgaagat gccgaactta tttgtttcga agaaatacaa     35220
     gaacctagca aaacacataa agttatccca gcagatttaa cagattatgt agcagaacaa     35280
     aaaatagttg tcgactatgt tatagatgaa gaatctgtta agactatgtt accattttat     35340
     acaacagttg aagaatatat taatttagat ctatctaaag ttgcttatat aagaatacct     35400
     attaaattag tgaatagaag tgctactaca ccagaagaag gtgagcaaat tgtaggttct     35460
     tatacaatat ttaattcaag aataccttat attagagtta aattacaaac aaagattttc     35520
     caacctggat ataattatga atttatgtta aattatccat catataattt taaattaata     35580
     agaaattcaa tatttagact tagatctgtg gtttttgatg atttattaga ttaccaagaa     35640
     gttagagata gtttaagagc tggtgacatt gatatgagca ctatgagtgt ttgattatct     35700
     aattaagaat attttaagtt attttataat ataattatgt aaattgaaat aacgaggcca     35760
     taatgaagtt ttcagatttt ttagaagagc aagcaattgc taaatcaggt gattatgatt     35820
     ttggcaactt ggattatata ggtgctggag gtttgatatc aaagaaagtt gtgaaagttc     35880
     tccacaagtt taactttgat ataaatggtg ataatacaga attattcatt attgaatgta     35940
     atgctaacca ccctaaacaa aaatattatt gtgtagctaa agaagaaata gataaaagat     36000
     ttgaacctta tacaacaaga tttaagatat tagctgctat acttttggaa tatacaacaa     36060
     aatacagagg tttaggttat ggtcctctta gaatagttaa aggtgttgaa actttaagat     36120
     catatagagg tggtggaata ggtaaaaaat tatatactat cttagtcgat gattttaaat     36180
     gggcattgat gggtgatgaa gaacaatatg aaggtgctag gaacttatgg actttcttat     36240
     ctaaatcacc tgggtttaac gtcgatatag ttgagctagc aactggtaaa attattgcta     36300
     aaaatgttaa attaaaagat gctttagatc caagaatttg gaccgatgaa gaactatttt     36360
     taacaggaac taaagaagaa agaatacgtg gtagatttaa tagattggtg ttaactaaag     36420
     ttataaatta aaggagttta attgaaattt tcagattttt tagaagagca agcaattgct     36480
     aaatcaggtg attatgattt tggtaattta aagtatttag atggtcctag atatacttca     36540
     atagaatata catttgataa atcacctttt gtatataaag taatttatga tgacagagaa     36600
     tattattttt atcgcagaga atcttatcac atcttagcta ctaaagtacc tgaagattat     36660
     ccaactaaaa ctaatcctaa tggaactaaa gatagatttt atcctatagc tatgattaga     36720
     ttattaccta ctgataaaat taaaagaatg ggttataaga atacttatac agttagtgct     36780
     gtagaagttg ataaggatct gcgaggtaaa aaactaggta aattattata ttatctatca     36840
     actgcagttc ttaaatatac tttattaggt gattctgagc aatatgaaaa tgctaggaga     36900
     atatattatt cttttagtaa taacccagga tttacagtag atataatcaa attaggacaa     36960
     ggagtcttag caaagaatgt aaatctaaac gaccacaacg atgaaagagt ttggagtaca     37020
     acacctgata aagtaggaac cttacataga gtggttctta agagtgttca tatggaatct     37080
     aaagtagaag tcaaaaaatt aaaataattt aattaggact aagagccaga taaatacact     37140
     aaaagcataa ttaaaggttt gatgtgttta aaagtatagc taaaaactta gtcccagaaa     37200
     attacaaatc taataaattt attatggacg tccttgacgt ttttgtagat tatatctatg     37260
     ataattcaag cctagcgatt gacatcaata atttatataa ttctaaaaat gaagttctgt     37320
     atgaagaaat tattaaaaca tatgctgcaa acttttataa gactataacc gatggttcaa     37380
     aaaatcataa acttgcagaa gctgttagaa aagcacacga aaaatatggt tttaatttta     37440
     gtgaaactca attagatata aatgtgatac acttattgtc gcaagaacaa ttagaattat     37500
     ttaaaaattt tcaacaatct aaaggaactt taagatctat tgagtttata tatcgtatta     37560
     tagaacaatt aaatattgaa agttttgtat tagaaaccga tggccaatta acaatagaac     37620
     ctggtgaaaa tatatttgag taccgtgttt atggatctat gttaccagaa atattcgaag     37680
     cgtttgttaa gccgttggct cacccagtgg gttggacgta cttgtttaca agaacttacg     37740
     ttcttaaatt cgaagattat ttcttgtgta aagaagttta cgatgtaaat gtttttagag     37800
     taacttgcga agattctgat tgtgaagata attttaaaac aaatactgga tatctttttg     37860
     aaactgacat taataataat ataatatatg aaaataataa accaaaaatg tataaagctg     37920
     atggaaatcc agtatttaat gttacaagat ttggtgttaa ttacccagaa ttaacattag     37980
     aatctgaatt aaaattagtt aaagatccaa ctattagaac tattgaaaaa tccagcataa     38040
     aaggtaatga caaattaatt gtatattttg aatctggtga aagattagaa caaaattcaa     38100
     accctaagaa tttaatatta tattattata aaggtattaa ctcattaaat caagaaatta     38160
     aaaaagatta tactgatttc ttaagcaaat gtgctttgga acttaattat gttagaagag     38220
     ttgtaaccac agttaaagac aaatatcaat ttcaagtaga ttttggttta gctagcacaa     38280
     ccggtaaatt tgcagctatt ggtgctggta atatgtatct aggttcagat acttggattc     38340
     ttggtaaaaa tagaatcaat acaaatacac cagtaacata tggaactaga gttcgtaata     38400
     aagttcttca aacttccgac tttaaagcat tgtataagaa aaatgataat tctattagac     38460
     aagtatttga taaagtttat tctggttttg atgatcacgt aaaatcaagt acttgtaatt     38520
     ttattttaga atctgataat ttatatcatt atagattata taacccaaat gcaatatttt     38580
     ttgaattaat taatacttac gggtatagag ttcgtgctaa aataaaatac aatgaagatt     38640
     cattagaagt tatagctgaa gatgaactta aaaatacgca attattatat atagataaaa     38700
     cattattcag taaatataac tcacaagttt acaaagattt taaagaatct atgaataatc     38760
     ctttaggaca atattataca gttcttaaaa aaggtgttaa ttacttgaat attgtagatt     38820
     ctaatggtta tatagttaaa ggtaattata gacttgtaga ttctgaatat agactttatt     38880
     taaatataaa agatcctgta actattcaat ttattgatga tacttatgaa tatgattcaa     38940
     gaccatttca aattattgat gttgaattaa gttacaacaa agattctaaa ttatatgaat     39000
     acaccacacc tgaaaaagaa tactattttg tcagtgtagc taaccgcgtt agtaatgtag     39060
     atttagacat tacatatatt gctggtctac aaaaaggttt taaaataact tcaagcactg     39120
     ctcaaaaaat aagagtatat gttatagata atacttctaa aagatttccg ataactatac     39180
     tgagtgcaac agccgaagta atacaagcaa aagaaaatag tatattctta ggtttaatca     39240
     atgctgataa ccaatacgtt gaaggtcaaa tagtttacga ttctgaaggt aaattagcaa     39300
     cattagattg taatgcaaaa acaaataatt taagtttatt atacttagat tattctgcaa     39360
     gtacccaaaa tccaataact attaaatcta caacatttga tattgctgga aatttctcag     39420
     aaattaataa taaaagaggt aaattccttt ataattttag aatcgaaaat attatgattg     39480
     ttaatatatt tgataaaaat aatcaaagaa tacaattaga ctatgatatt gaaaatactg     39540
     gagtatcttt ttatactgat tcgaatgaag ctattacaat acaatacttt gataatatag     39600
     atgaaggtat accaagaaca tatgcgatag atgctgaatt taaattagat actagttaca     39660
     ttaattataa cgcaaaaata tttaaatata aagatatatt attaaatata gatactagta     39720
     caaacaaata tgtttataaa cataatgaaa tgaaaactta tcctttagtt gttatggata     39780
     ctgatggaaa tgttttagac gttgaaatgg atattttaaa tactggattt aaaatatctt     39840
     attctgaagg tataaaagta agaatttatt atttggatga tactaaaaat agagctaatg     39900
     ttacttataa taaagctgaa aacccagaca tcacaaaatt attatatgct gttaaaaatg     39960
     gtgttataat caaacaagat attgataccg cgtctactga agatttttat tcgttttctg     40020
     gattaaaaac acttaaaatt aagaaagctg atttaaaagc tgttgaaagc aacgacccgg     40080
     attcaaaact aggtaaatat aaatttatta aaaatattga atatggcttg ccagttatgg     40140
     ttggtttcaa caatgattta aaattcaaag tcaatgaaga ttctataaca atttacacag     40200
     gaactaaaaa agatattaat attagatacg tagaaaaagt caacgaagaa agtttcttat     40260
     atacttatag tataagaaaa gatgatgatt tatttataga tgctcaaaaa gattctataa     40320
     aatatttaat agattatcaa tatgattatt taaataatag aattattttc acaaaagaag     40380
     atgatgatat cgttaaatta tttttcttaa agaataaaca caataagaaa acaatactta     40440
     gtattaataa tgcaaacttt gaggatatcg attttccaat taaaatttat ttaaatgatg     40500
     actttgttga atttgaaaat aaagaatcta tgcaattaga tataaatcca ttaaatctta     40560
     aattcaatca agatattaaa aatagaaatt caacaattag agctattaat aaaaatcttg     40620
     aagtgttaga acaaatagat tttaatttag cgccacaata tacctttaaa gcacttggtg     40680
     attatctcta tgagatagat ttcaacaaga ttaaattcaa agaaaataaa cttaatgaag     40740
     aatctctatg gtatagagaa agttcagttt atcataatca ttatgtggga tattttgcag     40800
     ctaataatgt tcagccaact caggtattta ctggtacgtc aaacaaatta gattatgaac     40860
     tcagagaaac aaacccttgg ggattaacag ccatagatac ttttgagtta actggaactg     40920
     ctgcaaatga tggctttgat gttaattttg aatttattga ttcttggcca gaaatcacag     40980
     aagtctataa aaacgattac acaggattct atcaaaataa atggggttgg caatcgggat     41040
     atgttgatgt ttaccaaact accagagatc ttgaaagatt taatgaaaaa tatgaaagat     41100
     tagaacacgc cagtgtatat caaatggacg attatattgt tataggatct aatgatataa     41160
     caaaagatta tatgtttaaa tggtacccaa ctagcaaatc agatgatttt agtgatagtt     41220
     tcttaagaaa tggtcaagtc tctgaaccag taacacctaa taaaatatat actggaaaat     41280
     acgacagaga acccgacaat ataattaata aaacaaatac ttgattataa aggatttaga     41340
     tggctgatat tattcaaaat aaaatgaatc aagtactagg tgatttagct cgtcccacta     41400
     agtttaaatg tcaaatattt ccacctaaag aaattaagtg tgaattaagt attttaaatg     41460
     aaggtgattc tgcgacatcc agcacttctg aaataagcca atatttagac tatttttgtc     41520
     acgctacaag ttttccggga ttgactgtag aaacaataga ttttaaatat cgtggtagga     41580
     ctctaccagt taaatccgtt caaacttatc aacaaaaatg gtcagcaact ttttataatg     41640
     atgaaaaaca tgcagttaga aagttatttt tggattggat gacttatgat caagcgcatc     41700
     aatttgagga taaaactaaa ggtaattttg aaggtatatt acccagcatt tctatatatc     41760
     aattagattt tgaaatgtct aaagattgtg ttgtatatac tatgatgaat gtatttccaa     41820
     caaatgtggg agaaatttca gttcaatatg acgggttaaa tcaaattgaa acttttacag     41880
     ttgagtttgc atatacccat tttgaaatta atacaatttc tagggaaggg ttaacgagtt     41940
     ctgaagtcac tagtttgatc aagaatacta tacagaatac tattaataat gttaccaata     42000
     ctttaaagga tgctgtattt ggtgctttag acgacctagt ttcacctgta ttggattcgg     42060
     tttcagattc atttgaaaat tttataagta caaaataagg ttttttatta tataatatat     42120
     ttttgatctt tttaaattgt attgttatga actttttaag tttttacagt ttatactata     42180
     gtattaagtc taaagcttaa attatcttaa gatactatta aaacgtataa aaaagtcttg     42240
     agtttttgca gcttatacta tagtactaag tctacaactt aaagtaatat taaaaagtat     42300
     aaaaaatgcc tgagttttta cagtttatac tatagtatta agtctaaaac ttaaagtaat     42360
     attaaaaagt ataaaaaatg cttgagtttt tacagtttat actatagtat taagtctaaa     42420
     acttaaagta atattaaaaa gtataaaaaa tgctcgagtt tttacagttt atactatagt     42480
     attaagtcta aaacttaaag taatattaaa aagtataaaa aatgcttgag tttttacagt     42540
     ttatactata gtatataaca acttaagttt actttaagtt taaatatgca aatctaaaac     42600
     ttaataaata cttaaaaatg aagttcaaac aaggcattta tataccaaaa aacccagaga     42660
     aatatataca tagttacaca aaaatgaatg aacacaccga atatcctgtt tacaggagtt     42720
     cttgggagct tagtttcttc aaattttgtg attattcaca ctctattact aaatggtctt     42780
     ctgagccagt cggcataaag tactttaatc ccgtcaaaaa acgccaatcc acatattacc     42840
     ccgacgctat gattattcgt aatggtataa cgtttttaat agagattaag cctaaatctc     42900
     aactgcccgg ttctaactcg aaatctagtt atgataaact ttcagcagca gtcaacgaag     42960
     ccaagtataa tgctgcaaaa tcttattgcg aagcgaacaa tatgcaattc ataatcttaa     43020
     gtgattcttt ctttaaatct tgattttaag tttttagctt tttgatttta aaactttagt     43080
     tttgcgtttt gattttaaac tttagtttta agcctaggat tcaaaaaatt ttttggcctt     43140
     ttaatatgat atattataat ataaaaactt tttttcaaaa aaatttttaa tgattttaca     43200
     gttgcttaga atttgactag aatttaacta aaatttgttt taaaatctaa actaaagttt     43260
     cagtttaaaa cttaaagtaa tattaaaaag tataaaaaat gctaggcttt ttaagtagta     43320
     tatactatag tataatgtct aaaacttaaa gtaatattaa aaagtataaa aaatgctagg     43380
     gttttttaat agtatatagt aatgctatat atcctatata agtctaaaac ttaaagcaat     43440
     attaaaaagt ataaaaaatg cttggctttt taatagtata tagtaatgct atatatccta     43500
     gtatatgctt aaatcttaaa gcaatattaa aaagtataaa aaatgcttgg ctttttaata     43560
     gtatatagta atgctatata tcctagtata tgcttaaatc ttaaagcaat attaaaaagt     43620
     ataaaaaatg cttgggtttc gtatattata ctatagtatc acgtctgaac tcataaatat     43680
     ttaaaacatt ctaataaatt taaggatttt ttaagcttat atattatata atatatcgat     43740
     tgaaaggata aacaatgaga ttaacttaca aacataaatt gtataccaaa catcaagata     43800
     ttattaatac atatctacgt ttaaaagtag agttcaactt atttaagctt gattacaaaa     43860
     gacttagata ttcaagtatg tttacacaga acacgagact taaaacacaa aaacaaatag     43920
     aagaacttga aacgaaacta accaaaaaag gtctcaatac acaaaaatta cgcaagttat     43980
     atactaaaat tgttaataaa aaacctttca acgcttttga acaaatcatc atcaataatt     44040
     ttgcagaaaa tggtaaaaaa gcacctcaat tatttaaaca cgaacgtaaa ttcgatgata     44100
     gattcacagg cttgctgtta gaacgtaaaa aacgtcgtgc taaagcagct aaagaagtat     44160
     acgcaagaag accattatct ccagaaaaac aaaaagctca gcaattagtt ccatatattt     44220
     ttcaattcat taaactcaga actatggaaa aatttggata taacgaagat ttagcagtcg     44280
     aaataactgg tagaattttc gggcctggct gcgaagaagc tcttgatatg tatttaaaag     44340
     aattcagaga tttatatggt aatacagatc aagctttaga acatttcaaa aaagttgaac     44400
     tattagctga ttaaaaatat atttaattta tatttaatat taaaactaaa gttttaaaat     44460
     ccaaaggtga taaaaatgag tgaaactcgt atgaaacacg attatactaa cgaacttgaa     44520
     ctaaaatcgc tagctattcg tgaaaaaaat cttaaattaa atctaggctc tgaagaccct     44580
     gatggttcta taaatgaaga cttagacatt aaaataaaag aatatgttaa aacaaaagat     44640
     cctgacctta aagactatat tatcagtgta tctgagggtg taaaaatatc accaaaatct     44700
     cacgaatatt ttggcagcat cgttattcta atgattaaaa aaatattaac taaacctaat     44760
     ttttccgggt atacttggca agatgatttt tatagtgatg cttgctaccg tgtatttaaa     44820
     tatatccata atttcaacca tacattaaaa tctaaaatta caaatcaatc agtatcttgc     44880
     tttagttata tttcccaaat aattcataat agtattttag ctattattaa tgagaaaaat     44940
     aaaaaagata aagaacttga aaacttagcc tgtatgtaca attctgaata tgatatccat     45000
     aatgaatcta gaaatgcttc aacattagat attattaatg agttatctgt ggattatgtt     45060
     atacctaatt ttaatttaaa aatgattgaa aatattttag agactactga aaacaaatat     45120
     aaaaatgtta atattaaata caatgaaggt tttatatcat ttgatgatta tgctgaactt     45180
     aaaaatgttc tgagtaattt taaacatttt aatgtaaatc taactaaagg tgattcaaaa     45240
     tgaatattag tcaagattta atagcaaagg aaattaaaac attaaataaa ttctacaagt     45300
     ttttaagaga acataaaaat gaatgtgtta tggaaataat gcaagatttt tgtgatttaa     45360
     atgatattcc tttagaagaa cttggttttt tgatatcaga ggatgcctac ttaaaagatt     45420
     atatcgaagc aaatcttatt aaatataaat tctataaaag tcctaaaaaa gctgttttta     45480
     gcgacgattt ttaattttat ataagcaagt atcaatttta acactcagtg taatttatga     45540
     tatttgcttc gattctgcta atactgctaa tactgctaat actattaaaa ctctcaaaac     45600
     tactaaaact aagcttaaaa caaaattaaa ccgattttaa taaatataaa aaaattcaaa     45660
     gaaaggtacc taaatgttag ataaagtttt aagcaacgat agctttaaag atgttctaac     45720
     agaatcagtt aaatcagaaa ttgaatctgt ttttaatgaa gctgttgaaa ttaaagctgt     45780
     tgaaatagct aacgaacaaa tcgaacttga aaaaatcaag ttagtagaag agttcaaaga     45840
     agctaaaaaa gaacttgaat ctaaaattac taaaaatata gattcattca ttaatgaaga     45900
     actttctaaa tttaaagacg aagttcttga aaaattagac gctgttgttg agaacgaaaa     45960
     ggctgctact ctggtaagta tatttgataa cttagtagat gttgctggat caaacatact     46020
     tgaaaactat gtaaataaag attctgaatt gagtgatcaa tttgataaat tagtcgttga     46080
     aaatagagaa cttaaagccg aacttgagat tcttcaagaa tctaaaaaaa ttgatgaatt     46140
     agctgctaat ttaaatctag tggaaagtga aaaattcaaa aaattagcta gcttagtaga     46200
     acgcggtgaa ggttttgaat ctaaattaga agcgttattt gaagcttgta aaaaagcaaa     46260
     tgaagatgat tctgatgcag attctgattc taaagattct gatgattctg attctaaaga     46320
     ttcgaaggat tcgaaagatt caaaagatat caaagaaagt ttcaaaaaca aagcaggtgc     46380
     tggtattaac tgggctaact actaagttca accaacaagc tcagttaaaa ttcagttaaa     46440
     aaataaatat ataaaaattt aaaaaggtta aaaacaatgg acaaaaatgt aagtcttaat     46500
     gaaaaagtag agtcttatat taaagattca agatatgctg ctttaaatga aagtgaagct     46560
     gtattgatga gtacattgct tagcaatacc gctttagcat ctcaaggcgc tcttgtaggt     46620
     gaaagtgtta tttctagcga tattgcgaaa tttactccaa tcttaatgcc aattgtaaga     46680
     agggtttacc cagcattagt tgctaaccaa cttttaggca tacaaccttt aacaatgcct     46740
     actggttaca tttatgcatt agttaacaga tatacaggta ataaaaaaga cggtgctgta     46800
     tctccagttg gtaaagcgca aattcttgta tttgaagcta atgtaactaa aggcgatact     46860
     gttactggta caacttcaac tgctactggt aaaattatcc acgttgaaaa agatggtaaa     46920
     acagctttag ttcaattaac taacgataaa aaattccaaa atgaagaagc aaataaagga     46980
     actagaatcg ttaatgttta ttctaacgaa gctactttcc ataaaatctt agaaacttat     47040
     tcaggtccgt atagtacagc tgatggtgaa aaacttgctg aagatatgaa cactgtaggt     47100
     tttggaattg aaaaagatac tgttgaagca aaaacaagaa aacttaaagc tgaatacact     47160
     ttagaaatgt atgaagattt aaaaaatcaa cacggggtac ttgcagatga acatttagct     47220
     aatcttattg ctgctgaaat gcaaactgaa atcgatcgtg agattatcaa tttcgtaaac     47280
     aatacagcta ctgttgttgc cgatacttta agtccaggtc acgaacataa agaagctggt     47340
     agatgggaaa tcgaaagata tagatgtaat gctattaaaa tcgatttaga agcaagaaat     47400
     attgggttaa tgacaagacg tggttcaggt aatacattac ttgtatctcc aaaagttgct     47460
     actatgttag atcaaatcgg tacatttaaa tttgcttcta gttcaagtaa tattgctact     47520
     gatgtattta ctggtaatgt aggaacttat gatggtagat ataacgtaat tgttgaccaa     47580
     tatgctaaat ctgattatat cactgttctt tataagggtt caacggctca agatagtctt     47640
     ggattcttct gcccatatgt accattaagc ttccaaaaag tgatgaatca agaatcagga     47700
     caaccaggta tgattgcaag aacaagatat ggtttagcta ctaatccact tgaaccagaa     47760
     aattatgcaa gaacatttgg tgtagattta acaggaacta ttttagctta attacttcaa     47820
     taatttgggg atgttaaatc cccaatctaa tttttaatac ataaactgaa aaaactctta     47880
     aaattcaatt tttaaatcct taaataaata ataagattcc aatatacttt agtcgcttag     47940
     cctaaaggca tcgaaattgg tttaagggct caacaacgaa gcttgatgtg gttcgagaga     48000
     ctctttgtaa tatcaaatca tattaaaagg attaaaatgg caaatttact tagccctggt     48060
     atccaggttt ctgaagtaga tcaatctcaa atcacaccag ttgaaggtga ctctgctgct     48120
     gtttttggtg gtgattttga gaaaggacct gttggtgttc atactttaat ctcaagtgtt     48180
     caagaactta gagacaatta tggtatgcct aatacaaaga attacaacga ttactatcaa     48240
     gtccaaaatt tcttagctta tagcggtgca atctatgttt cgcgggcagc tgatttaaat     48300
     gggacgccta caaaattaga cggcttacaa tttgaagaaa atgcatataa aacaaatgtt     48360
     aatgctacta aagttgaagg tgttaaagtt atcgaagctg actctgtaga cgttaaattc     48420
     gaaaaaactg ataaatttca agttggtcaa gttcttaaat tcaacgattc taacaaagaa     48480
     tataaaatta aatatgttag aaacgaagtt aaacaaatac caaacccaga ttatcaacca     48540
     ttaacacaat tagtagtaga tccaagccaa gcaagtgctt atgttgatga agttgttagc     48600
     tacgtagtaa caaccaatgc agaatcttat actgtagaaa cagacaggcc tgatgtagtt     48660
     cttgttaata aatctaataa atctttaact gcattaaaag taggaactgc tattgtaact     48720
     tttagagcta caaaagaagg ttcaaggcca aatacttttg aatttgtttt aaatgttcaa     48780
     gaaaaagaac aaactaagct agtagtaaca ccagaaactg taaatatttt agaaggacaa     48840
     actgcaatgc ttaatataga tacagatgct gaaacttata gtatagtatc taaaaactta     48900
     gcaatagcaa ccatagccga agataaaaaa actatcaatg gtttgagaat aggttcttgt     48960
     ttagccgaag tatcagcaca agctaataat aaaacagaaa ctactaaaat cataaatgtc     49020
     aatgttatca caggtgttga aacagattta acagtaagcc cagaaggacc tgtaacttta     49080
     cacaaaaacg aagaacaaat atttgaaatc acttccagtg gggcttctat attagaaact     49140
     gctagtgaag ctgataaaga atttgtaacc gtagacaaaa ctgctaaaaa agttactgca     49200
     ataaaagaag gtaatgctgt agtccgagtc cgcgcaaaag ctttaggcgc tgatgaagtt     49260
     ataaaaagaa ttcaaataat tattttacca gaaaaaataa gtgccactgt tgagcctact     49320
     gaaataagta ttaatacaga cgctggcgac caaaccttaa cggtaacaac tgaagctaca     49380
     aatatatctg cacgcgttat agatacttca gtcgcaaatg tgagcaccca agaaaaaata     49440
     attactgtaa caccattagc tgctggtaat acagagattg aaataactgt ttcatcagaa     49500
     ggttattcaa ataatgttat cactgttcct ttaacagtta ctgctgtaaa tgcagatcca     49560
     agtggtagca ccaaccaaaa atctaaagct aagaaaggat aacaaatggc agatatctac     49620
     gatataccag agtttataac tcaagaagta actattgtta ctttagataa agaaccaggt     49680
     gaactaaatg cagacacttc tgtatactta ctagaaggtg aatcacaacc agattctaac     49740
     tatattttaa gtcttagagg tgctaacact gaattaaaac gtggtgatat tatagcattt     49800
     tctgatgttt taactgatcc gagattcaga atcttagcaa tctctgacag tatagtcaat     49860
     ggcgaagctt tcacaaatat tacttatgaa ggcacagagg attctgaagc cattgttgaa     49920
     gcaactaaag gatttccagt ttatttagtt aaatctacta aatcagcttg tgttgaagtt     49980
     cctgtagaag gttctgaaac caaatacgac tcatcagaat atgaacttta cgatcatact     50040
     attagtaact tcaatacatt tgatgaagat aaactatcta aaccatttgt ttataaagat     50100
     gcaaaattaa aaatatttgc taaaactcca ggtatttggg gaaataaaat cgatgttgca     50160
     atcgcccatc ctgatgattt taacaaagga aaatatataa cagatggtat accattagat     50220
     tcccaatttg attatattcc ttatggggat caatttgctg ttattgttat ctacgcaaac     50280
     gaaattcaag aatcatttat tgtaagtcta ggattgactg ataaaaatga gaaaaatgaa     50340
     tttacttata tagaaacaat gattaatggc aagtcaagct atatcttagt ttctgtgaat     50400
     gaagcagttc aaggtaaacc aaaaacttgt ttgggtgaag atttacttaa acttgaaaat     50460
     ggtatggatt cagctccagg tattgacgac atcatagacg cttatacaat tttcgacaac     50520
     aaagaagaaa tcgatgttga tatcttaatt tgtaacgaaa cttatccaaa agcagctact     50580
     gatattgcga ttactcgtgg tgactgtata gcatttatgg gtgctccaaa aagttgttca     50640
     gtgggctata aatctacaat tgctaatcaa aaaacacttg attttagaaa atctttaaat     50700
     atagattcta aatatgtaac tttgtgtagc aattacaaat atcaatattg tgctgagctt     50760
     ggtggttaca gatgggtgaa tctagcagca gatattgcag gtcttaaagc tcaaacaaat     50820
     tataatcaag ctaactggta tgcagctgct ggtcttaaca ggggtctcat taaaaactgc     50880
     gaggcgttgg catatagccc gacttcagga atgcgagatc ttttatacaa gaatggtata     50940
     aatccagtag ttatgtttcc aaacactggt gcagttcttt ggggtcaaaa aacattacaa     51000
     actaaagctt caagcttcga tcgtgtaaac gttgttagct tgtttaacca tttggaaaga     51060
     tctttaggtc gtatgtcgaa gtacagtcta tttgagttca atgatagttt tacaagaaat     51120
     taccttgtaa gtattatcaa acctttcttg gctcaagtaa aagctggtcg cgggatcagc     51180
     gattatttag tcatatgcga tgcatcaaac aatccagcaa gtgtaatcgc cgcaaaccaa     51240
     ctcgtcatag acgtatatat taagccgact tatgttgcag agttcattca tctcagattc     51300
     gtgaacgtcg gcgcaaacga ctttagtgtt gttgtaagct aaacccaagg ttcaatttac     51360
     aaaagattca aggattttac gatccttgga tccactgaaa cttcatattt ccacaatcgt     51420
     atattattct ataactattt agcatcatat tagcactttc tgaaagacta gggtcgaaaa     51480
     tctctaactt ttcttttagc ttatgttttt gaaattgatg tctagccagc aattttaaat     51540
     ctttgaagta aaaataattc ggttctgtgt tctccacgaa cttaaaacct aaggttttat     51600
     atattgaccc tttactaaat cttctattag cataactcac tatacttttt ggtttataat     51660
     tgtctaagaa atacttaaat aatttagaag ctcctcctat aactgaacaa tattttaaag     51720
     tacacaatct tattaattca tattcatagt tcttattaaa tctaggctta ccaaatgtca     51780
     taacttctac taattcgtta ttataaaata aacctaaatt aatttttgaa actgtcgatt     51840
     tctgtaaatg attctcattt aaaaagtcaa ctacttcatt ataatttaat tcttttataa     51900
     tacattttct agcataaatt tttttattta aacctaattt attattaatc atagaaaacc     51960
     atatatctaa atcatcggat tcaaaaatat ggaataactg tattcctaga gcttcacaca     52020
     tttctgtctt ttttaaatgg tatttcttat cataatctgg tgtattaaac attttatgtt     52080
     tatgtaaacc tctactatga aaaaataaac catcgtattc aattgctaaa ttataatctg     52140
     gtaaaaatat atctaattca taaggtgata taatagatcg tgagttaaca acaatgttgt     52200
     ctacttcgat agattttaca attttacttt gtatttgcga acgacacgat ttatcaggag     52260
     ctgatatatt aaattttttc ttgtattttg cggctgttac gtgagatata ttaaagtaac     52320
     acataaatgc ttctttatca aataaagaat cgctaataaa gttttcttct ataaaagctt     52380
     tatttaaatc attccattta gtaatatggc tagctccaca ttcattacca tagatttcta     52440
     aatttgtttg ttttcttttt tcactaagtt ctgctagctc tcttgcagat ttagaagccc     52500
     aggttttact aacagcttct ttaaattcct ttgtttggga attacagata acaccatatt     52560
     tttttagatt tgtttcaatt gttttatttt taacaacttc actttgtgtt gcatattcag     52620
     tattgtattt acttaaattg gtttcttttc ttttattgtt tatttcagta taatctgtgt     52680
     tggctttggt gtttctaatt ttatcattta cttctggtat ttgcgataca ttttctacat     52740
     tatatttttc ttttattgtt tctttatgtt tatctatatt attatagtta gcatcaccgt     52800
     atctttctaa ttttgtagat ttgattttag ctacgcgtat tttgtcgtat tctgatgatt     52860
     ttaggcattc tttgcaatat tgtgtctttg tcttagttcc acaaatcaca caaaaattag     52920
     gattgttttg caaatccttg tagtctttgt atatcgaatg aaattcctca ttatatttag     52980
     ggtcttttaa tagaatatca ataatttgtt ttctataaag tggatactgt tttaattcaa     53040
     tgagtatttc tttgaaagtt ttgtttagat ctatcgttat atttttataa gttactttca     53100
     tttaaatcct atttttaaat aatattatta tataatatta aaacttaaaa atatattaaa     53160
     atttttagat atattttaaa atattaagta agttttaagc tttaatatat tataattaca     53220
     aaaaggagat aacaatgttg ggtttaaaaa acttaaaaga tttaaatcac aaatatattg     53280
     atgctttata tcgatgtttg aatggtactg aaaatacacc aaacaaatac cacttagaac     53340
     caaacgttgg tgtacacacc gaaatggtta tggctaaagt caacgaatta tataaagatg     53400
     atcctgatta taaagtatta atattagggg cagctttaca cgatattggt aaaataataa     53460
     ctagaacacc atctaaaaat aacccagaaa aaatacattt tttaaatcac gaaaatgctg     53520
     gtgtgttctt tgcattagat gttttacacg atttggattt aaatctatcc aaacaagaaa     53580
     taatagatat aattaaaata gtagcccatc acgacattta taaattcgat tcagaaaccc     53640
     ttaaaaaacg ttatgtttat agagatttaa aattattatc caagttttca gttgctgatg     53700
     ctttaggtag aatcactgaa gttccaaaag aacttccaga tttaaatatt gaagcttatg     53760
     atagatctaa tgttgataat aaaccggttt tagaagtatt agtaggatta cccggttctg     53820
     gtaaatcaac ttatgtttac atgaatgata aagtagctat atcaagagac gatattttaa     53880
     tgagatacgg ttttaaaaaa tataatcaag ttgaatattc agatatttgg agaaacttaa     53940
     cagattctga tcaaaaagaa attgattctt tatttaatga taagttttta agagcactcc     54000
     aaaagaatca aaatatttta atagataaaa cgaatacttc agttaaatcg aggcgtagat     54060
     tatttactgc ttcgagcttg gttagaaatt atcataagaa agcagtagta tttttaacac     54120
     cttatacaat gatattaaat agacttgaaa aaagaaatag tactggtaag gtaattaata     54180
     aaagtgttgt ggatactatg ttgaaatcgt ttgtgatgcc tacttatgat gaatttgatt     54240
     caatagagtt tagactttgg ttctaagctt aaaagcttaa aagcttaaaa ctagagtttt     54300
     agatttttaa cataagattc atagaatttt aagttcaaat ataatataat aaacaaaaag     54360
     gagttataat gctagtttct cacgaagttc cgttaagtct tttagaaaaa tcaagatcat     54420
     ttaatgatta tgattatgct ttggttcatt tatttgaaat atatccagca tacaagcaat     54480
     tttatgtaga ttcattaaaa aaacgtagaa tagtttattt agataattct ctattcgaat     54540
     taggaacatt atatgatcac gataagtttg ctaaagaagc aactgaatta ggttctatca     54600
     atcctagtaa tttctattat atagtccctg atgctttggg agatgctgat gcaactatac     54660
     aatcttttaa agacttttct aagtttagta tacctggcaa gaaaataggt gtggttcaag     54720
     gcaatacttt agaagaattg acagattgct ttaagtttat gaaagaaaat gcagatatgg     54780
     tagctatttg tttttcagga gactacttct acgaatacga aggtgatact aaagaagcta     54840
     aattaacaca agcaaggata gattttataa aacatttaga taaattaaat ctattaaaag     54900
     attctaaaat acatttatta ggttgtcaag ttcctcaaga atttaaaaat tataagaaca     54960
     ttccagagat tgtatcttta gatacttcta acccaattgt tcacggtata tataatgtaa     55020
     gatattccag agatggttta agaactaaaa taagaactaa attagtagat cttatagatt     55080
     ataaaggttc cgttaatact attttattaa atattatgga ttttagaact attaatggcc     55140
     tttgatatgg tttaaacagc caaaattagg ttttaaaggg gtttaaatga aaataggatt     55200
     tacaggagtt tcaggttctg gaaagacgac tatagccaaa ttattaaaag aacaatataa     55260
     tttggctatt attccaggtc ctggaagaaa attaaaagat ttaaatttta atataaatga     55320
     aggtggtgat attgaaactc aaaaagcagc tttgaaaatt catatagaag atcttaataa     55380
     agatggtata ttcgaaagaa caatattaga tgctgtagtt tatactaagt atttggtaga     55440
     gattaaaaaa gcaatacctg atgtattttt agatttagct gaaatagttt ctattgaatt     55500
     aatgaaaaaa tatgatatag ttttttatat tagaccagaa tttgatttag tttcagatgg     55560
     tgttagatct gctgatttag aattcagaaa tatttgtagt aattattatg attactatat     55620
     agatacctat ggtattaatg tagttaattt aagtggttcg gtagatgaaa gatttgaaac     55680
     tgcagttaaa attatcaaca aaagatttgg aaatttaagg aacttttaag gatacttagt     55740
     atataattat aaatataaat aaaaataaat tagatctttt aaatattatt gttaaacgga     55800
     tttagaatat agccaaaatt gtgagcattt cggatttcct aacagagaaa atcatagtag     55860
     agttgctcct ttttctttag attacaatgt aactaaactg aaagcttaaa aaatttaaaa     55920
     aagtttaaaa ttttcaaaat ctgaacagag agatgctcac aattttggct atattttagt     55980
     tttaaattct aaacttaaaa aaattagaac tataaagact tttatgtgca gaacgccata     56040
     catacttctt atttaattgg gttttgttag tataaactta gcacatctga agtctttata     56100
     gttctaatta atgttcagaa tagtctctac cttgctgaga taagcgaact tgtggatact     56160
     tctataatat ttttatgaag gactggaggt agaacactac cacaaactca agacattctt     56220
     tagaactcgt acatcttttc tatccttata tttttgaagg accattactt gctcctatca     56280
     gaagatttca tactatagtg ttaaacttga cactatagtg ttgtatttcg attttagaac     56340
     ttaaaataat cttaaaccat aaaaatcatc aaaataataa ataaaacaaa agcaaaggaa     56400
     tggtttaaca gttatgtcta acaaaattga agaaattaaa acagcactaa aatctggtgc     56460
     aaaagctaca aaataccgtg ttaaactttc atttccaaca gaagtacagc ataagatgga     56520
     attacaaagc ttgaactgct tagctaaagc tactagtttt ccaggtgtaa ctattggaca     56580
     aattgaagta tttaaccaag gaagaaagct tcctatacct ggtgatactt cgtatgacac     56640
     acaatggacc gtaacatttt atatggataa tgcacaccaa actcgtaaag acttcttaag     56700
     ttggatgaaa gcttgtgaca acttccaagc aaatacccat tctggtaacc cagggggctt     56760
     atttacagaa gtttcggttt gtcaattaga ttcattagaa aatgaagttg ctgaatatac     56820
     tttaagaaac tgctggccga gtggtgttgg tgaaattagt gttggtgctg atcaattaga     56880
     tacattacaa gaatgtgata tcacatttag cttctcagat tggattattt ctaatgggtc     56940
     tgaatttaat atgccacaag acggtaaatc agctgctact aacgtagttt ctgtagacca     57000
     ataattctta agggtctgga ttttccaggc tcataaatac ttcaaaacgg acaaaatgga     57060
     tagtttaaag ttagttaaaa atcttattaa aaccaaatcg gttgaaaaag gacagatttt     57120
     aaaacctggt aatttagtaa tttttaaata taatcctaag gacaccagtg ttaaatatga     57180
     tagaactcca ttgtgcctag tactcagaaa atctaaatct tataccttag gtataaattt     57240
     tcactggtgc ccgataccaa tgagaaaaat gcttttaaat gccatatttc gactaaataa     57300
     aaagaatatt aaagagaata aaccattaga tatagattgg tatagaatta agcctatgct     57360
     caaaaagttt ggattttttc caataataag actttatatt aatagcagaa tatatagaag     57420
     agcagtcaaa atacctaatg aaaatatgaa acaaattata gaaactaaaa cagaaacttt     57480
     tataggtgtt tctgcagaag ctttgtataa gaaagctctt agggattcaa aagtttcaag     57540
     taaatctaaa aaataaaaca ttttttaatt taaagcttat aatattataa catataaaca     57600
     atctaaacta aagtttaaag tttaaaacac aaagctcata aataaatcaa aagacaaaag     57660
     gctccaatga aaacttatgt cgttgatact aacatcattt tagatgatgt aaataatctc     57720
     tcacgtttat acgatagtga aaatcgtatt ataatccccg aaacagttat tgatgaatta     57780
     gatgccaaaa aatcattatt cgatgaagtt ggatatcaag cccgtaattt tgcaagactt     57840
     ttatcaaatc ttgatgtcat tgaacttaat aaattcaatg actatactga gacaacactg     57900
     ggtgattctc ttttaaaagt aactattact agtaaaaaag aatataaaca cgcagatgaa     57960
     cctattaata ttctaaatga tagaaaaatt atagaagttg ctaagttata tccagattgt     58020
     atttttataa catatgatag tatgtgcaag ataagagcta tatctgaagg ggtaaaaact     58080
     gagacattcg gtttaaaaaa agattttaat gaagttccag agttttttaa agttctcgat     58140
     gttgagaaat taccagaaaa tcttagcagc attttaagta tagatccaga ttataaacac     58200
     gaaaattata actacttaat acagagtaaa gatggtaata aaaaactagc aagaatacaa     58260
     aatcttagaa ttaattacat agatgaaaaa cacttggaaa aacaagatgt caaacctatt     58320
     aatatccgtc aaaaatattt cgtggatgct atgctagata ctaatgtaga tttacaagtt     58380
     gtttctgcag tttcagggtc aggtaaaagc ttattagcta ttgcgactgg tatcagatta     58440
     gtcaaagaaa aacaatacag taaaattgtt tatatacgca actcaatcga atctttagat     58500
     aaaggtgaag atattggata tcttgctgga aatgatgaaa agtttgcggt ttttaatcac     58560
     ccattgtatg attctttaga atatattgtt agaaaaagac ttgaaagatc taatgataat     58620
     aaatcaagaa aagttaaaat cgataattta aaaatacaag aaggtattaa agaaattatt     58680
     gagttatctg gtatcgaaac tatgtggatt ggtgctttgc gtggtagaac aatttcggat     58740
     gcgtttgtta ttgttgatga atgtttgcac gaagatcaaa aaattataac aaataaaggt     58800
     attataacag ccaaagaatt agagtcttta tatatagaag atgatataga attattatca     58860
     tataacaaac aaactaaaaa acaagaatat aaaaaattag tatcattgaa aaaagaacat     58920
     ataaacaata ccaaagaaca aatgtttaaa gtttattttg aaaatggtga ttatgctatg     58980
     ttaactggta atcataagtt aataaccact aatggtggaa atataaccgt ttatgaaatg     59040
     atatcaagaa taagcaaagg tgagactgtt gaaatcgtta gcaaacatta atttattata     59100
     cacaattgat gaaaataatt tcatccaaaa attattatat ataaacgata ataatataaa     59160
     ctttaaaggt tatcataata ctattgcaaa ccagaaatta ttaaaaaaat taagacagct     59220
     agttactaac aatttaaaaa tagaattaaa acattttata agactcttag caagtggaaa     59280
     aattttctgt ccagattgtg gtgatttatt agaagctgat cttaattgta attgtaaaaa     59340
     gataaaatgt agttgttgtg actacaaggc caattcaata aaaggtatta aaaatcatta     59400
     tacaacaaaa cataaaacaa attacgttta caaacctaca gtgtattgtt gttattgtgg     59460
     tgaaaaatta gcagttaatg aatacgggta tgctggacaa tgttttaata aagactgcga     59520
     ttcatttaaa tttagaatag aaacttttag aacaaatatc acaaaaactg ttaacaatta     59580
     tactaatata aaaaggatag taagacacgt tcggtatagc cgagctgcta aactgagaga     59640
     agttatgatg tgcaatacat acataggaga taaaacgaaa aaagaattag ccggtattaa     59700
     agcgggtgct aaattatcag ttataatgaa agaaaaaata aaaaatggtg aatttacacc     59760
     ttgtgttact aatagctggt gcagaagcag aatattatac aagggcaacg cttttcgcag     59820
     ttcattcgaa gtattgttca aattattgga tacagaagac aaacttttat atgaaaaaac     59880
     tgtaatacct tacgaccact acggagtagc ccgtaattat atagttgatt ttaccgattt     59940
     tgataacaaa atattatatg aaattaaacc aaaatctgag ataaacaacg atttaaacaa     60000
     aataaaagaa aatgctgcaa ttaagtggtg taaaaacaat ggatttgtat ataaaataat     60060
     aaccgaagat tatttaaaaa aatataaaaa taaaattgta gacaacttct tggctaataa     60120
     ggtggctttt gacaacgaaa gtctacgtaa aattaataat tcgttaaaag gattaaaatg     60180
     aaagtaatta aaatagagcc cattgaatat aattcattta tatacacacc acaagtagag     60240
     ggtaatgaaa attatttttt agattctggc gtattatcta aaaattgtca aaatatatca     60300
     caaaagtcaa tgagtactat attaacaagg attgacaagg attgtaaggt tgtgataatc     60360
     ggatcaaata cacaaataga caatcaatat attaataagt ataacaacgc tttgacagtt     60420
     ctccaaaatg ctgttaaaaa tcctagcata attaatactt ggggtggtga gttaattaat     60480
     gtggttcgtg gacctataac tgagtttgct gagcaaattt ttaataaaga ttcaatacaa     60540
     gaaccagaga ctatgaaatc ttttgtagat tctggcatta gcacacttga agtgaataca     60600
     aatactgaga acttagaaac aaaattagac tctgctagct aatttaatat tattttaagt     60660
     ttattactat ataattacat tgataaatta aatcaaagaa gattaaaatg aaatttgaag     60720
     ttgggtttta cgccgatgag ttaaaagacg ttacagcaga tgaagctttt acaatttatg     60780
     aaaacttgta ttatacagag caagaaaaat tcataaatag ttttttaaaa aatactgaca     60840
     agatagaaat tgtagaaaaa atactagaaa attgttccaa agaagaaaaa gaagaaatta     60900
     aaaaattgtt agaagattaa aaatgaaaat tggtttgata aagacggaaa ggagattaaa     60960
     agattttgat tttaggattt agtatataga ttataatatt gaaaagaagt atattaatac     61020
     ataatttgta ataaataagt ttattataag gttaatccgt tacaattatg tataaaatta     61080
     aactattaaa aaggataaca aatgacgttt acgaaattta ttaatgaagc cattattaat     61140
     gaagctgcta ttgatgctat gctcaaggag attaatgtgg ccaactggaa aacaggtctg     61200
     gattttaaaa acgattataa aactgtagaa tcgtttggga agaaagcttt aaaaattcta     61260
     cacaagcttg ctgatggtcc acatagcaac aaacaatatt ataaacttta taatgacttg     61320
     cgggacgaat tatggaagat acacgacccc ctacttagct ataaaaacaa gctgccttgg     61380
     tatagagatg aactccaatc accagaattg aaaagataca gagaaatcat caaagattat     61440
     atatctgagg ttaatcaagc tatgaaagat ttaaaagccg attatgcttc tgtttctcac     61500
     attagtaata gaaatctgga atctatcata aaatctatta tagacgaata taaaagatta     61560
     tataaaatag ttgaaaaaat ggcaagacaa gccaataaag ccaataagta aaattattag     61620
     aaaataaact tattggagaa ctttatcgta ttacaagagt aggttgcttg tgaaacgttt     61680
     aaaatagaaa ggtttgttag aaaccttgat aataaaattc ataaaagaaa agttgatttt     61740
     gatacagctt ttcttaaagt atataattca tatgtaaata tggaagtaat aagcaatatt     61800
     cacgaagatg ataatctatt aaaggagata aaatgacttc atcaactgct ttttattata     61860
     aaaacaaaaa agatattaaa aaagacttaa aaaatggaac attcttgaac ataacccaca     61920
     aaggtggtag ttatggtaat aatctttgga actttttata ttcaaaagat tatattatgg     61980
     tagatcctga tagaattaat gtatctttat cctacaaaga cgtttgtgaa ttatctaaag     62040
     aaagttatga tctaaaagaa gtaaagaccg caatggatga acataaagct gagtttgttt     62100
     attttaattg acatcaaagt ataaaattaa aataaatcta agcttattat tatataatta     62160
     tcaataaatt gaaggagata acaaatgaaa ctacaagatt ttgattttag aatttgggat     62220
     aagcatcaca agggttgtgg taataaggat tgtaaatgcc aaacaaaata tgtttatggt     62280
     gaagaagcca aaataaggtt gttcgagttt aaagaggatt gtgaaataga actttggact     62340
     ggtttttatg acaaaaacgg caaaaaaatc tatgaaggtg atattttaga aaatgaagaa     62400
     tttgaagaac tttatcttgt tacaagaaat gatattgttt ataatattct tgaaatatca     62460
     atatatcgaa aaaatattaa aggtcaactt tacaaatata agaaaaatgc agatataagt     62520
     tttttcaaat ccatatcatc aaataagtat atggaaattg ttggtaatat tcacgaagat     62580
     gctaatctac taaaggagct ataaatgagc cagttaataa gcaataaaga tataataaag     62640
     gaaaacttct taaaatttta caatgatgac actttttata ttataaaaat atttagtagg     62700
     aagaaagacg ctattgttag taatgaagaa gatattttta aaaatgtttt tggaagtcat     62760
     aatgaaagat taatagcaaa ctattatatt tcaaatgaag aagattttga aaaatattgt     62820
     aaggtttctg aacatattgt taataatata ccatatacaa gagcatattt taatgtaaat     62880
     cctaagtcta agaaaaaagc tctgttacat ttaaatgata gagtaaatca gttggtaact     62940
     aactttatta ataatgataa tgtagatgtt ggtaaaaaga tccaagcatt atcatatagt     63000
     gttttatcaa aaccagaagc agatcaagat agaaatttaa attgggtaat tttggatgtt     63060
     gatgtttttg aaggcaagta caaagataat gttggaccta attgtgtatt aatgacagat     63120
     tttgaaaata ttttaaaaaa caatagcatt gagtatgtag attattcaac attaaatgga     63180
     catcatttta ttataaatca tagagattat ggaaaatatt ttgctaatcc aaaatctatt     63240
     tttcataatg actataaaag atttataagt aatgattttg tggatgaaaa gaaagatgca     63300
     gcagcattat tgttttataa aaattatagt gcaggaatgt aacaatgaat aaaattaaac     63360
     aacgaattat agaattaatg tgtatattct atcctataaa aatcaaaagc acagcaaaag     63420
     gcagctatta catatcatac aaatttaaat ttaataagta ttacgttttc ggtgatagag     63480
     gcggagaagt atttgttgaa aattataagg atgctttaag agtagcagaa tggatggata     63540
     acaattcata attaagtata ttttaagtct ataatgatat aattacatta ataaattaaa     63600
     ggagataaaa atgaaattag tagaaaataa attattagaa ttaatcaaac aaaatggcaa     63660
     tactgcttat aagttttagt tatcatatag gacaagagtt aagagataaa agaagagatg     63720
     aaggagaatt tgattaattt ttagatgaat gtgatatcgg agcaaaaaat ttagagaata     63780
     ctaattaaat attttataaa ggagtataat tatggcaata attttaagtc aagaagaaat     63840
     tgatgcttta ttagaatgtg gtagtcgtcc cacaaatctt ggaattaaat caattgtaga     63900
     tagaaaaata tcagagttga aaaaaagaaa agagcaaatt aagtattaaa atgaaagcaa     63960
     tagaaggttt aaacttatta gctcatactg atgattttac aattaaagac tatatgagta     64020
     ttataagtaa tttaatagcc tgtttagaat acaagataag tcattgtcaa tcatttggag     64080
     ataatatttc taataaaaaa gctgaaaagg aatttttaaa agaacttagt tcatttaaat     64140
     taacattaat cgattttgaa cttaatatga ataaaggaga ggaaattgag aaaggatgag     64200
     ttattaagta ttctagtacc tacaattgaa ggtgaagagt taaagaaatt ttataaagaa     64260
     ttaaaagata aagataaaaa ctttaaaaag gcttcaaaag agaaaattaa agagatgtct     64320
     gaaaggttag gaatatgata gagtcaaaat tcattattaa acgcaaatta gattttaaaa     64380
     acatgagatt tggatatcaa ttattggatg tttcaggata ctctgaattt gttgaaaaac     64440
     caatttatga tcatatatta gaagaattta aaaaattaga tccaacgatg aaagatatag     64500
     ctattttgaa taaaattaga tatattgata gagttagaga tgatttactt tatgaaacta     64560
     catttatttt gggatatttt agaaatgaat ttaataaagc tattaaaaat ggaaaagatt     64620
     tagacgaatt tattttttat gaccttcatt cagattggtt actgaaaata atagatgata     64680
     ttatagataa agaaacttta ttagaatatt taccatctat attagagtgt atgggtaata     64740
     taattaagtc tataaatgat aattttgatt tatcaaataa ttcaagattt aaatggtttc     64800
     aaaatactca taattatgta aaattactat tagacggtaa aattgattat gaaaactatt     64860
     gcattaatat ggatttagtt atagagagca atatggaaaa tgcgttatta tttgaaaaag     64920
     aagttattga agaattaaat aggtgttaaa atggataaaa aatgtagaga tggttatggt     64980
     caaattgatt atttagatgc ttatggaaat attattaaaa caggatttga agatcctgaa     65040
     ttagatgaag ctatgaaaaa cttaagtgac tccattgaca agacttatga aaaatcaaat     65100
     ttttatgagt ttattaagaa aaggtataga acaagttaca aagagtgtga taatgaaaca     65160
     aataaaagct aaaggtatag tattaattcc tgatggtatc gagtttagtg aagaaacaaa     65220
     tgaattttat gatgaaataa ctaataaatt tttagaaggg tatcctacga aatattctaa     65280
     gcaagaaaga acgaacttcc taagggcttg tatgagagtc gacttagaat acaataatga     65340
     gaataaagaa aggtttgcta tggacgttaa aaaattaaaa gaatcactag aaggtaaaga     65400
     tcaaggaaaa tatttctgtg agatattcaa taataatgtt gatgtcttgg ttattgatgg     65460
     tggtatgaaa aaacacgaag cgatagttca agttttagaa gacgtgaaaa tgttatacag     65520
     aaatgattaa gcaagaatta aaaatttaaa ggttaacaca acgaatataa aaatctgaaa     65580
     ttaaataatt ttgattttag gtaataaaat attaaattaa attaaattaa ataaagaatc     65640
     ataaaaatta aaacaaaagg agattaattg aaatcttatt tagaagacta cttagaatct     65700
     atctatgaaa acgaagacaa aattcctaaa tacaacataa atcaatattt tagatcaagt     65760
     aaagaaattg aatctttaga tatagattat gaaactattc ttatagctaa ggatatttta     65820
     agaaacccag ataattacac agaagaagaa atagatttag ttttaagtgg tgttttttat     65880
     attacaaata atttaaataa aatttgtgaa ataataaaca cctcagaaac aaattatctc     65940
     ttagatacgg aacacttaat tgatatgctt gtgttaggtg aaaatagact acaaaaatta     66000
     gacgacgtta ctttaaaatt tgcgttgaat gctatagtgg gtgctactat cgatttagta     66060
     gattctttat tatttggttt agaaacttta gcttcaatta aagctgagtc taagaccaaa     66120
     cccaagattg aatctaaaac taaaactaaa actaaaaatt aattttattt taagtaattt     66180
     taatatataa taatgtaaat ccattcaagg aatattaatg aaaacagaaa aagttatttt     66240
     aggtgtagac ataggttaca gctttgttaa agtttgtgta ggcactggtg atggtcaaat     66300
     aattaaaaag tttaaatttc caagtgttat aggccaaacc aaaaaacttg aaggtgttca     66360
     aaatgataat atagttcatt acaatgaacg ttattatatg gtaggtgaag atgccaaaca     66420
     tttaccaagt tctaatatca tagatttaga tacttataag aatttagaat attttggacc     66480
     attgttattg aatcacgcag tgaaaattgc taaactcagt aaagtagatt taatagtttc     66540
     aggattaagt attgcagaaa ttaaacaatc tggatatttt caaaatgtac taagtcattt     66600
     tgtggttgat ggtactgaat acaattataa tgtaatgtta ttacctcaag gtgctggagc     66660
     taagttaagt tatgaaaaat tcggaaatga ttttccaaat cttcaaaaag aatacttagg     66720
     tgattcaaca tattgtattg tggatattgg attcaataca ttagatttag ttcttgttaa     66780
     taaaggagtt acttcaccag aattattcga aggaatttca caacacggat tgatgaaaat     66840
     agcttcgcaa gttgctaaat tagtaaatga aaaacacaac agatctattt cattgccaga     66900
     ggctagagaa atcttagata cgggtgttta taaactaaga ggccaaaaat atgattatgc     66960
     taaagaaatt gaaggtatta aaaaagaata cttaagagaa attttagcat tagtaaatga     67020
     aagatatagc aatatattgg ataaactaga tttcttggtt gtgctaggcg gtggtgcaca     67080
     cattttcaaa tcttcaagtg atggttatat tcgttgcgtt attaaagata ctgagtatta     67140
     taatgctatt ggagaattta tatttggaac taataatata gattctattg aaacaaatga     67200
     ttaagacaag gagattttat gtttaatata agcaaaacat ttgaatgttg ttacggccat     67260
     agggtttgga atcaatcgct aaaacagcag tatagccttg ataatgcttg tgtttgtcga     67320
     catttacacg gtcaccaaat gcgtctaatg gttggcttaa aagccaaaga tttagaaggt     67380
     ggtatggtaa cagatttcaa gcatcttaat tgtattaaga aattggtgga tgatgttata     67440
     gatcataaat ttattatgga tattaatgac ccattatttt ctaatttatt tcctgaaatt     67500
     aaaacagatg atgatattga atgggtatat tcaaaggata ataaaagatt atatggaact     67560
     attaatttgc atagtttttc aaatgttgaa aaccatattt ttgagaaatt ggaaggtctg     67620
     gtagttgttg attttgttcc taccagtgaa aatctatgta gattttttgg tgagatagct     67680
     aaagattctt tagccggttt attagatgat agaattaaat tatcatttat tgagttctgg     67740
     gaaacaccaa aaagtcaatg tgtttacaac gttgaatctt aaacatttaa aggagctttt     67800
     atagctccat aattaatttt taagcttttt tattatataa taaaacaatt ttagattcag     67860
     acatataaca ccaaggtgta aaatctaaaa actaagtgtt atacactaga atctaaaata     67920
     cagtcataat cacgcaaaaa cacggtcaaa atcgacttta attttttgtt atgtaaaagt     67980
     attaatttac gtttaaagga gtttaaatat gatttctgca attgaattat ctaatattac     68040
     cgtcaaccca agtattcaaa ttattcgttt ctttaaagac ttcgaagaaa caagtccagg     68100
     taagttcgaa ttatccgatg attttgatct aagtactgaa ttatttttta tagatactaa     68160
     agaatctatt gataatatta ttaaattaat tattttagat ccagaattaa cacaaagtgt     68220
     aaagtttggt tcaattaaat atgattttat tataaacaat aaaaatttat atagaaaaat     68280
     tgttattaac tcaggctcta ttattgacaa gtttagtact ataccatttg aatatggtta     68340
     tgaagaacca tctaaggata cactaaaaga attcaatgaa tttatagaat taactacacg     68400
     caattattta ttcaatacaa agaacccaaa gggtataatt attacaaata caaaagattt     68460
     aaaattcgat gaacttaatg attttttaag aaattcagga tcgcaaacat ttttcaatac     68520
     cgatgctaga gattttgata ttcttagacg tgaatcaact atggtaactc cggataatat     68580
     tttctttaat cgtgggggtg aattagtttg tgttaatgat tttattgacc cattaaatgt     68640
     ttttaaacgt actacagcaa tgctgttagc atcttaagta ttttagtatt tagaatgtgc     68700
     tagcagctta aaatgttata aatatacata aaggtacctg atgaacttct acaatttaat     68760
     ttatgaaaac aaaaaatata aaccaaaaac taaagcagat cttaaagaat taatcaatga     68820
     tcttagtatt aaattaagtg atatagatac tagtgatata acagatttta atgaattatt     68880
     ttctggaaca aaaagaactg atttcaaagg tattggcact tggaatacca gcaatgttgt     68940
     tactgctaga cgttgttttt ataatttaaa agattttaat gaagatatta gtaaatggaa     69000
     tactgctaaa cttcaagatg ctagagaaat gttcttcaaa tgcaaatcat ttaatcaaaa     69060
     tttaaattct tggaatgttg gaaatgttaa gaatatgaat aaaatgtttt atgaatgtac     69120
     taattttaaa caaatattaa acaaatggaa agttgataaa tgtgagaact tttcagcaat     69180
     gtttttaaat gttaaatacg tagaggaaca ctttaaagaa tttaaatgga atactagaaa     69240
     tgctgacggt tattcagcaa acccattcaa agcttagaat gtattatagt tattataaag     69300
     gtgtttagaa atggctcata tattaagtca agaagagatt gatgaattat taggtggtgt     69360
     ggaagtacct acatttaaat atatttctga tatattagat agaaaaaatc aaaatattag     69420
     tgaagaaata agcgtcttaa gatcacaagc atctaagata caaagtttga atatattact     69480
     taaaacagat ttattcacta cttcagatta tgtaggtatc gtcagagatt tattagaaat     69540
     attagaatca aaagtagaaa aatctgaaat gatttcagaa attagttata atggtgaact     69600
     atctaaaaag gatattttaa aagaaataag aagtttaaaa tccagtttag acataaccta     69660
     tatcaaaatg acataaccta tcaaaacatt ttgataatat aattaaagga tatacgtgta     69720
     tgaagcagac atcaataatt ttttaacttt gaatccaggc attagaaaag aaacacattt     69780
     agaatctgca aaatctatat atccttggtt taaagatctc tggaatcttg taaaagattt     69840
     tgattataaa ttaattggta aaccatatgg atgtactcct atgttagaag caatgggaat     69900
     tacaaattat gatagacctg gtatagaaca cgattttata gattgtatag actatgcaga     69960
     ttatacctta ggtaatgcct taggtatagg cataggaatg aagctagcaa aaccagaagc     70020
     taaaatcttt gttttaattt ctgatgctca gttgtacatg ggtaatgttt tagaagcttt     70080
     aattttattt aaagagttta attttaaaga ttttttgatt tgtattgatt ataataataa     70140
     aggatctaaa gaacttaact catttaagtt taataattta aaccttttta aaatcacaga     70200
     atgtaaatta gatttagaac caaatgatat taataataaa attatagttt ttaaacatca     70260
     gaattcaaaa atttttaagt acattttaaa ttaaaactta aaagttttta atttttagtt     70320
     taaactagat ctaagctaaa atattatata atatataaaa ggcaacaaat gaataaatta     70380
     gaatttagaa tatatcgtgg tattgttgtt aataatgatg atcctaaaaa aggaggtaga     70440
     gttcaagttc gtatatttga acttcacgga atgagtgaaa atgctactcc tggccaatat     70500
     ccagtaactt ctggagaaaa ggatactaaa tataatcaaa tacaggaaag tgatctgcct     70560
     tgggcagaag ttatgcaaag tattgattat attggttatt atccagcacc ttcagatggt     70620
     tctgatgaat atgccaacaa tatagacggt aaaggttcta aatctggata caaaactata     70680
     acaagatctg gaaaatatcc aggatttggt tataacgtta tattgacacc aggaacttgg     70740
     gtattttgtg tcttagacaa caataaccca aacttaccta ttgttatagg ctgcattgca     70800
     agtgataatg aaatgcataa aaacacaaaa cctaaaaata caagagtata tgatagtatt     70860
     acaggccatt atgaagaatg gagtgatgaa gatggtaata ttatttttca tcatagaaca     70920
     ggtactacaa ttactatgaa taaagaaggt gaaatgacca tcaatactgt aaagaataaa     70980
     aaagaatata cacaagaaaa taatttgtta cacgttgatg gtgaacaaaa tgaatacgtt     71040
     aaaaaagacg ttaatgagaa atacgacgct aaccataatt taaacgttaa gtcaaatgaa     71100
     aagttagagg taggttctaa tagaacccgt aaagtaggag gtaatgaaaa tgtgacaatt     71160
     tctggtaacc agaatataaa tgtatctggt agtgaaacaa tttcagcagg cccaagcatt     71220
     actatgtctg ctggtgttat caaactaaac taaattcagt gaaaggaatt aaatgaaaat     71280
     atttaaaaat attaagttct tattttatgc aatactagta ctaataatta tttgtgatat     71340
     tatgtcttta attacatcgg gtaagcttac tatagagcct gcaacttatg ctttgatttt     71400
     agtagctatt tgtatagaag aagttatata cactcgcaat aaaattatag aagaaattaa     71460
     aggtattgat gttcatatta aattaaatga ttatttaatg tctactagta acaccaaaac     71520
     tagatattta aatacaaagc ctgaaactga ggctaagacg actaaaacca aagttgttaa     71580
     aactgagtct aaagctaaag aaagtaagtc taaagtatca aaagctaaaa ctgagtctaa     71640
     aactgataaa gagatattaa aagatatgtt aaacggagct gaataatgcc tcctttaact     71700
     agagttggtg ttgattttag tacaggtcat tcttcatttc cacctaatgt aatttcgagt     71760
     ggttctacga atgtcttaac taattcaatt agtacagtta gacaaggtga tcctatgata     71820
     ccacacccaa gtcctagtcc atcaccacca cacggtggaa gtattgttac aggttctggg     71880
     actgttatgg tcaattcaaa acctgcttgt agaataggtg atgccattag ttgtgggcaa     71940
     gctgtagcgc aaggatctgg aaatgttatt tgtggataaa gatttctaat taaggagtaa     72000
     tatatgtatt ttatttcttt tagtgaagct atagataaag atacagaatt aacattattc     72060
     gataatcatt ttgttaagat cgctaataat ttttatataa atgcttctac taaaagtatg     72120
     tcagatacat ataacttcct ttctgaaaat tattttgaaa atgtaaaaat atattatggt     72180
     aggctcggag atctttcagt ttgtgaagat ggtaatctta aatttttaga agttgataat     72240
     ataacaaagt tctaacctat gcttgttata ctaaaatgct gaaaatacta gacttataaa     72300
     gctatgaata cgaatgctat tttaatagga ccttgtaaat cgagaatacc catagatggg     72360
     tcactttcga atgcttttga atatttttat ttctcttggt tgtataatag aaatattatt     72420
     cttataatag atactacttt tgaatctctt gagattgtta aaaaatatct tgaaattaaa     72480
     tataacatta ataaagattg ttttaagaat attataatat ttaaaaaatc ttttatgtct     72540
     attaataatt taattttatt tgaaatgtac tgtatagatc atttcgacag atataaacca     72600
     tttttaaaat gcaagaattt atatgcttta agtggctcaa aaaatcatac actcgagtgt     72660
     aattattttg tggaatacga gcatttaaaa cctgtcggta aatcagttaa ttacagaagt     72720
     aaaatatttt ttgagatatt aaataaacct agatttcaaa agaatcaaaa atttattaat     72780
     accagagcaa aatatattaa aaaagaatct gaaataacta gaagtgatct aaacattatg     72840
     tctaatatat tcgaacaatt taacgaaatg ctatacatac aagatcctgt attttttgat     72900
     gtaaaaccta gattatttca agaatgtcaa tattttggtg ttccttatga gtttgttgaa     72960
     cataaagatt gttttgatgg tgctaattta agggcatttg actatgattt agaatccaga     73020
     tttatgagcc ttgaagaccc tataatatca ttattagtgg attctaatag tgctagtaat     73080
     gttaataata caaacaatac aaacaacact agatcataaa taaatcaaag gagtttaatg     73140
     aaacttatag attgttttaa agataataat gattctgctt atatttttaa aggttttata     73200
     tatcattata tttttaaata tagaatacaa atgcttcaag gtaaaagcta tattatcata     73260
     acttgttacc gtggtaaaga taatgaatac gtagctataa aaccaaaaaa attcaaaaaa     73320
     attattaata aattaatgga agaaaaacaa gcagatatat tcgtgatgga gggcactgtt     73380
     aaattaaact cagtgaattc taaaaatttt agatttactt tagattccgg aatgtatttg     73440
     tacataagaa acaaatccta gattaatctt gggtacaaaa gtacccaaga ttttcacaaa     73500
     ttatgaacag tatttgctat ttactagcca caagctgata atttaataaa cttttaagtt     73560
     atttctttat ataatataat ataattttaa taaggatttt aaaatgaatt taaaaagtag     73620
     aatttgtaat attttcagtg agttttcttt tgagaagtta atagaaagat tttttacggg     73680
     gttatttgtt ttgtttatag ctatatttgt agttgtttta tatacgttta tgttctcgta     73740
     tttagtcagt gtcataggtt ctataactat tgctatatta ttgtgcgtag tttttacaat     73800
     tatagtgttg tttttaggat cactcttagc tgtataatat ataaataaat taaagttgtt     73860
     tatataatat tgaatgatta taataggtca aaatttgttt aaaacactag aagttaaaaa     73920
     ttataataat aatccagatt tgaaaataac gttaaaacct acttataaat gtaaccaaat     73980
     gtgttcgttt tgttgtgagt atgataatac attcccggaa tgggatagat cgactattac     74040
     acgactcata gataaattaa aagatacccc agatagattt caaaaaatat ttgtgtacta     74100
     ttatgggggt gaacccacat tgtttaaaca ccttgaagaa ctcacagaaa aactttttga     74160
     agtttataaa gatagagatt tgtttataca atgtcaaaca aacttaagta tagataaaaa     74220
     tagactttat aattttaaat acaataattt tgagttttgt tcttcttatc atatgaataa     74280
     acaaaaagtt gaagatttta ttgaaaaact taatatatta aaagaattga atatattagg     74340
     ttactgtttt atgaatacat atttagatca agaacatcaa ttcataaaag aatttaatgc     74400
     tttagcagaa gtaatacctg ataaattaaa aatgagattt acagtagata acataaaccc     74460
     aggttcaaaa catatgaatt atgaaaaact aataaaaact tatccatttt taaataatta     74520
     tttagaaaca caatttacat ttttaataga ttctaaagaa gttatttacg ataaagcata     74580
     taacgaagga ttatataaac aatgtagatt ttgtaagtgt gaagttggat ctaaaagctt     74640
     ggttatcaat tatgatgaat tgtgttacca ttgtgatgat gaatctaata aatttaataa     74700
     taaagaaata aaaggtttac ctttaaaaga cttagattta aataattttt ttatacctta     74760
     taaaatttgt agagttaagc agtgccatag agggcttgaa tttaaaaagt ggagatgaaa     74820
     tgatcgaaat tttttgcaca accaaatgta attggaattg ctattattgt tgtgaaaata     74880
     tacataattc taaaaaaaca cctaattatg aagatattat attaaaagtt aaacaaaatt     74940
     tggataaccc tattatatta agtggtggtg aacccggtct gataccagaa aatataatta     75000
     aaactatatt cagtatacat agtgatgttt ctgttaatac gaatgggaca tttataaaaa     75060
     aatataaaaa ttttgtagat aaagtaacta aaatttatta ccattgtact gtagatttgg     75120
     aactcattga aaatatatac actgagaata acatagaata tttagttatc gtaactgatg     75180
     ataacattca taaattagat aattttttaa aaacttataa ttatatatat tttgatgtta     75240
     taccctgtaa tataccgcaa gatattaaat attataaaaa tttatcatta gaaaatataa     75300
     aattattgaa acaaattatt aaaaataata aaaatgttta taaaaaatct ttattgtatt     75360
     taatgaataa aaatagatat aatataaaaa aatttatata ggatttagct ttgattgatg     75420
     ttaattgtca cacaactttt ggtgacctta aaacagtaat tgtcggtata gaaacaagta     75480
     aattagtaag agatttaaca tccattggtg ctaacttcta tggtattaaa tctaagctaa     75540
     taacacaccc attaaataga gtgttaaaac gtatagaaca attagattca ttaagtttaa     75600
     tcttagaaca aaatggtata gaagtattga gaccagatta tataaatgaa gatataatac     75660
     cttcaaatgt tagagatata ttattctgct ttggtgatac tctttataaa atggctttgc     75720
     cattaaaata cagagtaaat gaatttaaat gtcttgaaaa tatttttaaa aatataaaca     75780
     aaattgtaga atttaagcaa atacaaaatg aaccatctgt agaatcttta aattatataa     75840
     taaaagaaaa taacaaggtt gaagcttgta tggatggtgc taacataata cctttaggta     75900
     aagactggat agttaatgta gcatcagatt ctcaatacaa tatgttttta gaattaaaaa     75960
     aaattaatcc agatattaat atgcatatag ttactatgga tactagtcat ttagatggtt     76020
     cttttagaat agttagaccg gggttaatat ttgtaaaaga tttatcttat atcactaata     76080
     ggataccgaa aatatttaag aactgggaaa tagttaaaat tgaacatata aaaggtcatc     76140
     gtaaggatgg tgtttgtctt tgttctgaaa tgggtatgaa tcttaatttt ttaatgttgt     76200
     ctacaaataa atgcataata tcaaaaagta acaattcata taataaagtt aaaatagaat     76260
     tagaaaaacg tggtatagaa actatagaag ttgacttaga agattctgag ttttttggtg     76320
     gtggtgtaca ttgttctact ttagacttga atagagcgga tgaattaata aaatatgtgt     76380
     aaagtcatag ttttaaattt aatagattat tgtggtttta attgtgaata ttgttcatca     76440
     agtcaagtta aaaaagtgaa ttcaaatcct ctaactaaac ttaatttttt aatgctgata     76500
     aagcaaattg aaaaaagtct aagtcgtttt ataataaaag ttactggtgg ggagcctact     76560
     ttacacccta attttttaga atttattgaa aaattaaata acgttaaaaa tatacagcgg     76620
     gtgataataa ctactaatgg tagttgtaat aatttagaaa aattaaataa ttataaaaaa     76680
     gtgcatacca ttattagtta tcatcctaat cagattgatg aagatagttt tataaacata     76740
     ataaataaac aaacaataaa acaactatat gtagcgttac cagttttagg ttaccctaca     76800
     aaaataattg attttctcag cacaaataac tatcattttt ttctaatttt tttaacagat     76860
     aaaaaaggat tgaaagttcc tgttgaagaa aaatgtttta atttttttga acaaatcttc     76920
     ttaaacaata aaaatatttt aaccaataga tttaatctaa ctagagatga acaatatttt     76980
     aatattttta aaaataatct aaataaatca ttgggttgtc tatgcaaccc caaattgata     77040
     tattatgata atggcatatt tacgtctaaa tgtcgtaact taaaatctaa taaattagaa     77100
     acaatgttcg gtgttgatat aaattgcaaa aaaatagctt gtgaagatta tgaaataatg     77160
     gagtaccgca aatgaaattg gtgagaggtt ttgaagaagt tttacctata attagcataa     77220
     acgtcacaga cgcttgtaat ttcaattgtt catattgtat tggttaccac aataatatta     77280
     ataaatctaa atttataaaa atatcaactt tgatgttatt tttaaaaaaa catatccaca     77340
     gaccagttaa tatacaatta gttggtgggg agcctacttt acaccccaaa ttgaataaaa     77400
     ttgtggaaat actagtgcat aataattata taaatcaaat tgccctcata acaaatttaa     77460
     cagcacctct acattcatat aattttaaca gtagcaaagt ttttatagtt gcatcctatc     77520
     acagcaaaaa cttttttaaa tttattttaa aatattataa aattaagact cgtaaaataa     77580
     tatcacttaa cacggtaaaa ctcaaacttg tagaaaatgt tgtagcgttg ttcgataaac     77640
     ataatattaa ctattttata aatcctatac acgattgtaa tggagtacca ttggatagta     77700
     tcgcaaaaaa acatagcaaa attttatata tgtttgattg gaatctcaaa tacaaaacac     77760
     acggtaatat tttggatgat aattttgaaa tattacgact aaatactaaa gatataaaat     77820
     gtaaaccttt aaatttttta ttagatgttg atggtacttt tatgaatgat tgttttaagc     77880
     atattaaaaa tatagatgat aatattgtag taacttgccc atataaaaat tgtaaatgtt     77940
     tagaactatg ttggtatcca aaatatgagt aacattttaa atttctcaga acttgcgaat     78000
     attgaaagaa atattgtttt ttttaatgtt tacgattatt gtggtgtaaa aggtattctt     78060
     aaatacttaa attttcacaa tcataatgta tatacatata gttatgatga tttaaaccaa     78120
     tcattttata ataatgtatt tgatactaag tttaatttaa aaaagtttaa aaaatactat     78180
     aatattttaa aaaatttaca agcaaaaaat gatttgtggt taaaaggatt ggctgagaag     78240
     cgtggtaaat acgaagtatt aaaatttgac ataaaatatt ttaattattt tgatgatgac     78300
     tggttaaaaa tatgtgtgtg gcgcgaccct gtgatatcaa tatctttaaa cttttttaca     78360
     gctgagagtg atgatcaata taacataaat ataattaaaa aatttaagaa gtttatggtt     78420
     gatatcaatg aatatgcaaa tgttatttgt tatgatgatt ttttaaatca tcttggtata     78480
     gacaaatata ctgacattga taaaagtgtg gtgaccagag aagctttaaa ctactctata     78540
     aatttatgta aacaatattt aaatttgaat tatgaggttt ataatgaatt actttaatgt     78600
     gaacaattat ttagaaatga gagaatcttt acacaaagaa tcaaaaaatt ttgaagaaat     78660
     agaaattaat atatcacgta agtgcaaccg aacttgtgca atatgcccac acagtaatgt     78720
     tgaatatcaa aaatttttaa acaattttaa taatttattt atgaataaat taatttttaa     78780
     acgtatagta gatgaaatat caagcataaa agatttcagt tttaatatcg atatcatagg     78840
     cagtggtgag cctactttac accctaattt tttagaattt attgaatata tattaaaaaa     78900
     aactacaaat tatataagaa ttacaaccaa tggtgataaa ttactaaaag attttgattt     78960
     tcgtaaaaaa ttatacaact taattgaaaa tcaaaatgta atattaaaca tttcagttta     79020
     tgattctaaa caagttaaaa aatatactgg actaaaaaca ttagaaaatg ttgtaataaa     79080
     ggatatgttt ttagacaaaa gtatcaattt aaaggataag catataaaca accgcgctgg     79140
     tagtgtagat aattcataca taaccagagt aaacaaaaca acttgtaatt acccctttta     79200
     tgcgttatat gtagatatcg atggtgatat acaatattgt ccacacgatt gggaaaaacg     79260
     tttagtgttt gctaatataa aggatatgag cttattaaaa gcctggtcta tcgaaactaa     79320
     acacaggtcg ctgatgttag ctcacaaacg cagcgagatt tatccttgtt ataaatgttc     79380
     agtagatgga tgtaaaatag gcaataaaaa aaggaaaatg tttgaataat atactattaa     79440
     atttaactta tgaaaaaaat gctagaaata atatgttaaa aacaatacat aagcctagac     79500
     attattataa tgaattacta cattgtattg attgttggcg caacaatggt ggatcactaa     79560
     aaaacataga catattggtt tgtactgacg atactacact aaaattgcca tttgataata     79620
     ttaaatattt atatgttaat tttgacaaca gcttatctga ctatggcttc gtaaatattt     79680
     acaaggcagg tcaagcggca attaataatt atccaaattt tacacatata catatagatt     79740
     tagatatgta tgttttgaga gacccttctg agatattgct ttttagagga aatactgcat     79800
     taggcgtata ttcaattgag gatgaaaact atcaaagaaa aaaaatattt gggacaaggc     79860
     ttgctgagac tgatctgata ataacaaaac cgggttcaaa tttttataat ctttatttga     79920
     aggagtttaa taaaatagca aaaatattga gggctcgaaa cacatccgag tatgacatag     79980
     aagaatatgt cgcggattgg atgttattta aaaatgaata tgacgtgata gaggaatacg     80040
     aatatggtga aaattttaaa tgtaaaccag ccaaccccct atttttacat catcataaat     80100
     attataatta gattaaatta aaaggtcttt atcaatcaca ctaaatcgtt tataataccc     80160
     aaaatcccta gtgtcatacg tattaaaatc cttagacagc gctaaaaaag gaccttcagt     80220
     atcaaaaatt aaaaaactaa cgaaacttat caatgaaata ttgttttgat ttttttatta     80280
     tatcagtgtg tttatctatt atgggtttgt tccataaact gtctatcact aacttggaat     80340
     ggcttgtaat ttgccagggt tgagtgttat taaaaggttc taaattattt gtgttacaaa     80400
     aacctacacg taaaccagga aggcctagtg tttttgaagg accataaata acaaaaaaac     80460
     ctttactttt taatttttct accatatgct gaaaatctgt aaaatcgcta cattgtgaag     80520
     tatatatata ataacttaaa tcaattattt taattttatt agttaattcc caaatattat     80580
     atcgcggaaa atttaacgta caaccattag gataagtcac atacaccaca tctgcttgat     80640
     taatattggt taatttcatt ttgaaaagat tggcatagac gtcaatcatt ttataattgg     80700
     gtaaatcata atatattgat aatccacgaa aataattgaa caaatctctt ataataccat     80760
     cagtaccaaa attaatgtaa tcacaaccat ataactcagg atttatatca ctacaatatt     80820
     gataaatatt ataaaaatta atattaacac cataatctaa tataaattta gaagctggta     80880
     cgttgttgtc agttttaaac ataatttgta tgctccttat atttttcaat atatttataa     80940
     cttttagtgg tgtatttttt tgttgaaaaa taaatatata aaaagtgtga taatggaatt     81000
     aagcaaaaag agattaaata aaataataaa aatatataat ttagcaacaa agccgtacag     81060
     tgactccaaa tacacagatg tttcgaaatc atattggtat tgtttggata taaagtttag     81120
     acattttgca tttgctaaaa tatttaaaat agaattaaat aattatggtg atcaggaaat     81180
     catttatttt tttataagga cacctgcata cgaatttatt aacccacctt taaaaatgtt     81240
     agatttcaaa tcgtatcttt ttaatgcatt gaaaatgaat aaaattgaaa tgatttcaat     81300
     tgaggatgtg caagatttga caaatattga tgaatatatc aattataaag ataaacaaat     81360
     acataagagg ggtgttagag agtttaccag ttattgttat atatgtctgt taaataattt     81420
     tttaaaataa tacctaatac gtaaaaatat agatatatgt ttgtgaaata aagacaaaca     81480
     aagtaataat taatttatca aataaaaacc aaagatttaa aaatgaatat aaattatggt     81540
     tcaatcaaaa agttttttgg gctagatcct gatgaaattg acgtaatcca agaagtaggt     81600
     gatatctttc aatttggcac tctttggata gctttatttt ttatagcttt gtatcctacg     81660
     aatatgacaa ttacacctat ggtgtggctt tatgtagctg caggacaatt attagtatcc     81720
     gctagtctaa agaaattggt ttctaaatac tttcctaaat tatcagttag acccaatggg     81780
     ggtaaagatt caatgccttc gggtcatacg tgtgctgctt acgctggttt tggttgttta     81840
     ttttttggta taaatgaata taatacaatt ttaattatag ctactgtgat attattagct     81900
     ttagctgttt ttactggatt ttcgagaata gctgcgaaaa aacatcattt tagagatgtt     81960
     tgtgtgggtg ctgctatagg tttaataagt tcttggatta ttattaatat attttagatt     82020
     cttttaaaaa tttcatctta atttaaagtt attattatat aatattgaaa acaaaggaga     82080
     atacaatagc taactttaaa gaatttttat tgttgcaaga gtctttgact aaaaagacta     82140
     attatattaa gctcggtgag aaatatatta atatgtttaa tcaagttctg gatgcaaaaa     82200
     aatacctaca aatatctctt tttaatgtag ataataaaca atactattgt atcctaataa     82260
     tgaaggattc aaagttggaa ccacattttg gtgtctttta tgaaaataaa ttcaatgagt     82320
     tggtagaagc ttttaaaaat aaagacacga agaaaatcag cgatttagtg aatagtgagc     82380
     tttttattca aaaagatggt tatctaaatt ctgatgtaaa ttttctaaaa gtattatcat     82440
     atgtgttttc ggttttagtg gattacctag caataaagcc aataggattt gtaaaaatta     82500
     tggggatacc gagaaagttc aatctttatc aaaaggtagt aaaaaatatt atccaaaaaa     82560
     atgagattcc atatcatatt gtagtagaag agcaagatga tagctattcc agtaaaatta     82620
     ctggtcaaat aaaccccgct aagtcaatga ttttaaagta taattttgct tagtgtgtga     82680
     aattctaaaa tctaaaatat gctaaattta ctaaaatcta ctaaaacttc agtttaattt     82740
     aagattatta ttatataatt atataaatta aaaaggagat aaaatgtacg ttgctagatt     82800
     taatgaatat tttggatatg actaccaatt aatggatgtt gaaacagttg atattttaga     82860
     aaatatctat gatagtttag gatatatgcc tagagatcca gaaccaattg atttagaaat     82920
     tgttttagaa gaattctata atacagataa aatctatgtg ttatgtgaag ctgatgatga     82980
     agaaattgaa ttttgttctt gtatcgatga agtagcacca gaagttatca tagatttttt     83040
     gaaatctaaa ggtcatactt ttatagattc aaatgcttga ttgcgtttgt ttgagctggc     83100
     tggtattggc taatgctaga caataccagc taatatccac aaaataaata atcacaaaag     83160
     agggattatg gactacttaa atccaggtta tgaagcacct aaaaaaggta atattaaaat     83220
     tacactagca tctttggtag atagttttca agaattttta acaaaacgta attatttttt     83280
     atataatata acaactaaaa ctcaaataaa tgatgtcaaa caaacgaaag tttatagtga     83340
     tttgcacgag caattaagat ctataactta tagtcatttt tacgacgatt atacttttta     83400
     tgctaaagat acctttgata ttgagcgtgt taaattaatt tttatgtctt attatttaga     83460
     tttacttgaa aaaaatgata ttgatttatc taataatgaa ttagttgcaa ataacgatgt     83520
     caatatcgaa cattttgatt tagcttataa atggtgtgat ttcaatactg aattaataag     83580
     aacaaaagca tatgaaatgg gtatatttaa atcttaagcc aaaggttctg aatgaatgaa     83640
     atcaattatg atgtattaga atatattatt caagagcatt taaattgttc tttgactcgc     83700
     gaaaaatctg tattagatta tttgaattta gaagcaacta aaagaaacca aaaaatcacg     83760
     ggtgagactg aatcatttgt agtctataaa ttcaaaccat atatgttaag tgatgatatt     83820
     ttgaaacctt ttactccaag tgctgataaa aataataaag gttattaatg atttataata     83880
     tcgacaaata cgatataaaa ctctataatg aattcttaaa caacttaact aaacataatg     83940
     tagattactc agaatacgtg tgtatacgag ataataagtt ctatttgtca actcaattag     84000
     agccttttat tctggattat atccctattc aaaatgcttc taaaatgttt ttgatatcta     84060
     aaacaaaagg ggttaataac caagatatat accaatacag aagacaaaaa gtaactgctt     84120
     ctaaagataa tttaaaatta tgcattaatg atgcttatca atatttcata gatttaaatc     84180
     aaaaacagaa aaattctata ttttactttg ttaatatatc gaataaagaa cgcgctgaag     84240
     ctttatctaa acaattaggt aggctttatt attttgggtt ttattataat aagtacagag     84300
     tttatttaac aaataatcaa tacacaacaa attacataga tcctgaaaat attttagtaa     84360
     gttctaatga tttgtttgat gctgagatgc aattgaatta taatatattt agattacaag     84420
     ataggcttaa aaaatttagt caaacaccct atagagaaaa tggcactaca gtgttaccaa     84480
     aatatataga tccatttttt agaacgcagg ctaaagttca aactaatcca aatgctaaaa     84540
     attaaaactt taatataata tataatataa aatttaaaac aaatactcaa aggaggcaaa     84600
     atgtctaaag aatcaagata tacaaaagtt aaaaaagcgc caaaaatgat ttcagatgaa     84660
     gactttgctg aattcttcca agcagctata gattctaatc ttaatgaaga ttttaaaaga     84720
     ccactcatag aatctaaata taaacttaaa tctaatattt tatacttaac agatgcttgc     84780
     aattttgatt gtgattattg ttatcaaaaa aatgatagag atcgtttaat aaaaaacacg     84840
     tatatatctg aaagagaaat taatgatttt tttaaagatc ttattaagag agaacccgat     84900
     aagcctagca ctgtagttat atttggagga gaaccatttt taaacccaga tattgtttat     84960
     tatatttttg atttaactga taaaataaca tttcatacta acaaaaagtt taacctatca     85020
     ttgactacaa atggtgcata ttttaaaaat actaaaaatg ctgattattt tatagaaaga     85080
     acccgcaaat tattaaacca tttttcttta gaaatatctt atgatttatc tggaaactcc     85140
     agaagagtct acagaaatgg taaagattcc acaaaagata ctgagtttgt tttaagttat     85200
     tttaaatcta aagactataa attaactatc cgttacactg tacataaatt aaattatatg     85260
     aatacattaa gagatttaat aacattaagt ttagattcta attataaaaa aattgtagtt     85320
     aatttctatg aaactgaatt agaacaatat ataaatgttc ctgaatttaa agaaactcta     85380
     aaaaagcaaa cttgtgaagt atttaaaaga actaaaatgc ctatttgtca tttaaattgt     85440
     ttggcttgta tgggttgtaa ctttgcagat tttgatggca tatattatca atacaatgat     85500
     aaatcatttg aagttcaaga aaatgcaaag atatttgaat cctttaccga acattcttga     85560
     tttagatttt agtacgcaat aaataaacta aaaggcaata tctgtgaaat tatctgaatt     85620
     aatgtttatt ttagaaggtg gtaatactac tacaatcaat aaaaaaacag gtgaatcaaa     85680
     aagtgctgaa aaaatagatt ttaatagatt atcaatagaa tcttttagat cagaatttat     85740
     agatttattc acaagtctta atagattatt ttttaacaaa tacaaagaaa aactttgggc     85800
     taatgattca ttaatcaaaa aaggtcttgt ttttaatggt tctacaagtt atattatgaa     85860
     ccctaaaatg gacccaaaag aaatctttaa atataaacaa agttctggtg atattgatat     85920
     tgttatacct gctggacatc aagaaaaact atgggattta ttagattctt tagaaggtaa     85980
     aacaataggt aattttgaat atcacggttg tttttcacaa aatcgtgaaa aattagggga     86040
     tcaattatta acaatattcg tgtataaacc cgaaaacata gcttgtcaaa tagattttga     86100
     aaatgccgac tttaaagatg gaaaaccaac ggaatttgcg agatttagtc acggttcaag     86160
     tttcgaggat gctaaagaat ctataaaagc atttgctcat aagttattat taagagcgtt     86220
     agtaggagct atttcagcaa atccaaatat agttgtagct actaagagtt ctaaacctga     86280
     caatatcaaa ttaaaagcag ataaaagcac ccctagaatg gcccaattca gtgttactag     86340
     aggtctaaga tttggtttag ttcctatgtt agataagggt gaaccagttt attacgatgg     86400
     taaacaagta tatcaagaac aagatactag tgattcagaa tttataacag atttaaaaga     86460
     aatatttaaa tatatgttta aatcaagtgt ggggttaaaa gatttacata gttttatagg     86520
     tgttgttaaa ttaatgaaaa aacactgcga tgaaaaaact attaaattaa cccaagaaag     86580
     attctttgat atcatttttg gaatgccagc acaattcata gagccaaatg atttgaaatt     86640
     agatagacaa gttaaattaa cggcttataa ttatttctta aaagaattac atttgagaca     86700
     cccaggatta gaagcagata tagatagata ttatattgtt aaaggttcca aagttaaagc     86760
     taaatcttaa atcttggaac ttaaaagctt taaatcagta ataaatatac aaaaagtagg     86820
     gttaaatggc tgaaataaaa actggtattt tattaagacg taatcttaaa aaacattttg     86880
     taaatgaagc aaaaccaaca caaggtgaaa tcgtccttgc taccgatacc aatgaaatcg     86940
     gtatgcttgt aaacgatgaa atacaatgga ctcctattca aggtgtcgtt aacacagttg     87000
     ctggtaaaca aggtgacgtt atactaaaca aaaaagacgt aggtcttgaa aacgttgata     87060
     acactgctga cattgacaag ccaatttcta attctacaaa attagaattt caaagacatt     87120
     atacagccga aaatccacac aatataacaa agaaaacact tgatttagaa aacgttgata     87180
     acacggctga tatagataaa cccgtatcta acttgactca aattgagtta aataagaaaa     87240
     tttcttggga tgatgctaga aagcaagctg gtgggaaaga cccggttttt acagatacta     87300
     cttatatcat tgcagatggc caactttcag aatttaactt taattcatat tataagaatt     87360
     tcatagatac ttttaatact aactccagag ttttgccaag cacacaagct cttatagcta     87420
     atggtaggac aataacctta agaagagctg atggctcgag tgaaagcata gaaacgcaag     87480
     atactttata tgatgattct gaacttagag cattaattga acaagctaaa atagatttgc     87540
     atataaacat acaagataat ttagaatcag attctactca agatgcttta agtgctaatc     87600
     aaggtaaagt tcttaaaggt ttaatagacg aaataaagaa ggtgattaat attacagatg     87660
     atgattttag aaatcttcaa gatattatta attatataga agaaaaccgt gaaaaatttg     87720
     atgatttgac aattactaat atcaaaggct tgcaagctgc tttagattct aaattaaata     87780
     gagatgattc tacatacatt gctccaaatt ctgcattatt agaatctcac ccagctagtg     87840
     attttgtatt aaatacaaat tataatgcta agttaataga aatacaagat tctttaaatt     87900
     ctatcaattc acaaattaaa ttatttgaaa cgcaagctgg tgtggattct aaaataaacc     87960
     aagcaatcag agatttaaat ttcactgaaa ctatacagag tattaatgaa caaattacaa     88020
     gactacaagg ctctttagat gatattgatt tggatgctat aacagaaaat ctccaaaggg     88080
     ttcaacaaga tctaactcaa cgaatatcac aattagaaac taatacatct aaaaaattag     88140
     aagaatttga agctattgtt aataattttg atatgtctga aatacaaact agtattaata     88200
     attttaaaaa tcaaattaac caaaatattg acagtataca aggtgttgta gattctataa     88260
     cagaatcatt agatactatt caaaatcaag tttcaaatga tatagcaaac aaagtttcaa     88320
     aggatgaatt agctactgag gttaaaacta ttaatgataa tattgctaat ttatcaagta     88380
     ttgtaaatga agcaaaatgg caagataatt tttatagtaa agttgaaaga aaacgacaat     88440
     ctttatggtc aattatatca atttcaaaag actctttcaa aggttcatat aaaaaaccaa     88500
     atacttataa ttactgggaa gcaaaatata aaaatcttaa gtatatcaat gataattttg     88560
     atagcttaga aacaatatct aatgcaccta catatgacgt tgttactaat caggttatta     88620
     aattaacttt tggtgatatt gcggaagcat catttttaat tggaagtcct aagaataaaa     88680
     ttcaaatagc taaaattata gcagtaaatg ctaatactaa aaaagctgtg tttttatgtg     88740
     ggtacccaag ttttatgaca gacgatttgt caaaaattat ggtaactata gaaaaagatt     88800
     caagttttgg taattatcta tcaagagcta ataaaacaga tccagaaact tttcaaaaaa     88860
     ttgtgactac acaagaattt gatttacctg acgatactga tgattattca tattttgaag     88920
     ctagttatga aatatctgga aatataataa cattaaccat acctgaaaat atatttttag     88980
     aattctatgg taatatggca gcagtggaaa taactgttac tggttctaac gcagctcaag     89040
     tctggtcaac tactttaaaa tccactgatt atgaaggtaa taaattattc tcaaatggtg     89100
     tgttggtagg aaaagattta accggagaaa tcttaactat atatgataat aaatctgtat     89160
     acataaatac cttggatgaa gctagaacta attataatga ttttcaaata atacgcgaag     89220
     aatacgaaga tattatgtat acaagggatt ttttaccagg aactatagag ccaggggatg     89280
     atgagttaga atggtaaaaa cttttaaact ttagtttaaa tatttaaaat ctaagattta     89340
     aactttagtt taaagattta aaatctaaga tttaaacttt agtttaaaga tttaaaatct     89400
     aagatttaag aattgtttaa gtaaaaatat aatataattc aatacaattc ataaaaagaa     89460
     aggaattata tatgttagaa ttaagcaatt ttcttagatc accattctca gagctaccag     89520
     gtatgccatt tgataataga agttatcaag atttattaaa aaatgtttct aaaacgattg     89580
     aaacataccc atcgtcaatg acttcgtatt taacaactga aactagttcg ggaattgatg     89640
     ttgttgtgtt agcaccagga gtgcaagaag atggttctaa aacaattgaa ttagatttta     89700
     aacccgatga aattgtaatt aggtataaag ttcataatga cgctaagtca ttttttataa     89760
     ctggttataa tacaatcaga gttagtttgg attctgttaa taactttaaa cttaaacaaa     89820
     attcatttaa agctagaaat ggtattataa cattttcgtt agaatctatt aaggaaacta     89880
     aaaatactta tacattctaa ttaactagag tctttggaat taccgaagac tcttaactca     89940
     taagattcat aaataaatat acaaaaagca aggattgtaa tggctttcgt tcataagaat     90000
     caaaaaacct tttatactga ttatgctatt aaacacggta tgatacctac tgaagatact     90060
     ataaatctat ttcctgtacg tcttaaaaaa gagacaactg atatctataa taaatttcaa     90120
     atggtgaatg gaaaagcacc actagagtgg aatcaatcag aaaactatga agttaatgaa     90180
     attgtaagat ataatgaagt agattataaa tgtgtgcaag aatgcattaa taaagttcct     90240
     agtgaggaac ctagtttttg ggctgttaca aaatatcaag aatatactaa atttcctgcc     90300
     agtaattacc tagctaaaga caatcaagat ccttacgatc ctagttcgat acaagattat     90360
     gaagcatcaa atacatacca cccaacaacc gttaaacacg ttgaagatcg tctaaaatat     90420
     tggtttgata atgaaactgt tacaaatgcg gatagacttg atggtgaaca taaagactat     90480
     ttctgttcta aacaagaatt tgatgatttt gccagaatag cattgactga aaaatctgtc     90540
     gttgatagtt tagaatctga taatcgtaga ttaccattaa gtgcttacca aggtaaagtt     90600
     cttaaaggat taatagatca tattaacaca attttaactt cgaatgatat gaacttagac     90660
     gaacttcaag aaattgttaa ttggattaaa acaaacagag atatgattga agctttaggt     90720
     attgattcta ttaaaggatt aagagattat ttaaatcgta tagattctga tttggggaaa     90780
     agagtcactt atgattattg gaatgctgaa tttctcaata aaattaaagc agtagatggt     90840
     catctatcag gagttgatgc ggatacatta gatggtcaac acgcagatta tttcttacct     90900
     gcaagtagat ttacaccaga agaaattact ttattacttc aaaaagtacc aggatctttg     90960
     ggtaaaatag atgctgataa attagatgga ttagattcta aagatttctt aagacgttca     91020
     actagtgata cacccacaca agataataaa tttagcttag gttctacagc tttaagatgg     91080
     tctaatatat atgctgttaa ttttcaagga accgctttac aagctaaata tgccgactta     91140
     gctgagtatt atgaagttcc tgaatctatt aaatcgaata taaaagcagg tcatatatta     91200
     ggtatagatg tttgtggtgt aaatttattt aatccaggta tgaaattatt tggtgttgtt     91260
     tcaaaaaatc ctggtataat tctgaataat gaatgtgatg gtgtaccaat tgcattaaaa     91320
     ggtagaactc cagtttattg caaaaataaa cctagtatag gtgattatat ctatgccgat     91380
     tctaatggtt ttggtattgc aagtgaaact gaattagatt taccattagt aggtgtttgc     91440
     ataggttcta taatgaatca aaacgatttt tggatttgcg agatcaaaat ctgatagatc     91500
     taactaaaca taaggagtat tataatgaaa tttagtgaag cattaaaata taaagattta     91560
     ctagattcag ttaaaaaatt agattcctca atcgaagatc ttaaaaaatt agctgattta     91620
     attactaaaa atggtgggaa agttcttggt aaacaattag aagaagatct taaagtattt     91680
     aaaaattatc aatgtctacc aaaatcttta gaagctttag aaactgctat aaaaaatcat     91740
     caaatttaaa ctactaaatt gtttaattac taaaaactcg agtttaaaaa ttagactcga     91800
     gtttttaatt cttatatatt atataatatt ttaaatttaa atttttaagt tttaaatttc     91860
     gggtaataat atacaacgag ttccaaattc aacaccttgt gtgtcttttt ggaattgtac     91920
     acttgaataa aaactatctt taaaacttga acctactata ggaaatgtta aagtatcttt     91980
     atacgtagga tttcctctcc attggaaagt ttgtcttgtg gtgtctacgg cagcatcttg     92040
     taaaacactc cattttggaa taccacaaga atctatttta tactcagaag tcgttcttgt     92100
     gcttgcatta ttgtacttag ctccagcatc cttaaaataa cctaatgggc tatcagagtc     92160
     actgtttata taagttataa tctctgctgg taatgtagtt tcatcataat tattagtatc     92220
     tactaaagat tctaaatcta aatccgttat attaatactt tctttgataa caccaaaata     92280
     acttctatct aatatatagc catacatagc gcctatagcc agattaaata acccgcctac     92340
     taaatcaaca accccacacg cgtgaccatt atgactaatt ttacccattt tagaatctga     92400
     aacactacct gttctataca acgcgttagt accatctgta tacccagcag ttttataatc     92460
     taaattatga atagcttgaa tatctctttg tgtactttgc atagtattca taccttgaat     92520
     gaatgcaaat ctatctgtcc ttgctttagc aaactcaata ttattaaaat tatttgtatt     92580
     ataagcattt tgatatatac atttagacaa caaaatcaaa taattataag caaatacagt     92640
     taatacttga aattcagggc ctctattttt aacagcttct aagaagcttg aatttctatt     92700
     cttaatagat tttaaatcat ctaaattcaa atcagaatct tctgtaattt tatttcccaa     92760
     agcaaccttt gcagaaacac ctgagattaa agctacagaa ttaaacttaa catcacaggt     92820
     taaaggcact gtattacgcc tagaacctaa aataccccct tggttagatg ctagatattt     92880
     gtctataaaa aagcctggaa tttcctcgtt attgttaata aatgctctat gacaccaaaa     92940
     accagattct tgagtagcag aaacttctac ttttaatcca taatatggtg cagcgtctac     93000
     atttgaagtc ttaatataaa gtttaggtat ccaaaccata acattaccac gaatatcagt     93060
     ataatttcca taattcatat gaccaggagt aaaagttcct agcataggat acatattata     93120
     tttgttagta atttcttcag gagcaatacc cacgccaaaa ccaatatcac caagatttgg     93180
     atcacttgga agtgcgccag caacttctcc gtttccgttt atccagcgat ttttattttt     93240
     tgttttatct atacaagtcc aaataacccc agtagttgta tttaaaaaag ttgcactatc     93300
     gattgtagga tttatagaag ttgtgggatc atttggttgc ttataattta tagtataatt     93360
     atcaacttgt gtatgtaaag ctttaatatc ttctttaacc ggatctaatt tttgatctat     93420
     taagaaatta gcggtatcag tatctataga atttttaatt ttttcataat tatctttaag     93480
     ttcatttata gctcctactg ctgtagtttt tgcttcggtt tttaatgttg ttacatcgcc     93540
     aatagtattg actttttcag ttaaatcttt ttgggtataa gcaccaagag ctaaatctct     93600
     cattatgaac cttttatgtt atttattttc gatttagata tcagcataat ttaagatatt     93660
     ttataatata atatcacaaa ggataaaaat gaaaggtaaa aattttagtt taaactcaaa     93720
     taaacgtaat aaaaatgact attaccaaac tccttatagt atgactaaac aactattaga     93780
     agttgaaaat ttcgaaggaa gtatactaga accttcttgt ggtgctggtg cgatagttaa     93840
     aattcttaga gatcatggta aacccgtaga ttattgtgat ttaaacaatg attttagttt     93900
     aacaggtatc ttcaaagatt tcaaagattt catcaatgat gattttgaaa aatatgataa     93960
     tattataaca aatccaccat ttagtttagc aaaagaattt atattaaaag ctaagcaaat     94020
     agcaaataat aaaatagcaa tgttattacc attgaattat ttacacgggg tttcaagata     94080
     taatgaaata tacaaggata ccgattttcc attaaaaact gtttatgttt tttgtagata     94140
     tggtttactt gaagatacta ttagagaaga tgggacttat aaagctggta tgatggtata     94200
     tgcttggtat atttggaata aatcttataa aggagaacct gtaataagat ggctaaataa     94260
     caacgattat atagtcaaat caaataaagg atcttaatgg ctaagttcgt tacacccgta     94320
     gggaatttac ttaattcttt aaattctaag aaccttagaa atgttcaaaa ttatagccaa     94380
     acaatagttt ggtcttttga aactaatgaa gagtttatat ctgctagaat agttgatgaa     94440
     ggtgtagaac atatccctaa aggcttaaag aaaacttgga cttccacttc tttgactctt     94500
     tctggtctgc cagacgatgt tgatttgtat cacccaaaaa tgattacata tctttggagt     94560
     ggttttaagt tggatggaac tgaatttaag gatactaatt acgaagaaaa agctactata     94620
     gaagatatta aaaatcaaga tatgcactat actggcaaat cctggggaac taaaggtatt     94680
     gctggatatt atagggataa taatatacta acatttcctt ttactgtaga agttacttat     94740
     tgggaatatt caggatctag ctctaaaact aattcagtat ctaaaaatac tcgtgaatct     94800
     ggttctgatg gactcaaggt tcaaagaact atgacccaag attattatat cacagtagtt     94860
     cctaatatgg atccagcatt attttgtaaa aaatatggtg atgcgcatgg atttaaaggg     94920
     cctaatggtg aagactttaa ttacgatcaa tataaagctt atatggtttc tttaggctta     94980
     gatttcttaa ctatagatag gtctcaagcc acttaatata ttgcaatata ctttaaatat     95040
     taccttaatc ctaaaatcga tttaagccgc gtttttgtgg gattatgacc acatttaaaa     95100
     tttacaaaaa atatctgaag cttcagctta atttaagttt attattatat aattatataa     95160
     atttaaatca aaaggagatt cagatgttac aagacaaagt tttaaaaaat tacagagatt     95220
     ctttaaacca aagattatca atcctaatca gagacccaga aaataacaaa gatgttatat     95280
     ctgatgttaa agttgaaata aaaaagatcg ataatatatt aaatagatct tacaaccgcg     95340
     gttaattcaa acaaggctag taatggttag acaaaggaaa tataatggta gattttaaaa     95400
     attttttaac agtaaacaaa gtttatatag ataaatcaaa taaaaaacca actcaaggaa     95460
     aggtaaactc agttctttat aagttgctct taaaaggtta taaaccaagc cagatattat     95520
     tagaagctat taataatgct tcggattctg atcttaaaac atttgaagaa tctatagtat     95580
     tagctgcagg cacaacattc tataaaaaat atactcataa attaagagat atttcagatt     95640
     atgaagatca attctatcac tatgtcttaa gatatatttt taacttagat actcacgatt     95700
     atactctaag tattaatttt agtgatctaa taccaaacaa agaactagtt gaattagatt     95760
     taatacaaga atctgaaatc gaaaaaataa caaaaaatat ccttgaatct caattcaatc     95820
     ctacggacaa tgaaaaagat atcataataa aatatggttt taaatatatg ccaaataaga     95880
     ttccaaataa gttagcttta gaaactttaa tttctaattt aaatcctagt gaagctcttg     95940
     aattctctaa aaaatacaaa ccagaaaatg ttaatgcagt cagaactatt gttaaatctt     96000
     taattaaaat tgaatataat atagatccgg atcgtttaga tagaatctat acaaaagaat     96060
     ttaatttacc tagatatatt aaaacttttg ttatgaaatc tattaatgaa ttaaaattgg     96120
     atcgggaaac tatattaaat gaaatgttaa tatacaagaa attctggcaa aatatacagt     96180
     atttaattgt tacaacacaa aaaagatata aaaatctaat agtcgcaaac tatgttttta     96240
     ataaaatatt aaaaagagat tataaacaaa cgagtactta tagaatcaga actttactaa     96300
     ataacccagt aaaatttaat aatgctttta ttgaaattta taagtataat ataaatttag     96360
     cttataaaaa tgtttttaat ttagcagcta aaactgataa caatgatttt agtattttgt     96420
     tgtatcatag acctaaaaca ctcaaacaat tattggattt agttcttaat tataaaagaa     96480
     ctggtaaagt tcgtatgtct aatatcaaag gaaatatttt atatttcgac aaagctaaaa     96540
     aaccagaagg aaatctttgg gaagttctaa gtaaattatt ttcaatttta ttacaatcta     96600
     aaaaagattt aattgatttc ggttcagcta aaagaatagc agtctctgat gatttagaaa     96660
     ctatagcacc accaattaaa tctaaagatt ctttaaaaac tgatgtattc tttccaaaag     96720
     gttccagcct tagaatagat tctaaatttc aagtattcgt tgcttggaaa aagaaggata     96780
     attctcaagg ttcgttagac ttagatttat cttgtttatt cagatctgtt tcagggtcac     96840
     taaaagatgt tttagattat acaaaacttg aagctgtcgt agacgataag cttcaaacac     96900
     attcaggaga ttatacaagt tcaagaagtt ttgatcctaa aaatccatta attacagcag     96960
     agttttgtac tttggattta gatcttaaat cagatttaga agtatatgta aatgttcata     97020
     gttacaacaa agttccactc agtgaatatg atgtaattgt tggtgttcta ccaggcgata     97080
     ctaaaaataa tgatggtgtt ataaatctcc aagacgctat ttttcaattc aatgttgatg     97140
     tagatttcaa agacatatgt gcgtttagaa ttcaaaatgg tttactacaa gttattggtg     97200
     aagcatttaa tttaaaaggt tcgcactcat atgggcgtag ttttgatcaa gttgcaccaa     97260
     tatatgatta ttacaaagtt tataatcaaa tgagtttaaa aagattattc gaattaatcg     97320
     taaaacataa aggtttagaa cttgttgata ttaatgacaa tccagattta gtagttagtt     97380
     ctaagttgag ttctaaactg agttctaaat ctagcccaga atataaagtt tataacgtaa     97440
     gtgaaaatgt aaacgaactc aaagagttaa tgataaaaga ttaactcttt gattctatta     97500
     agtttgattc tggatttatg ggttctatca ccgattcgat cggatttggc tctataggtg     97560
     catttggtat actaggagtg ttggctccag gattagaatc aaactctaaa gattctgagc     97620
     ctcttggatc tatataatat actttaaaat gtctatcatt tttaactgct tcatttaaaa     97680
     cattaatcaa atctttatta ttttctattc tatcatctat tccattttta ttaatatctt     97740
     tttcaggtgc gaacttgctg gcttgataaa caattttttg cccagaaaca tataagatta     97800
     tcgacccccc aaaagatact aacaaaggtt ccaatcctag atttgcatca aaaaatctat     97860
     taagaattaa agccaaagaa catataaaaa agttctgtat tataatatgc ctatttcttt     97920
     ctgggttacc ataattagca gaatctttag ttcctttaaa agtggcaata acagaagttg     97980
     ttctgtcaac acctacatat acacaacata gagtagcata tagtgtggtt agtgtttcca     98040
     ttggtacttg aaagttttta ttaaagatac tcgaacctgg tatataataa tctatgatat     98100
     aatctaagca ttgaaatatt aaacaaactg ctgtgaatat accaaagaat atgacgtagc     98160
     cagcagtgcc tttaatattt ttatttaatt tattagtaaa ataatcagat ttaatttctt     98220
     ttgctgtata tgtaaattca ttagtttctt tgtttaaata catatgaacc ttttgcatta     98280
     tttatgtcgt tttaaagttt aagtttatat taagctttag acttatgtag tatgcggaat     98340
     gaaccttttg cattatttat gtcgttttaa agtttaagtt tatattaagc tttagactta     98400
     tgtagtatgc ggaatagcca agcatttttt atacttttta atattagttt aagctttgct     98460
     ttaagtttta agtatatact aggatatata gcattgctat atactactaa aaactcaagc     98520
     attttttata ctttttaata ttgctttaag ttttaagcat atactaggat atatagcatt     98580
     gctatatact actaaaaact caagcatttt ttatactttt taatattgct ttaagtttta     98640
     agcatatact aggatatata gcattgctat atactactaa aaactcaagc attttttata     98700
     ctttttaata ttgctttaag ttttaagcat atactaggat atatagcatt gctatatact     98760
     actaaaaact caagcatttt ttatactttt taatattgct ttaagtttta agcatatact     98820
     aggatatata gcattgctat atactactaa aaactcaagc attttttata ctttttaata     98880
     ttgctttaag ttttaagttt aaatctcacc tagtgcttgt atataaataa tcttaaaaga     98940
     gggactatgc aaaaatatgt agccattgct ttcatcattg tttaaatctc acctagtgct     99000
     tgtatataaa taatcttaaa agagggacta tgcaaaaata tgtagccatt gctttcatca     99060
     ttgttgttat gctaggatat ataggatggc ttaaatatga taatgctcaa ttacaaacaa     99120
     ctatttcgag cttagaagcc aaaaacaaag gtttagaaac ttctctaaac atccaggtta     99180
     atttaaataa aatacaagac gaaaagaatc gagaacttgt taacaacatt aaagaacttg     99240
     aaaacaaacc cattaaaact gaaacaaaat acatagcagt caaggattgt aaagttcaaa     99300
     tatctaaagt agacaccaat attacctcag ctaaaggtat acctttattt ttaggaaata     99360
     taggcaaaac gcaaatatct aatcaaaaat aaggaatcac tatgaaattt aaaaagtttt     99420
     tattggcctt aatacccttt atttttgtgg gttgttctgc agttagaacc gagtttattt     99480
     acccaaaaat accagatgtt aaagaaccgc ctatgacaca agattataat ctaactgtaa     99540
     taaaaataaa taatgtagaa tattattctt taagccctga agatgctaag attttatcag     99600
     agaactggat caagtttaaa tcttgggctg agacaaatta cgaattatta aaaataatta     99660
     aaaataagga cttaaaatga gtttcaaaga cacattatta aacctagttt gtgaaggtgc     99720
     tagccgtgaa gagctagatc gtgaagattt agactccaaa gaccctaaaa tcaaagaaac     99780
     agattctggt gatatagata caacacctac tactaaagca gatattgtta aacgtaagga     99840
     ttctaaaatc aatgaagatg ctgacggcga aattgattct ggtgatgatt cagagcttga     99900
     accgttatca aaggaagaat tcgacgatat aattaattct ttagatccag atacggttgc     99960
     attaattata agtattctta atgataatgg atatatagtt gctactaaag aagaaatttt    100020
     atcagcagaa gattttgaag atattggcta tcttgtttta gaagttctcg aagaaattgc    100080
     tgagtatgaa gctaccaatt atgaacaata cggtgcaaac ccagtagacg aatcatttga    100140
     tgatgctgaa gttcttagag aagctgctat gattttagaa gctaatgatt taagtgattt    100200
     gagcgaacaa ttagtagata ttgcacatac taaacaatta agacgtgata gaaaaagatc    100260
     agcttggaaa agatcagcag ttctaagagc aagatttaga aaaactggtg aaggtagaag    100320
     agaacgtaaa aaagcactta aataccttaa aaaatacaga agacaacata aagcacgtct    100380
     gaagagatat tcacaaaaat ataagcaagt ttggaaaggt aatactaaaa actaatgata    100440
     ttttgtgaag atttagaacc aatatatgag gtagtgaaaa agctacctct ttataaacag    100500
     agagctaagg aagaagtgtt tttaggtatt ttaaaatcaa aatctaagaa atgggttggg    100560
     tggaaatacc taaaagaact taaaaaagat aaaagctttg ctaacagtac tatttttatt    100620
     gagctttatg agcttgcatt aaattactac tggattaaat ctcaaaacga ctccatcaaa    100680
     tacgataact tgataaaaaa ctataaattt taaatttatt aatattctaa gattttaaga    100740
     ttctattatt gtagggtttg aaaatttttt aaaaaaattt tttttgccct ttaatatgat    100800
     attataatat aaaaactttt tttaaaattt ttttagtgat tttattggta cataaaaatg    100860
     cttgagtttt tagtagtata tagcaatgct atatatccta gtatatgctt aaagcttaaa    100920
     gcaatattaa aaagtataaa aaatgcttga gattttagta gtatatagca atgctatata    100980
     tcctagtata tgcttaaagc ttaaagcaat attaaaaagt ataaaaaatg cttgagtttt    101040
     tagtagtata tactatagta ttaaatctaa agcttaaagc aatattaaaa agtataaaaa    101100
     atgcttgagt ttttagtagt atatactata gtattaaatc taaagcttaa agcaatatta    101160
     aaaagtataa aaaatgcttg agtttttagt agtatatact atagtattaa atctaaaact    101220
     taaagcaata ttaaaattta gactcatagt attatatata aaacttaaag caatttaata    101280
     acattttaag ttttaataat atataataac aatatttcaa atcaaaggga tttatatgaa    101340
     agatacagtt ttaagtataa gcggtggttt agactcaagc gctttattgt ttgagtataa    101400
     agatcgtatt aagattgctg taagttttaa atatggttca aatcaccaag acagagaact    101460
     agcagctgct aaaaaagttg tagaagaagt aaataaatta ggtgctgaaa ttgaacacag    101520
     aataattgac ttgacaacag cttttagtac ttttaaaagt gctttattaa gtggctctaa    101580
     agcagtccca gaagctggtt caactgaagt ttcaaatgta attgttccat ttagaaatgg    101640
     tatattttta agtattttag ctggtatagc agaatcagaa ggttgtagat ttattgctat    101700
     agcaaatcac agtggtgatt ctaatgtatt tccggattgc agatacgatt ttattgatgc    101760
     tatgtttaaa gctattggtc taggaaccga agacaaagtt caagtatttg caccatatac    101820
     aaatattaca aaaactgatt taacaatccg tggtatggct aatggtttaa atccagattg    101880
     gacttatagc tgctataaag gtggtaataa accttgtaat gtatgcccta cttgtgttga    101940
     tcgtaataaa gcagtgcaag aagctataac agttttaaaa cattttagtt cttaatttat    102000
     agactattaa gttttaatat attataatat tctaatcgtt aacactaaag tgtaaaacaa    102060
     caacacttta gtgttaaatt tagaacttta gtgtaagtca ctaaaattag aatcaaagga    102120
     gaaatattga aactatttga agcttgtttt aatttaggta attttgaaac ttatgaaaga    102180
     ttctacaata cagaaactaa taagtctgaa attcaaaaag tttttcttaa gaatcaagtt    102240
     tttattgagg atcctaaagg cgaatataca tttttattag atccaaatat caaactaaca    102300
     aaagttcgag ctaaccaagc caaagattta gaaacttatg gtaaaactaa tattgctgct    102360
     gaacatatta gacagaacta ttggaaactc aatgattcaa aatacaataa aaatataagt    102420
     attttttatc tggatataga aactacagca cattcaccta ttgatacaga agcctgcaga    102480
     gaaagaatag tttcaattca agtatatcat aacttaacaa atacaaatta tatttttaca    102540
     aatgagttct ttgatactga agctcatact aaagattcta aatatatttt cgacgatatg    102600
     acttatgatt ttaaacttaa atactatcaa gtagaaggcg agcataattt attaatcgct    102660
     ttgtttaaac ttatagaagc tttaaaacct ttattagtat tagctcacaa tggtgaaggt    102720
     ttcgactttg cttatctttg gagaagaact gaaaaattag gtttaactga aggatttagc    102780
     ccatttggaa aatctgaatt tcaagtaaat gaattagata atggaaccaa aaaatatagt    102840
     ataaaagcgc ctggtgtttt ctatatggat accatagata tctacaagaa gtttagactt    102900
     aagccaagag aatcttattc attagattat atcgcagaag ttgaattagg tgaaagaaaa    102960
     gttaatcacg attgttttaa aacttttgat ggttttagaa caggtgaagg attcattaga    103020
     ccagattcag aacctagcaa agaatctatt ttagaatata aactttataa cgccaaagat    103080
     gatgaagaaa ttaaaagaat ttcaaaagaa tattttattc attatagtat tatagataca    103140
     tacttattat atagaataga taatgtaatt aaattatctg atattatgat tagtattgct    103200
     tctattatgg gtattcaatt accacaaaca cttggaacaa caactccttg gagtacattt    103260
     atccgaaatt atgcaatgca agataaaata gtattaccaa atccaagcga atttagtggt    103320
     gatgtagaat ttaaaggggg ctttgtagct gaaccattaa ttggtagata cgattgggtt    103380
     ttttctgcgg atgttaccag tatgtatcct agccaaatta tggcatttaa tttaagctct    103440
     gaaacattta taccatttta taaattacca aatgatttac aagaagctat aaatgaatta    103500
     gatcttaatg aagatgaaca atatcatatc aataattatt ataaaaatcc agaaacttat    103560
     aaaaaataca cggatttact tataaagtac aattattgtg gatctttaac aggttctgtg    103620
     tacgataaat ctaaaaaagg tattctacca atattaacag aattagtttt taatcttaga    103680
     aaagcagcta aaaaagaaat gttaaaatat gaacaaatgg ctgaggatac taaagatcca    103740
     gaattaatac aaaaatacca agcattagca accgaattag atgtcaatca attgacattt    103800
     aagattttaa ttaactcatt gtatggtgct tgtgggaaca aacattttat tctatataat    103860
     aaagaaattg caaaagctat cactggaaat tcaagatttt atataaatct tatgagtaaa    103920
     aatatcaata attttttgtg tgatttatgt ggttctggaa attatataat ttataatgat    103980
     actgactccg tgtacgttca agtacctaat gttataaacg aaaaattacc aaaagatccg    104040
     caattagcaa cagatataat tgataaattt atagaaacta aaatacaacc tataatcaat    104100
     tcaagctcgc aagaactagg atctattttt aatgctttag atgcttcaag aatttctgca    104160
     aagcgtgaag cgattgcaag ctctgctgtg tttgtagcaa agaaaagata ttttatgaaa    104220
     gttatagatt cggaaggtgt taggttcagt gaaccatatc ttaaaacaat gggtatcgat    104280
     attgtcagat ccagcacacc agcattttct aaaaaatatc ttaaaaaatc cgtcaatatt    104340
     atattagaaa gtacagaaga agaactcaaa gaatggttaa aaaatattag atcattatac    104400
     ctagatcaaa atctaatgga tattgctaag atatcttcgg tcagttctag taaatataaa    104460
     cttggtatag acaaatctat accgattaat tcaagagctt tcttagtatc aaatcattat    104520
     ataaatagtc taaatacggg tgagtttcaa ccattagaat taggtgagaa agttcgtatg    104580
     ctatatctca gagaacccaa cccattaaaa tctaatattt ttgcttttaa taatgaaaaa    104640
     tttgcaaatg tatttaaaga ttatatagat tgggatacta attttaataa gtttttttta    104700
     aaaccacttg aaataatgac agggccactt aattataatt tacataaaga aactgaaact    104760
     ttggaggaat ggtaatggat atactcggta tttataatta tattaaatct tatattttaa    104820
     aaggatacaa ttatattaaa tcttatattt taaaaagctt taattattta aaaagtaatt    104880
     attcttttat tactataatg atattattat ttggtatcat ttggttggtt cataatttat    104940
     tatttgctat aatttttatt gttttctttt taataagttc gtttgtttta tttgcatatc    105000
     ttgattctgc agtagacaac attgatttta aaaaataatg attaatagag ctgttataac    105060
     taggtgtttc aaatataatg gctctatgtt cgatgctttt gaatattttt atagactttg    105120
     ggaattagac cctgatacta aatttgtttc attgtacagt catattaata aagatttttt    105180
     aagcattaaa tacaacatag atccaaaatg ttttgataat tttatatata aagatccgta    105240
     tgatttagaa tttaacaaag ttttattatt cgatacccac gatttctata atataaatca    105300
     cccaaaatcc cttaaattaa ataagttata tgtaattgca aacagcacca tagggttcaa    105360
     agaaaatact gaatattttg atgaatattt tttaaataaa aattatatca ataaaatata    105420
     ttaccagatt cacagaatat ttaatcattt agataatgta tatgttaatt gtatggacaa    105480
     ttgctgcaag agttatttaa atattcttaa aatgtatccg aaagcaatta tcaaagatcc    105540
     taaaaataat tttcaacatt acacaatgac taagaatttt ataccggaca tttacaagta    105600
     ttttaataag tacatatatg ttaaaactgg tagaacttat gatagacacc caagacaatt    105660
     tacagaatgt gcttaccaag gcattgattg tgaatatatt tctgaaggtt ctaaattcac    105720
     aaaaaatgat aattcatatt atagattcga agatagatac gattttgata agagatctat    105780
     atacaacgat atagttatat ctaaaatgct cgattgatgc ttgattaata ccaaaaataa    105840
     ataagttaaa aggtttataa tgagattctt agaatattat agattaaaag aagctgaaga    105900
     atttagtaga aatgacatta aaaccatcgt taaacaatac aataaagtat tcacaagaat    105960
     cttgaatgca aaattctatt tagttaatga agtcgagcac tgcacttcaa atggttcaaa    106020
     attaataggc atcagatttg ctagtactga tggctatatg ataagattta attacactgc    106080
     aaaaaacgct aaacaaattc agaaaattaa caaaactact aaagaatttc acgttgaaag    106140
     tatagatttt tggaatccaa taacggggca cttaaataaa ccaagtatca gagtttctgt    106200
     aatttcaagt ttatctctca aatattttat agaagacatt acaacttcta ttaaaaagaa    106260
     tcttttagga actttttatt ataaagatct taaatttaca gacgatttac aagccgatac    106320
     aagatataag attaatccag atgaaatcat attcattaat actaaaggat ttaaagaatc    106380
     taatgatttt gcattaagtt cacaagatcc taatattcaa cttatactta ataatatcaa    106440
     agaagtttat ggagaagctt gatgaaaaga atcttaacct tatcagatct taggcaatat    106500
     attaaagaag aacttggata tccacaatta caagttgaac tcacagataa tcaattagat    106560
     cactgtattg aaaaaacagt tcaaatgttt tgtaatgttg cctatgatgg agaattaaca    106620
     agatatataa aatttgaatg tcagggccaa ggaaattatt ttgtagatcc tgaagttgaa    106680
     gaaatattac aaatatgcca aagtggtatt tttgtaggtt ctgatttaaa tggattaata    106740
     gatcaaaatc tatctaatta tatactatct acttctggtg ttgctttaag ttacttagtt    106800
     actttaagtt ctacaagatc cttagtcgac aaatactttg gtcaacgtgt taatttcgag    106860
     tttaactctc ataagggact attatcaata tatcaaaatt atcatggccc tttgttaatt    106920
     gaagctaaat gtaaatacat accagatgaa cacgataaaa tatatgatca agaatgggtc    106980
     aaagcaatgt ctgtggctca ggccaggtta atgcaaagtg ttgttttggg aaaatattca    107040
     gcacctttga ttaatggttc tcaagttaat tatagtgata ttagacaatt agcccaagat    107100
     gaaatacaaa gattaaacga ggaactttcc aataaattta cagaacctgc agtctttatt    107160
     gtagggtaat tcattttata tttaaggggc tcttaagata ttttatatta taattatcaa    107220
     aaggagataa tatgagagtt tcaaaatata aaatgttgag ttccttaaaa gactcagaat    107280
     acaacttagt tttaacaaat tacaaatacc cacaatctaa aatagattta gaagaattta    107340
     acgagtttgg agaacgcttc ttaaaagata atgcaattat cgatgttaaa aaactcaaag    107400
     atcctgaatt aaatcttaga tatgattatg ttttaatact tagatcaaaa cttactgata    107460
     ctgctttaga aattataaaa gaagcttatc ctatgctaaa aactattgac gaatataaag    107520
     cttcattaac aggagatttt aatgaattat gataaactaa ataaaattgg aataattttg    107580
     attattattt tatcagttgt ttattttatg cttgatatta ataatacaaa agttaaaaat    107640
     ttagaattta aaattcaaga tcttcaaata gaacttaata aaaccaaaaa ggaactaaat    107700
     gataccaaaa ttaatttaaa tcatttaagt tctaaagttc aagatttaaa aatatctttg    107760
     atgaaagata tgtcgacaat gtatcactta agtgatagac aacaatctct gatacttgat    107820
     gaaatatgga aacaatctaa aaaatacaaa ataaacccag cattcttgta cgcagtatta    107880
     tggaaagaat caagatttag aaacgatgtt attcacaaac ctacttatgt tagaacactt    107940
     aaaaaagaaa tacaggccca aggtatgggt gctatcgttt gggatttctg gggagataaa    108000
     cttaaatcca atacaagttt aaaatctaaa aaagatctta aaaattggaa aaagaatata    108060
     gaaggaactg catatatact tagttatttg aaatctttac caaagatacc taatacaaaa    108120
     aataagtacg aatcagcagc ttcaagatac tacggaaaat atcaagcaaa ttacgtgaat    108180
     aaaacaatgt caaaatttaa tgaactaaac tcttaatgct gaaattaaag tggatttaaa    108240
     caacgatttt gagtgatatg attgtctaat aattaagtat attttaagtg ctagtatatt    108300
     ataatatcgt tagattttaa tagaaaggag aactatgaat gaattaagtt ttataccgaa    108360
     atcagaaatt cttaataaat cacaagaaac ttgtattaaa gaatgtcaag atattgtatt    108420
     tcaagaaaca aaagaagttt ctaaagatct tatattagat acattattag gtatgataga    108480
     ttctgtcaag atttcagatt ctgcagttca tataaaattc aataaatctt taatcataca    108540
     aagtgaaaac attgttttag gtgcagataa tttaaatata caacttgcag gaaaccgagt    108600
     agaattacaa ccaagaatca aacaaaatcc aaaggagatt aaatgatcac aaaagatttc    108660
     attaaagaac tttcaaaaat gtcgagtata actgataaag ttattcttaa gtatccaata    108720
     acaacattaa attctgaagc tatagatatg cttgtaaata tagatgcgtc taaattagga    108780
     tgccaagaat tcccagatac tggtatatat gaattaaata agtttgttca tatgttcgca    108840
     ttatttgata atccagaaat tacaagaaca aacaatgcaa tagaatttga aacaccgggg    108900
     acaaaaagtg tttatacaat ttcagatttg tctgtaatgg aaaactttga tcaaaaagct    108960
     tcaattattg aaagtttaga taattttcca gaagttgcta gagttgacat tagtattgaa    109020
     gtcataaaac aaattaaaca agcttcaagt atttacaacg aattaaatgt tttaagtata    109080
     gaaggtaaat caaatgattt atatttgtat ttagatgcgc ataatagatt taattcttct    109140
     aataatacat ttagcaaaga gtttttaaat cattcaacta tggattttaa actgaaaatc    109200
     aatattgaaa attttgttaa actgccggta acaaattata ctttaaagat taaatataac    109260
     gagagtaaaa acgcatttag aattctcttt gaatctgagt tttctaagat tttgatctca    109320
     aaaattgcag attaaagatt ggcgtgtgtc aaaaattttt aacaccaagg aacaataaat    109380
     ggataattta aaacaacttt cagctacgtg tatgcaaatc tttattaaat taaatggaat    109440
     gcattactta gctaaaggta atcaatttca cagacttcac gaaataacac aagaatatta    109500
     tgaatttttt caagagtcgt ttgatacatt caatgaaaga ttagttcaat tgaatttaac    109560
     accttgtgtt aatatacaag aaatccacga tctgaaaaat ccatatattt tagatctaca    109620
     agctacaaaa cttgatttgg atactatagc tagcacatta ataaatgatt ttaaattagt    109680
     tgacaattca gtagcagttc ttattcaaga agctattaaa attgaagata ctgttacaga    109740
     agacatctta agaacattta gaattcgtct ccaaaaatat atttggatgc tcgaatctat    109800
     gcaaagttaa ggaggtataa tgttaaaaga agataaattt gtttgggaat tatttcagaa    109860
     aaaatttcca gaagtttcaa gagaagctta cgaagatttt gtagaagaat acttaagcat    109920
     caaaccattt aaagctagtg aaaatatatt tgaaaccaat caaagtattt caaacgaagc    109980
     tcattttatt atgagaacgt tagctactaa aaaattacaa gaagtttttg aaatacttaa    110040
     aattgattta gaagacccaa atgttaaagc agatttcgaa aatggtaatt taggaacacc    110100
     aggcagagtc attaagctaa tgtctggtgc tggcactgat gatgatactg agtgcggctc    110160
     tggtagattt atgaaacctg ttagaatagc aacttttcca aataaagacg cagctaagat    110220
     cccaattact aaaaggatta acatatcaag caattgtagc caccatttat taccatttaa    110280
     tacagatttt gcggaagatt cctatgcaat agttagttat atacctaaag attatgttct    110340
     gggtatttct aagttacaaa gattagcaga tttcgtctct agacgttatt ggctacaaga    110400
     agacttaact aaagaaatct ataataaaat taaagaagcg gcacaaactg aagatgttta    110460
     tgtcaagtta tacaatatta aacatacttg tgaatggatt agaggtgcaa gaaacactga    110520
     ggggggattt acttcagaat tctacggggg tgcttttggt gatcctgaat taagaaaaca    110580
     ggttcaaatc cgagtttaat gttaatacac tatagatctt agcatttaac actttagtgt    110640
     aatttgctag atctttagta aaaaatttaa ttaaatttta atcgttcttt atatataata    110700
     tcatattaaa aatttaaatt taaattttaa aagtctaaat caaaggagtt taatttggat    110760
     aattttgaat ctgttcttct aaaaaatatc atagaatcta aagatttttt taatagagta    110820
     agaccaatct taaaacctag tattttcaca gactttggta accaaaaaat ctatgaatta    110880
     atagataatt tttattctaa ttataatacg actcctagta tacaagaaat agctcttcaa    110940
     atcaaggata ttcctaataa agaagcgaga acccagattg ctactaaact taatgatgct    111000
     agaaactcag aaaatatcaa taaagaattc ttagatgatt taactgttaa attcattaag    111060
     gatcaaatgt ttacaaaagc attaatgtta ggtgctgagt tcatcgacaa aaaagatgaa    111120
     acttataaac aaaaagccaa agatcttata gatgcttcac aacttgtgaa tattcataaa    111180
     gatcttggta atgaatataa taatatagaa gaacgtattg attattatca aaatccaaaa    111240
     aaaggtatca aatacttaag attcaatact ttaaatgagt atattggtga aggctttctt    111300
     aacggaactt tgaatatttt tatggctcct gcaggtattg gtaaaagttt attaatgagt    111360
     accagcattg gtgattttct taaacaaggt ttaaatgtat tattagtcag cttagaatta    111420
     tctaattttg agttcttaaa aagaatagat gctgacttat tagatataca aattaatgct    111480
     ttaaaagacg tagaccctag tgttattaga actaagtttg gagaactaaa aagatctggt    111540
     attggtagct tatatgttca aaacttccca gctggttctt ttagttcaaa tgatttaaaa    111600
     tctttattag aaatgtataa agctaataat ataaaatttg atgcaatatt cttagattat    111660
     ttaggcttaa tgaaatccga tagagtttct gcaagtgcag gtttatatag ttatattaag    111720
     gctattggcg aagaagttcg tgctgttgca gtcactgaga atctcccgat tttttcttgt    111780
     tctcaattaa acagatcagc tgtaaataat acagattcta acaacgaagc tatttcagat    111840
     tctatgggta ctgctatgac tgcagactgg atttgttttt tgttacaaac tgaagatctt    111900
     aaaaagaaaa atactattag atttaaaata actaagaatc gttataatgg tagaacttca    111960
     agttttgata tgcatattaa ttatatgaat atgagaatcg aggacttagc tacacctacg    112020
     atgcaaattc aagctccagt agaagttcca aaattatcag ataaaccaaa aaccgattgg    112080
     aactttaatt agttgctcaa atattgacac tacagtgtaa aatgttttaa atttaattaa    112140
     actttaagtt tatatattat ataattatat tgtttaagag atttaaagtt ttacacttca    112200
     gtgttagttc ctggctctta agtgaagttt aaaagttttt ttaaatggtt agattctaac    112260
     caggattttc aagctacaat gtaaaagttg cagtttgaat cctttttaaa ttaattaaac    112320
     tttaagttta aatattatat aattataaat atatttaaat acatttcggg atgtagctca    112380
     gctggataga gcgacagcct tctaagccgt aggtcaaagg ttcgagtcct ttcatcccga    112440
     ccattctaac attagtaagc attcgggtaa ttggtaaccc accagactgt aaatctggcg    112500
     tctcttggca ctgcaggttc gagtcctgct gcttacacca ttattaaaat ttatattata    112560
     aacataatta agatttattt gtaattttta cttatgttta ttaaattgtg atgttatatg    112620
     tttacgtaac caataaatat atttaaatat attttgaagg attaagatga catttaaaga    112680
     ttatttaaac aacattacta taaatgaagc gttgaagacg gatgcgtctg ctatagagga    112740
     actcagaaat agatatcaag aagtagccaa aaagaaagat gaattacaag ccgaaataag    112800
     taaactagaa gctacgcaga ctacagctta ctttaaacta ggtggcttag ctgcacagat    112860
     tgcacccgat aacgttgaca atgaaaaact caacaaaggt ttagaacaat acgacagtga    112920
     aattgcgaat attgagaaaa agttagaacc tctttataaa aaacgcgaat ctttactaga    112980
     cgagcttaaa aaaataagca gagttgctaa taacttagta acaagaaatg ctaaaaaagc    113040
     gggtgtaagc cctttgaatt atgtttttaa acataattta tcattttaat aaagttgaag    113100
     gtacattgtg tagagtttaa ttctatacaa tgaccaaacc ttataagtag acataaacct    113160
     tataagacgg tatagcttta tatgactcgt atatttttac taataaactt aattattccc    113220
     atttaatttt atcaacagat ttaacagttt cagctgaatt aattttttct tttaatgtat    113280
     tcgctttaaa tattacttcc tgggtatatt cggttacttt tgaaacaaat gttaaaaatt    113340
     cttgaggtgt aaaattaacc ttttcatcat tcaagtcaat ccaagtaatc tcagttattg    113400
     aattagtacc gctttgtata tctaacaaga tattagcggc catcccgtta atattaagtt    113460
     tatctttttc cctagtttgg aatgtgtggc ctttgaatat aaaacctgat tctaaagcta    113520
     cgtccctttt tgtttgtatt tcaaacttct tcttttcttt aattatatta agtttttcgt    113580
     attcacttgt agtatttagc acatattcat aatataaatc cataagatta ttagctaagc    113640
     agtattcttt tactgcttgt gttcctgctt gaatttcttc aggtgttata tcatttgtaa    113700
     gattgccatc ttcatcaaat aataactctc tatctacttt acatatttgc catttatttt    113760
     ctatatgaaa agatattaca tctataccta aattattaac tttagctaat acattttctt    113820
     tactcaaaaa catttaaact ccttatccaa aaataatacc tgattcagat acaacattag    113880
     gtgtttgaga attcttagaa gctccacctg taacagtaac ccctgaattt gaaataagtc    113940
     caccattaac tacattaaaa gcaaccccac taggttgaat tacttcagta ggattcctat    114000
     aacttaaaac ccctacacct gagctagtaa aacagtgttt attaatatca ggtgttaaaa    114060
     attgaaactt acccataaaa ataactgctg cacctgttcc tgcttgtata cctgaaatag    114120
     gagcacctgc actaacatta gacttagaac aagataattt acaagtatat gaagtatctg    114180
     caaaacctat ttgttcacaa gtagaattta aaaagtaaaa gcaagtagag taactttcta    114240
     cataaggctt aagtattttg ccaatcttag aactccatat gtaaaaacca attgtttcag    114300
     aagttatttt taccttaaat ccattaaaat caatatttac aaaaggtata tttagttttc    114360
     taatatatat aggattatta gcttcaatat tagatattaa ttttaatgta agtatataat    114420
     ctttattatt tataaattta gcagcttcgt ttatagcagt ttgtaaatta gtgaatttac    114480
     ctcctacccc aacagtccat tccaagtttt gtgttaataa tgtagggtat ctattatcag    114540
     cttgtgccaa cacatcttgc aatttagtat taatttcaga tttattataa acattatttg    114600
     tgttggcttt agtgcctaat ttagaatcta cttcggactt attataataa ttagataaat    114660
     ctacgcttag aactgcattt ttccattttc tagtgtttga gtcatactgc aaaatatgat    114720
     tatttgctgg gccaacaata cttgtatcaa ttaagttaac aatactcgtt ttatgtggat    114780
     tattaaagtc tgtcttatgt gtattaatta aatctgcatt aaaattcttc ttggcataag    114840
     ctaagttaat agcgtgccaa tcacttgttg ggtctgcaac attaaatact tgtgtttcag    114900
     aaccacccag atttgctttt gcatttaagg tattattaat actaagaatg ttattttcta    114960
     tatttttttt aaattgagtg tattcaccat acctagtatc ttctaattct ctattgtcag    115020
     taatggtatt ttcagcagtt gttactcttt tttctaattt ataatgttta tcttctatat    115080
     ctttttcatt agtacctact gtagtttcta atttggtaag cctagaatca ttagcttctt    115140
     tataagtttc aaaaattatt tttcgaagga aattatcttc tatatattta gaactatata    115200
     ataaatctct tgaagcttca tctggatttt cagttgtatg tctaaaaatt gcttgaagat    115260
     ctattaattc gtctgacgca cccatagtct ctttagtttc agaatccata caaatccaat    115320
     atttaccatt aactatatca tgaatattgg caatataact aatactagga tttgattctt    115380
     tacttatttt gttaagttct gttaaaacct tttcttttaa ttgttctttt gtaagatttt    115440
     ctgatattaa aacatcaact tttttaaatt gcatttttca cctttaagct aaagatttta    115500
     taagtctatc tattctttta tcctgaacga tattattact agtattattt atgatcttac    115560
     catcagagtt tattagaata actctacttt gatctacgtc tgttactcta acgtatactg    115620
     gtttaccatc atttttagca actaatccct gcatttcagt aacagcttct tctgtaattt    115680
     gacttaatgt tttagttgtt tcatacacga aatctattat ttttatttta gatgcttcta    115740
     atgccattta attttccttg tatatttttt accatttaga tactaaattt tcaaaagtat    115800
     cctgaactgc attctgtgct acacttaatc cattttttaa catattacta aaatatgaac    115860
     ttgctttaga ttgtacacta tcattgccgg tcgtattaga agtgccagct aattgaatgt    115920
     ttttaatatc tgtgttatcg tgatttggtt gattcatttt aaaactaaca ttgaattcta    115980
     taatttcatt attgtcttga gataattgta tttgtgaaac atctgtcaac aatgcatcct    116040
     gcgtctccat tactaagatg tttttagaac cattgcttaa ataaacctga attagccaag    116100
     cgcagacatc attgtagtta ccttttgaaa tttgaaaagc attgacaaat ctgcgataca    116160
     tactggcatt atcaaaatct ctgaaggtca tatccacttg gtatactggg tctgcaccac    116220
     gtgctaaaac ccaagtccca ccaattaata actcttcaaa tctaccggta tattgtggta    116280
     aattaatact ttttaaacaa atatctatac tattttgagt ttcggtagga tcaccccagt    116340
     ttataagatt ttggaaagta gtattaatag gtttcataat aactataaaa tcagaggttt    116400
     tactccattt gatagtatta ataacactag caagtttatt taaggtaaca gttgccattt    116460
     atcctacttt tttgtatatt tatttgtaca ttcaatataa tttaagctca aatatgttat    116520
     aatctaaata attaaaaagg aatataaatg cgattcaaag attatattaa aggattaaaa    116580
     gattttaaaa atcttgacaa tatcgagata aattccaatg acaattttaa tgaatcttcg    116640
     ctatccagat tatacaaaca ttatcgagaa cacgattcgg ggacaattag cgggtatcgt    116700
     ggtgaaaata ctaaagaaga aaaccaagaa aataataaaa aattaaaaaa cttcttatta    116760
     gctaatggtt attctgtaac gcaaatccaa gggacatatg aagaaactga ttcggaaggg    116820
     aataaaaagg ttgttaaaga aatgtctttt attgttatag atattaacga tacgggaaag    116880
     cttaaaaaag tcttaacaac agctggaaaa agatttaaac aagaagctat aacattttct    116940
     gaaaaaggtg gtgattattt cttaataaac tgttacgatg agaaagaaag taagctagga    117000
     agtccaatgt ttggaaaaga cggtaaaata atttcaaaaa ttagtggtag accttttatt    117060
     ttcacagaat gtgaagacat agataatcat acttataatg atactttaga tgcttataat    117120
     cctttggttc taagatatta tattaaaaat aattttagtg atttagattt aatataattt    117180
     aagcttagat atattataat taaaccaatc aaaacgagaa ttaaaatgac aataaaagaa    117240
     aacactttta aagaatactt atgcgaacaa gcttttagca gagatgtaat gatctctaaa    117300
     tttactaaca attcggacaa tatttttaat catattttaa aagtcttagt atacgatgat    117360
     cctttaaata ataaaaaaca cctaagagag atgtcaggaa tagtaagatt tttacaaaac    117420
     aaaactatta aatcaaaaat aacacctgaa gacttgtatc atattttcta tggaaatatt    117480
     gaagaagatt cgaatctgaa acaatatatc ttggatttag agattaatta cggttctctt    117540
     caaaaatcta agctatcaga aaatgagata catttcagac tagctagaat ctttaaaaga    117600
     ttatcaagtg agacattaac aaaatcattt aaatcttttg aagattacat agaactaagg    117660
     gatagatttt aaaacaatag gctttgatat aatttatacc cgattatatc aaagctttaa    117720
     atatgcaaat gattgaatca taaatattta accaacaatt aaaggatata atttgaattt    117780
     agacactata catattgtta aaaataacgg agaacgtgaa atattcgatg ctgaaaaaat    117840
     acataaacac ctacattttg cttgtcaaaa cctcgatgta gatattatta gcattattaa    117900
     agatgctaga ttaaaaatat tcgatggtgc aaaaagtgta gacatacaag attctttaat    117960
     taaatctgca caagaaaaaa tcagtgaaga ttctccagat tatgagttag ttgctggtag    118020
     attattaaat caaaaactca gaaaagaagt ttataaacaa tatacaccat tagattttaa    118080
     atcacaagtt aaagaacgta ttaaaaaagg tttctatact gaagatctta atgcttatag    118140
     tgatgaagag cttgactatt ttggatcttt aattaattat gaattagata acgaactacc    118200
     ttacagcgca ttaaatcaaa tgtattctaa gtacttgatc aaacataata aaaaatgcat    118260
     tgaggttcca caagaagttt ttatattgat accaatggct attttttata atactgatat    118320
     agaatataga aaaaaatatg ttaaacttgg gtatgaatta ttatcacagc gtaagatttc    118380
     tttgcctact ccagttatga atggtgccag aacaagttat aagaaattta tatcttgtaa    118440
     tttattaaac tttggtgatt cggttgagag ctttgctaga ggattagaag caattttaaa    118500
     atgcactagc gctaaaagtg gtttaggtat caatacaagt tttattaggg gtctaggtgc    118560
     tccagtaggt aaaccttcaa ggttagatca taccggtatg ttgccgatcg ttaaagccat    118620
     tgaatctgct acgtctgcgc tgattcagca cggaaggggt ggtgcaagca atctgtcaat    118680
     gcctttcttt cactacgaaa tagaattatt ttcacaacta ggtgattcta aaggatcttt    118740
     agaaaatagg gctagacata ctgatcaaac tattatcatc aataaatggt tcttagaaaa    118800
     agctcttaat aaagaggata tatttttatt ccatatgaat gctgtaggta ataaggatcc    118860
     caaattagat ttatatgatg ccttaggtga ttataaaaga ttcgatgaat tatataaaca    118920
     ttatagcgct aaagttccta ataaaagtaa aaagaaaatt aatgcttatg atttattatc    118980
     tttaattata aatgagagaa tgattactgg tagagtttat attgtttttg cggataactt    119040
     cgttaattca agttttaaag aaaatctata tatgacaaat ctttgttgtt tagcaggtga    119100
     tacaattgtt gaaacttcac aagggcctaa atttctcaaa gatattaaaa aaggagatct    119160
     tgttttaagt tataatcaag atacaaaaaa atatgaatac aaagaagtac tagcagctgt    119220
     tttaacaaat ccagaagctg aagtttttga agtagaattc aatggtaaag tggtcatttg    119280
     cactggtgat cataaattct taacccaaag gggttatatt gaagctcaac atcttttaga    119340
     aagtgataca atagtagaat gttcctcccg tatttagaag aaataacata tttagataaa    119400
     ccgaataaac ataatcttaa tttctttaga aaaacatatt taatggattt ctttgaatta    119460
     ggattagtat tcgacgaaaa tgaagattta attggtatta aaaatgagga tactacatca    119520
     ggctatttac cattacattt caatagtata ttagaactct cagagttttt atatgctttt    119580
     aatggcgcgt gggtagcaaa gaaagtattg gatgcttgcc agaaaatgga tatggtgatt    119640
     aagcaaatgt ctgaagaact cggtatacca gaagaggtta ttagaaatgg caagttttaa    119700
     agaatattat tacagtgaaa gtattttatc tcataaagtg attacaatat tgttaataaa    119760
     gatataattg atatattatc cagttgtata gcaagtttca aagaaagagc tattttaaga    119820
     atggctacat ttagacacaa taacttgtta tattatgtta taattgaaag gagaaggggt    119880
     gtcaaaggtg accatacttg tgtagaacca cattttggtg cttttgtaac tgatatagaa    119940
     aatatcttaa aaatttctga tactaagcaa ttgttgttac aactcaaaca cagaaaggat    120000
     attttaaaga ttttaaaccc agataaaata gaaacaaatt ctcaattagt tttatcctat    120060
     gtattaagtg ttctaagaga ttatattaaa gaatattata cattgtttat taagcttgtg    120120
     actaatgaag aattaatgaa aaaatatata aaattattac cttatgtttg tactgattta    120180
     aagtatactc ctatagatat ttcaaatgaa attagaacgg attttgatgg aactaggaag    120240
     ctttttctta ctttaatact tagaaaatca aaagatttag acaaacaaga tgtactaaaa    120300
     tcacttagta atatcaattt aagtaattat atattataat aacaataaaa gaggtgctat    120360
     gataaaaata actaaaaaaa ctgaaaaaat acctgtatac gatatagaag ttaaggataa    120420
     tcataacttt tttgcaaatg gattgtgtgt tcacaattgt gaaatatctg tacctagtca    120480
     tagtttagat aattataggg gtataccagg agaactcgga acttgtatct taggtaatat    120540
     aaattttgga cattctaaag aatctgacat tccaaaagtt gctgatttct tagttagatt    120600
     cttagataat atgattgata tttctgattt tgctatgcca gaaattgaat actcggctac    120660
     aaaacgcaga acattaggta ttggtgtttc taacttattt gggtatcttg ctaaagcaaa    120720
     attattctac aatacaaaag aagctcgcga acatatcagt gatctaatgg aactatttta    120780
     ttttaacttg gttaaaactt caatagattt agcaaaagaa cgcggtgctt gtgaattata    120840
     taatgaatct ttttatagtg ataataagtt tatatttgaa agatatttgg aagccggtat    120900
     taaacctgaa tttaaaacaa aattagattg ggagtcactt cgtgaagaat tatctaaata    120960
     cggtatgcgg cattcaagct tgtcagctgt accgcccgct gggaattgca tttctgaaga    121020
     tcatacaata gagacttacg aaggtaattt taatcttaaa gatatttgta atagagaatc    121080
     aatagattac actgatttaa aacctggttg gtatgatctt aaatcaccat taaaagttcc    121140
     tacatttgaa ggagattcga tatctaatag attttattat aacggtgaag ttgaggtaat    121200
     tgaaatagaa acagattctg atgttattga agtgacagct aatcacgaat tattagtaga    121260
     aaggaatggt aataatatat gggtagcagc ttcattgtta gaaccgggtg atacgataat    121320
     tgataagttt atagaacaca aaatcgttaa aaacattaaa atcggtaaaa aaattaagac    121380
     ttgggattta gaagttgaaa aataccataa ttattttctt aatgatggaa ttatttcaca    121440
     caatagctca aagccaagct cagcgacacc tggtatcgaa ccaccaagag aattagtaac    121500
     tattaaaaca gaaaaaagtt ctactgtaaa acagttggtt cctttctata aaacagccaa    121560
     aaaatattat acgactgctt ggggtgttga ctttaataat aaagattatc ttaaattagt    121620
     aagtataata caaagatatg tagatcaaag cattagtaca aatcaatatt ataatatcgt    121680
     agaaactaaa aaagttaata ttgaagacgt tatagaagaa tttatagaat gttttaattt    121740
     aggtgtcaaa tcattgtatt atgctaattt tagaactaca gatgatgcag atggagatca    121800
     agtaatcgaa ggttgtggat ctgggggttg cagtgtttaa aaacttttag gtttaagctt    121860
     aaaaatatta gaagcttaaa cactaaaatc agcttgtatt tcagaaacct ttaagttatt    121920
     ttatattata attatttcat taaaggagat aaaatgaaac atattacaaa aatattttta    121980
     ggatataaaa acaacaaagt atatttcgat agaacacaaa gacaaattac aaatgctatc    122040
     aaaaatcttg aacgtttaaa accttcattc aatattaata aagctagatt tgaagaaatc    122100
     tacgaagcta aacaaattga accaaatcca aatatacttt atatcgctgt cacagataaa    122160
     caatatgtaa ttgttgtcaa tggtgattat cgtggtaata tcacattaga ttataaaaat    122220
     attgattttg atgtagaaag aagtctacaa atatcaagac ttaaaagatt gtttagagct    122280
     ggtgttagaa tatggaaatg taatacttac ttgtataata gaaaacgcaa atctataggt    122340
     ttaaaaccta gtcttgaaga tcgtttagca gaatataaaa aatctaaaat caatgatttt    122400
     aacaaatatt gcttaaataa attaaaaagt gttggtaatt taaagctaga tgtaaacaat    122460
     attgaagatt tagattttaa taatttagaa aaacaaattg attttataaa agagttgttg    122520
     tattatacta aaaaatatat tgcgaatgaa aaatataaat tttgtgatga accttatttt    122580
     gaatacgcaa aaagaaaaac tatgaatgct attataaatt taaagattta aaatacggca    122640
     taatcacaca aaaacaggga ttaaacgatg atattagata ctaaagcaga tatattagta    122700
     actcatagtt ttcactttaa taatactaaa atgcacggat tatccggaca tttatttgaa    122760
     gtattagatt attactggta ttttaaaaat aaaggtgtta atgttaaatg tttaattccg    122820
     gaagtagtaa ctaaagaaac tttcaatgat ttcataaaag gacactatag tgtagatttt    122880
     gatttaaatg atatgtattt tttagatact aagatattag taattaaagc tagaaatata    122940
     ttagtaaccg atggtggtta ttggttttta aatcaatata agtctaaatt actaggcaaa    123000
     gtgttttcgt ttgcttgtgg tcctagtttt ttagaatccg gagataagcc agaatatgtg    123060
     acttttttag cagatcataa aatatatcct ggtttgggaa taaattatac taagaaggtg    123120
     ttaccccatt taaatcatat accaggagat aaaccttttg cacatattac taaaaattgt    123180
     agggcattgt cagaatctca aataaaagat ctaacaagag attatcctga tattgtaatg    123240
     tatagtgatt atttgaatat acagaattca acaaataaac ctatcaagaa ttttaatttt    123300
     agtaagtatg tatatacacc tattatgaga cattttgatt gttcacctag acttataata    123360
     gaatgtagaa tcttaggtat agattttgat ttatggaata ttaattataa agatcctggt    123420
     ttagaaagac gcttagaaac agatctgggt caatttatat tggatgagtc cgataatata    123480
     ataaattatt ttgattaaaa tattaaactt attttaagag tattattata aaatatcagt    123540
     aaaggattaa gatgatttta tataatttaa ctttagtagt atggtctctt gtctttattt    123600
     tattttatgg ttggtttgta tggaaaattt atgataaaaa tgataaatta gtttcattta    123660
     tttcaatgat tttattaaca cttattttaa tcttgtggtt tacgcacgtt atttttactt    123720
     ggaattattt tgaattaatg ttaagaatat tacatcaata aaggagatat ttaatgtcag    123780
     ttgaaataat taatgatgat tgtttaaaca tattggaaaa tataagaaat gttgatttaa    123840
     ttataacaga cccaccatac ttcgtaattc ctaaaggtaa aaaaacaaat aatggatatg    123900
     ataattttaa atgggatagt tttgacaata tggatcattt tttaaaattt acaaaagaat    123960
     ggtttgattt atgttataaa aaattaaata atgattcatt tatgtatata ttttggagtc    124020
     aaaagtattt ttcatatggt tttgaaattt ttaatccaaa tcgtgttttg ttatggcact    124080
     atagaaattt agtactcggt ggtaatggag attttgcata tgattacgaa cctatttttg    124140
     ttataaagaa aggtaatcct aaattaataa aaggcaaaca tagttcgatt ttaaatttta    124200
     caaaacctca gagtaatttt aaggccgaca aactcgttca cccaacacaa aaaccattaa    124260
     aattaataga atacttgata tcaatatcaa atcttaaaga aaatgctgtg attttggatc    124320
     cgtttggtgg tgcagggaca acagcgttag catcaaataa tttaaaatat gattgcatta    124380
     ctatagaaaa agagactggg tattgtaact taataaacaa tagattgtta ataaagtaaa    124440
     tattctaaaa agagacttaa tatggctttt ataaatgata aaaaaaaagt tcataaaggt    124500
     tcaaaaatga ataaaataga cttcagtggt tcggaatgtt catatgaaaa actactaaat    124560
     ggaacattag agtttgaagg tattcgagct gcgataatga caaccgataa atgttgtttt    124620
     agttgtgaat attgttgtaa ttcaggtttt acagatttta atgctgctaa aaatactaaa    124680
     agcgaagcag atttaaaatg ttttaatttg gttaaagcta tatttcctag attaaaatcc    124740
     gcagttttat gtggtggtga accactaatg tgtgattatc tttataatta tttagactta    124800
     tttaaggatc taaaagacgt aacaatttta acaaatctat tatatataaa agatcattat    124860
     aaacgtctaa aagaatatag aaacctagat ttagttacaa cttatcacgc ttctcaaatt    124920
     aattctaatc aatatattga aagacttaaa tatttcttag acatagattt accaaaagaa    124980
     gttaaattat tttttaacca taaaaaacca gatttaatag aaagaacaca aaatgttaaa    125040
     gatttcttag aatctcaagg atttactaat attatttgta ctcatatttc agggtttggt    125100
     tttagtaatc caaataaaaa tgtagcaggc gttgacctta atgcagacag agactacgta    125160
     atgatttctc aaggaactaa gaaatatatg aatgaatctg agtttgcgag tcaaaattat    125220
     ctcggtatgg tctgcaatgg tttgagactt cacgtttacc cagatagaat cattgaaaat    125280
     tgttcaagaa aaactttgac tgtagaagaa gttctaaagt taaaagatta tcaagtttgt    125340
     aaattcaaaa gttgtaatgt tggtatgtgt ttgaattatt ttagtaaata caatgttaaa    125400
     tacttaaaga atatttaaaa tatataaata atacaagaaa ttaataaagg tttataatga    125460
     aatttagtga atatttaata aatgaatcca taaacgaagg ttctaaagct ttctctttgc    125520
     attcttgggt aagtgtagaa aacgctatga aaaacataca agctgatggt gaatttgata    125580
     aaagtgaact gacccacgtt gaaaaatctt gtaaagatat ttggtctatt gtaaaagcct    125640
     tgtgtgaaat agacaatcaa cttggtatta tccttcatac acttagcact atgaaagatg    125700
     acaaatatct cgattctttt gcatcaggta cagattttga cattaaagat gtaaaaaaag    125760
     atatcattaa aatagatgat gctgtaataa aattaagtga agataaaatt aaagatattg    125820
     ctaaaagaat gcatatcgta aaataaactt gttttaaata ggcttaaaca ggcttaaaca    125880
     ggcttaaaca ggcttaaata actgatattt aagcttattt taaagttatt attatataat    125940
     attagaaata aaaggagata aaatgattaa aaacacaaaa atacaagaaa taaaagattt    126000
     taacaatgat ttaatatcta aaatgttaaa agcttgccca gattttaact taaaagtaaa    126060
     ctatagaact caattcataa tttttaaaga caactccata agagaaagtg cttattatcc    126120
     tactaaaata gatgcttatg aatatggagt gattgacgta gatgaagatg ctttagatgg    126180
     tatctcaata tctcataata aaatagaatt ttttagaaat gatagacgta atggtttatc    126240
     aatagaactt attgaggata atgaaactag aatcaaaatt agatttgatt tacaagatcg    126300
     taatattttt gatgaaactt tttacgcctg ggattgtttt ggaaaaagag ctttcacttt    126360
     tagaaatgat ttaaatcgtt ttaatgatag ttttactact aagattaaac ttaagaattt    126420
     tttaacaaaa aactttgatt tatttaaaga ttttattaaa agttctaatg aatatttaga    126480
     tcttattaat aaaagtttat aattatagtc aaaggagcta aaatggaaat aattaaatct    126540
     gtatcctcag gattttttaa atatactata ataatatttt tactaggatt tttttctggt    126600
     atatccttta cattttttat gactaaatgg tatttcgaag atagtggatc aactataggt    126660
     tatgaaattc aaagagctaa tatgataaaa aattgtataa aagaagttga tattgcctta    126720
     gaaataatga aagaagaaaa ctcagtcata gatgcaacac aacctttaaa ctaaatatag    126780
     gatttaaaat gattatagaa ataaaagatt ttccattaaa tgttaagaga gtagttttag    126840
     aatttgatga ttcgggtgct tgtgtagtag aaccagaaac aaaagttaaa aataaaccta    126900
     gaaatgataa aattgttaaa gaacccgaac ctgaaattca aaacgaatca gaaccggctt    126960
     tagatattaa ttttggttct aaaccagcaa aagcgtcaag tatagaacct attgataagg    127020
     tcgtaatccc ggatatagaa agagaagcta acgtttcagc tacaatgcaa aacttgaagt    127080
     tataatacaa ttttgacact atagtgttag atttgcacta tagtgcaaaa ttaataccgt    127140
     atagcactat agtgcaaaat ttaaaaatta agcttcggta attgtaaact tatataacat    127200
     cggagtagtc ttagaatgta aagggtgtat tgtatatgca tttcttgtaa atatacctac    127260
     agttctttca ccagattggt aattataagc agttgttaag ttcatacaat atgggctata    127320
     aatcagcgaa ttaacaccct tttctttatg agattttaaa cctacataag cattattatc    127380
     atcaggattt ggatttaaat aatatcttgt attattaatc ttacctaaga aataatcatt    127440
     cgctctattt tcatctgttg agtcatctat tcttgaataa gtaaaactta atgataatat    127500
     accgcctaca ccagtttgtg gaaggataca aaaactatcg tatgttctaa aattaggcga    127560
     attcatttta atgactaaat catttacttt tttagatata tgaaataagt ttgtttcagc    127620
     attttgtttt gaatcgttag catcatctaa cacaatacct actgattcaa ctgcattttc    127680
     tttaataaga tttataattt tttcagtttc tttgtgtgct gcagaagact taacccagtt    127740
     aatgaataat tctggtgttt gttcatttcc ggctttatta agattgctta aatttaataa    127800
     atcttcccaa gcttcctgtg atattttgat aatagattta ttagtgtcta catcaatttg    127860
     ctttttaata attttaaatg tatcttgagt ttcttgtctt gcaaaaacat atccagatgg    127920
     ttgcatcata ggttgaactt cagcaatatg atgccctata aatgatttga ttttatcttt    127980
     taagatatca cctaacataa cttggtaaaa atctgcatct ataccttcgt taattaagtt    128040
     tgtagactct ttaagagaat tttctaataa tagtttatac attttgacct ctatgtattt    128100
     ttaagttatc aactaaacaa tttaatagtt tttcttgctt cattgtcctt ctctatttct    128160
     agagttgttt aagaactcca caagctttaa ttttttaaag tggttccggc tgtcgcatcc    128220
     gtagtcacta tattctttaa tccaagattt aatatattta tactagcatt taaatctcta    128280
     tcaatcgtaa aaccacattc attacaatgg tatgttcttt cagataaact taaagtttct    128340
     ttaatacatc cacaattaga acaggtttta ctactaggat aataagtgtc aatcttaatc    128400
     aaacagcctt ggttttcggc tactttataa cttaattttt ctataaaaga actccagcta    128460
     acatcagata ttgctttagc tagttttctg ttcttaacca tattcttgac ttttaaagtc    128520
     tcaagacata tagtcctata ctgattgact aactctcttg aaactttatg ttggtagtca    128580
     tttctttgat ttttaacttt tttatgaagc tttgaaactt ttaatctttg tttttctcta    128640
     ttattagaac ctttttgttt tctacttaga cttctttgag aaatctttaa ttttcttagt    128700
     gatttttcaa gaaatctttt attttcgtaa gttacatcat cactacaaat acaaaaatct    128760
     ttaataccta gatcaatacc aacagctcca tttgtttctt tactttctat attacaatga    128820
     aaggtgaaag agataaaata cttattattt tctctactta tagtaaatcc agtaacttta    128880
     ttaaaattat attttatttt atgtctttta aatcttatct ttaaatcatc ttttgtatag    128940
     ctagaacccc ttggttttat tagaattata taatcaccat ctatttttat tctacaacca    129000
     gcatacatat taaagctttg tatattattc tttttggatt taaacttagg ataattcatt    129060
     gttctataga aattattaaa acccctgctc aaatttttca ttactgcttg agcataatcg    129120
     tttggaagta aagataaaaa gctgtgttct tcttttaatt taggtataga attgttcaaa    129180
     tcaaactcag ttggaattct tggaactata ttacctttgt ttttaccatt ttgaatttca    129240
     taagttccaa attttgaatt cttaatatta tagagtgaga ggttatagat agccctagac    129300
     aatccaaaga aagattcaat catctctttt tgtttagaat ttggtttcaa tacaaattta    129360
     acacttctaa cagtgctata aatattttta gttttagaca tattatacct atgtttaaaa    129420
     ttagagattt aaagaaattg gtagtttctt tatttcttgt tttattatat ttaaatttca    129480
     aaactttcaa tttttgaaaa ttctaaaata atttctatat ttatttagtt taatatactt    129540
     ttaagtccag aatatataat atttgatata aattatatag tttttctcaa tttcttaagg    129600
     ttgtcttagt aacacctata attctagaaa attctccaat aatatacatt taaattcttt    129660
     ttaagaaaac ttataatata attatagata tttatatatt cttataatat ttcatatatt    129720
     atattttttt aagttatttt atattataat tatttcatta aaagataaag gagataaaat    129780
     gaaaaacttt aaatcaaaat taggtgataa tagatttaca tttgacttag tttacgcagt    129840
     tgtggctgta gtaatgatga tagcataccc agcttatttt atttggggtt aaaatgaact    129900
     tcgtaaccaa agattatatg ttaactgcag aaatagcaga taaattaaat ataagtatga    129960
     ctaatatttc aaaatggtat acagaattta cagagtctgt tgctaataaa catttagtaa    130020
     gaatatgtaa ttgtgtgttt gttcacagag actttcctaa tttaactaag aatatgaaaa    130080
     ttatttttga tgaacccaga atagattgga gtaataaatt accattgaat tatatgatta    130140
     aaaattttaa aattaatgtt gcttattgtg aaaaatataa tataggatat aaaataagtt    130200
     atgattttaa aacacacaga aatcgtgtaa ttcaaaaaga cttttttgag tttaacccta    130260
     gtattttaaa attattaaaa gatactgaat tagaatcaag taaggttgct agtttaaatt    130320
     caattcaagt ttcaaagaat tacttcattt gtttttgatt atttaaagga gtaaaaatgg    130380
     attcaaaaag ctttattaaa aaacaagttc taaaaatctt aaaagtaact aatatagaag    130440
     aagaaattct tcataaaatg ttcgtagatg aaggtgttga tgccgatttc ttgatacaag    130500
     ttctgaaaga tctgcacaaa gaatctaaaa ttaaagttct aattaaatct gatagttgtt    130560
     tgtttgaatg ggattctcat aagccttata ttaaaggcgt ttattatata actagtaaaa    130620
     tgtaaacaaa ggttctaaat gacaagatat agtttttcga aaatagatac atataaaaaa    130680
     tgcccaaaac aatattatta tagatatatt gaaaaggtac cagaaataca aaagaatcca    130740
     gcattaaaaa aaggttctga tatacacgaa atacttgagt ttcacaacac tgaaaaatat    130800
     gatataattt tcaactcaaa agatccagaa atacaaaata ttgcattaag atttattgat    130860
     tctgaattag gaaaagaaat actatctaga aaatctctga gagaatttga gttatttttg    130920
     gattctaatt acgaaccttg tggtaaagat actgctattt ttgtaggcta tattgataga    130980
     attaatacga ctgaaaatgg attggagctt atagattata aaacaggtaa atataaagat    131040
     ccgtcttatc aagacttcac tcaattaata ttatatagtt tatatatgtt taaaagactt    131100
     aaacttaatg aaataaaaat aagatatgtt tatgttgaac atcttttaga aaatacttta    131160
     agtttgactc aagattctgt gatttattgg caagataatc ttaataatca aataaaatct    131220
     attgaaaact ctgttgaatc taatacttgg aatagcaaac caaataaatt atgcccttgg    131280
     tgcccttatg cagaattatg tccagatttt aaaggtaaac ctaaatgtta gaaaataatt    131340
     ttaaaaaatt aaatgaatca tttagtttaa tatctttaac agataatcaa aaagcgaaat    131400
     taatatttaa gaaagatatt cgttataata tatgggctca aatgaatcca aaattagctt    131460
     atgaatactt ctataaagat ttcaacgacc aacaaattgt gccaaatggt atcttagaat    131520
     acttggatat aacaactaag ccagaaatca atgaaaaatt agattcacaa ttagaaataa    131580
     ttataaaaaa tttagaacca tttccagttt atgattatca aaaacaagct ataaaagatg    131640
     ctatacaatt tcacaagtta ttcattagag ctgcaactgg tgctggtaaa agtgttatta    131700
     ttggattaat tgctaagatt ctaacattaa aaaaattaaa aggtttaata ctcgttccta    131760
     atatttcact aacaaatcaa tttaataatg atttaataaa ttataaattg aatatcgaaa    131820
     caagattaat aggcggtgaa aataatatta aatcttttga taaaccatta acaattagta    131880
     cttggcaatc tgttaaaaac tttaaagaag ccctaaatga tttagatttt attattgtag    131940
     atgaagcaca cacggccaaa gcagatcaaa tatttgatat ttgtaataaa tgcatcaacg    132000
     ctaagtataa gataggtttg actgggacta tcccagataa tgaaatagat gctatgcgat    132060
     taataagtat ttttggtttg ccaagaactt atattacacc tagaggttta atagataggg    132120
     gcttagctac aaatgctatt attaatataa tagatcttaa atataaattt aattttgaag    132180
     gtgaatattc aagtcaatta aaacaattaa aagaatatga tccaagaaat aatttaattc    132240
     aaagaatagg tgatactgta gtcagtaaag gcaacacttt agtgttattt tctcataccg    132300
     aacacggttt aactttattt tataagttct tgaaatccag aggattaaac tatgataaaa    132360
     agacttataa agatttagcg tttcagcaaa gaaataatgt attttttatt aatggaatga    132420
     tagaaggttc tcaaagagaa actattagac aattaataga ttcagtaaac aatgctatca    132480
     tagttgctaa ttatgcaaca acttcaactg gagtaaatat taagaattta cataatttag    132540
     tgcttgctag cccactcaaa agttatgtta caataactca aagtattggc agattattaa    132600
     gacttcacga ttctaaagat attgttaata tatatgatat tgctgaccac aatggttttt    132660
     ttaagaaaca aataaatgct agaataacaa aatcttatga acctgaaggt tatgaaataa    132720
     aaagattcga atataatata taatttttaa attctataga aatctatgat gatttaatca    132780
     aatattacaa agtaatattc attttttaca tcttgagaag tctataatat tttaatttta    132840
     aactaaagtt ctaaaacttc agcaagaatt aagttcaagt atattataat tctacatagc    132900
     tgtttaaaag gggattgata gtcacggtga cggtaaatac aataagggag ggtattgtag    132960
     acctaagagc ttcctagtag ctcaaacctt ttttacggct tagattaatt ttaagtttag    133020
     ttctaaaatt aacactatag tattagatct taaaagttct aaaattaaca ctatagtgtt    133080
     aaactatacg ttttagatct aaacttagaa ttaattttaa aaggagatat aatgttaata    133140
     caagttaatg aaaatacaac tgttaaatta tcagcagttt gtaacattaa tgttttgaaa    133200
     gacaaacaag ttttcaatat gtgttatact ttcacagata aaaaaggagc aatgagtggt    133260
     tattattatg tagataatag taatataaac tatcaaaatt ctaaatactt caaagaaaaa    133320
     tttatagcag ttcgtggtat cgatagatta atatatatta acacagactt tgtaagcttt    133380
     attaaaaaag attacgcaaa ttacccaaaa gtggtaattg gttttagtca tagtgtatta    133440
     agacacaatg tcgaatcttt tgcatttgca cccgaatata tgtatattag aactaaacct    133500
     gaagatctcg ataatacata cgccgaaatc ttagaagcta ttacaaatat ttcaaaataa    133560
     ggaggtaaaa atgagagatg aatttgatga tttgttagca agcttagcaa tagaacctgt    133620
     taagaaacct gaaatagaat atcaagaacc attagttgtt aaacctacga gtaacataga    133680
     agttaatgaa gcaaacaagc aaaatacaga tttaaatgat tttattgacg ttcttaacag    133740
     catcgaatca ggtgttagca ataccaacaa taataacgaa aatatagtag ctagctcaga    133800
     ttcagaagct tttaaggaat atatagacct cagaaatatt aaaaacgaat cagatattga    133860
     agttcctgat ttagtggata caatgcattt agaagaagtg ccaagtttaa taccagaagc    133920
     acctagtgaa catacaaatc aaacacaaga atcaaaacca agaggttatg aagttccaga    133980
     catcaaagga actactaaaa gggtaccaga tattgatgat tctgaaaata atgtttataa    134040
     attagaaact gaatatattg atattatatt aagttatgaa gaagaattaa aagatcttaa    134100
     acgccgtttt aaactcaata cattagaata tcaagcaaaa ggcgttcaaa ctaggttagt    134160
     tattaaagca gttaaacaag cagccaaaga cgctaaaaaa gaaggctata tcatcaaaga    134220
     tgaaaataga atccaagaaa gaattaataa tgattctaat ttattaggaa ggatttgttc    134280
     aattattaat tcggcaatct aaaagtttaa taatatttta aggtatttta tattataata    134340
     caataaagtt taaaaggaga tatatggttc ataaaagtgt tcaagattat tttctaaatg    134400
     aattaactaa ttattcttgt tacagtactt taagaatgat agctagttct attgatggtt    134460
     taaaaaattc aagcagaaaa atcattaata cagcattaga caaaaaacta aacacagaaa    134520
     ctaaagttag tatatttgat aatatggttc aaagttatac acaatactta cacggttcgt    134580
     gttcaggtgt tattcaaaat atggctgcaa gttatactgg ttctaataat attccattgc    134640
     ttgaaggtaa aggtaatttt gggtcgaggt ttattaatga gccagcagca ccaagatatg    134700
     tttatgttaa aaataaaaaa tatattaatg atttatttga tattaaagat gtcttgattt    134760
     ctcagaattt tgaaggttca gaaatagaac cagtatttta tgtaccaagt ttacctatac    134820
     tagttttaaa tggatccatg aatggccttg ctagtgggtt taaacagaat attttaccaa    134880
     gatctttaga ctcggtaata aaatatatta agacaggtaa gaaagtcgat ttaaagccgt    134940
     atattgcggg ttttaaaggc acagtcgaat tagtagaaga tgctagttct aataatacac    135000
     aatggaactt tataggcgtt gtggaagtta ataaaaataa agcaattata acagaaatac    135060
     caccatttat tgagtataca aaatatcttg aaatattaga taatcttata gagtctaaaa    135120
     agattaaaaa ttataaagac ttgtcggatc aaagaaacca agaatttaaa ttcgaagtta    135180
     tatttttcga taatatctct aaagataaag ctatcgatat attaaaatta tctaaaagag    135240
     aaacagaaat atataatgct ttagatgaaa ataatcaagt tagaactttt gaaaatattg    135300
     aatctataat tgattattac atagacgtta gaaaaagatt tttaattaaa caaaaagatt    135360
     ttgatttaaa agtccttgaa aatgatttaa acattaatgt tcaaaaatta agatttgtta    135420
     aattaatcat tgattcagag ttacaaatta tgaaaagatc taaaaaagat attgaattgg    135480
     atcttgaaag taaagggttt attaagtttg aagatagtta tgattattta cttaagttac    135540
     caatacattc gtttacaaac gaaacttttg aaaaattagt acaaaatgct aaagaaatca    135600
     aagctaaatt tgaaacatta aaaaatctgg atacatttaa aaattatgtc gaatctttag    135660
     attctattaa gaacatatta actaaagctt aagaggagtt aaaatgagat atgaagctgt    135720
     aaacaataaa acaaaaatgg aggattctga attggatatt atatctacaa aagatacaag    135780
     gcattcgtta tacaaaaaaa gttttaatta tactaattat actttaaata tcaattcatt    135840
     tgatcacgaa gaaggtgaat tagaaaatat ttttgctgat cttaatggcg ctaatgaagg    135900
     tgattctata caaatcttta tagccagtgt gggtggtttt gctgatgaac ttaatagatt    135960
     tacaaatata attagaacaa agttctatgg taatgtaaca acagtattaa acccatttgg    136020
     atattcttgt ggtgctatga tgttcttaat tggtaattca cgtgtaattt atgagaactc    136080
     aagtattatg ttccattcag taagttttgg agtttctggt aaacattcgg atgttaaaac    136140
     gcaatttgat ttttctaata agtattggaa tgaatatatg aagtcattat taaatccata    136200
     tcttaccaag aaagaaattg aattattaat agatggtgtt gagttttggt tcgatgctta    136260
     tgaaatgtgt aaacgtggta ttgctactca tattaatgtt tttggtttaa gtatgaaagc    136320
     agatgcttat tgtgagtaca tagataattt agattataga atagagtttc ttgaatatat    136380
     tattaaagaa ggtgaccttg attctattga tttacaaagg gctgaaattg agttagaaca    136440
     agctaaaaaa gatgctaaga aagccagcac tactaaaact actaaaaaag ctgtagaatc    136500
     taagccgaag gctaaaacta ctaaaaccac taaaaccact actaataatg aaattgagtc    136560
     taaagatctt agctaagatc tttaggcttt aagaatcttt ttagttcagc tatattataa    136620
     tcatatataa cacctaaggt aataaaatat gaaaataaca atctttggaa ctgcaagtaa    136680
     aaatgaaaag tttgctaagt caccatacga tgacaattct tttatttttg aaacaattga    136740
     agtccaaacg acttaccaag catttcaact acttgttaat aatttttgtt taaatattgc    136800
     cttagactta aaaggaccta gcaaatccag aagattaaaa acagatttag aacctcatat    136860
     aattaaaaca tttgatcatt tattatttga ttttgaatgc aaatcagagt ttaataaaaa    136920
     tacggcatta gactatttta agagcacaca atgcactata ggccaatcca ggtcttatga    136980
     tggtgttaat aattttaatt taaaaggtat tattaaaaca gctccaatga gcttaaagga    137040
     actaaaagtt ctacaagcta aaatacaaaa agaactttct gaatatggta aatatactac    137100
     tgacacatta agaataactt attatacagc acctttgaat aaagacaaca tcctactaga    137160
     taatccaaac ggttctgtat tgatgcctgt aggcacgaat gttacagatt actataataa    137220
     catagattta gattgtaaat ttaatattac ttctaaagaa actactgaaa tatgcaaaac    137280
     aatttttaag aacctgggtt ttatcttagt agatatcaat gctaatggtt ctataaaata    137340
     cacaaaagat tctgaaaatt atatttggta cccaaataat ccatatatta tgaatcatac    137400
     tgaaagttat atgtcagtaa atatttggaa agaagctata aaatatgaac ctacttttga    137460
     tataactcct tatatagatt ataaagcaga tatcgtagtt gatagaaact ttacagaaat    137520
     taagtctgaa ttagattcca ttgtcgaggc ttttttgttt aaacataacg gtgccttgac    137580
     tttgagagct cctatgggct caggcaaaac aacttttata gatagaatca tagaatatgc    137640
     tttggaacaa gattttaaaa ttgcaattat aaccaataga gttacattag cagaagacta    137700
     caaaagaaaa tataagaagt ttttatatta taaagattat actaatgcta ttaaagctaa    137760
     aaatgactat aaaaataaca acgattgcaa caataaaccc aaaattgtta gatcaaaagg    137820
     taaatcatta atttgccaat acgatagttt taactacttt gatttggatg actatgattt    137880
     gattatttta gatgaattta tgagtttgtt aatgcataca agaactgctt taaatagtaa    137940
     aacagagaac ttaataaaat tctatactgc tttaaataaa aaagttgttg tggctgatgc    138000
     atttttaagt aaatacattg tagacaatat gtttactaaa cctttaaatg ttgttagtta    138060
     tacaaaaaat aatacagaac tttatagttg caatgacagc aatacctttt atacattaat    138120
     taaaaatgct ttagattcta ataaaaaaat aactatttct acaactagta taaaagttgt    138180
     tgatattatt aaagaaatgt gttatatact aaataaaaaa ataattattt ttaataaaga    138240
     aaccagctca gtatcaaaaa atattatata tgataaaatt aggtctaaag aagcactaga    138300
     ttgtgatgtc tttatttaca ctccagtgtt aactgtgggt gtcaacattc tgaatgatgt    138360
     tgatatacat tttcattatg atagtgcaag ttctacagac gttattagtt cattgcaaat    138420
     gttaggcaga gcaagatttt ccaaaaagat aatttactat gttatgaaca aaaaatataa    138480
     tacttgtatc aattatgatt tattaaaaac taccgtagaa aaaaagccta aggagcatac    138540
     tgatgattct aaagacagag atgttgaata taaaagagga actgttaaaa atcttttgta    138600
     tcattttcac gtaccacctg gcaaagatta tcaagaatta agccatattg gtaaagcttg    138660
     tctaaaagta gacgttttta acaatatgac tttatgtgac tataaaaaat cttttgatat    138720
     tttattaagt tttaatttta gtaaaacgcc gattgaattg aaagaaatgg aaggtgatgt    138780
     tttaaaatta atggatatta aaattcagga ttcaaaagat tatgatactt tttagtttaa    138840
     gctttaagct ttagttttgg tttaatttta aaatcagtct aaatatatta taattaaaaa    138900
     atcaaataaa ggagtcaaaa tgaaattaat agatggctat tatacagatt ctgataataa    138960
     taaatgggat tcttctgtat atactgaaga gcaagcgaaa gaagcttctg ggactttagt    139020
     agtttgcaaa gattgtttaa attgtttcaa ttgtgtagat tgttataaat gtattgattg    139080
     tattgattgt tataaatgtc gcgtttctaa agattgtatt gattgtaaat cttgtattga    139140
     ttgtattgat tgttataaat gccaaggttg ttttaaatgt cataaatgtg tttattgttt    139200
     ggattgtcac gaatgtgtag attgcaagag atgtcgagct tctatagatt gtttgaattg    139260
     cattgagtgt gcaaatactt cgaatgaatc acatacacga aaatcacaca cagcattaaa    139320
     aatatataaa atcttaaata cataaattat agattcataa ataaactaaa aggtgataat    139380
     gatttatatt acaagtgatt tacatgtatc tcatcaaaat attataaaat atactggcag    139440
     atatattgat gatgctttag aatattcaaa agaagttcat aagtatttta aatctgtttt    139500
     aaaagattct gatattttaa tgtttttagg agatttagat tgtggtccta ataaaaatat    139560
     agaattctta agatactttg tcagttcatt acctggtaaa aaaatttttg taagaggtaa    139620
     ccacgacaag tggttagatg acgaaagtat tttatatatt gggtttagta cagtttctga    139680
     tattattaga tataaagata tcttgttttg tcattatcca ttagattcaa gatccgtaat    139740
     acctaaggaa gctccagagt ttttaaaatc ttatgattta acaggtatta aaaaaatata    139800
     tcacggtcat actcacaata attggatggt agattctaaa gatggtattg aaagaattaa    139860
     ttgttgtata gacagaaatc cagaagttat tggtactttg ataccattcg agctgaagac    139920
     ttaaaaactt aaacaaaagg atattaaaat gaataaagtt tctgaagtta aaaaagttac    139980
     aagagttttc caaggaaaat ctgtgtatga ttgtttagtt cgttggaatg atactaataa    140040
     atttgtgcct tgcacagttg atattcaaaa tccaggtgac ctgaaaccat tagcagatta    140100
     cttacttaaa cataatctta tatctggcct ttaataaaag gcctcactaa ggtttataat    140160
     gcatagcgat attatacaaa ctctaagttc agcaggtgct tacttaccca atgatactat    140220
     atgccctaga gcaaaactag acactggcac atactgcaac tatcgttgtt atttttgcta    140280
     ttaccaaaat gaattagata aaaagacacc atttgaagtc attaaaaaaa gaatagatac    140340
     tttgtatagt ataggttgta gagattttga tttaagtgga ggtgaatctt ccatacaccc    140400
     agatttcttt aaaatcctag aatatattaa atctttgaat ccagataata aaatatcttg    140460
     tttgacaaat ggatctaaat ttcagaataa agattttctt aaaaaagcaa aagatcttgg    140520
     gttatctgaa atattatttt cattacatag tgttaatgaa actcacgata aaataactgg    140580
     gataaaaaat tcttataatt atataattaa agctatccat aatgcaaaag atcttgatat    140640
     tgtagttaga ttaaattcaa ctattactga tgtaaattat aaattagtag atactgaata    140700
     tttcgaagtt gttgaaaaat tagaaccact tgaaatgaat tttttaccat tgaattattt    140760
     tagtcagaat tcaaaatcaa aaggtgttaa ttattctgag attttagaac ctataaaaag    140820
     atttatagat ttatctaaaa ttccattaat caacgttcgg tacgtcccgt tttgttatat    140880
     gactgggtat gagaaatacg tcgtaggata ttatcagcat atctatgata tctacgattg    140940
     gaatattgct atgtatgaat acttagaacc taatttagta aatttagcaa aacaagccgc    141000
     atctaataga caaaaaagtt ataggaaatg tgatgcttgt agaacttgta agtattttta    141060
     tatctgcgat gggattgaac ctcaagttct taaaacaggt tgtgagttta aacctataca    141120
     aggttctaaa ataaaagacg ttaatgcatt tagaaaatca ttctttgata tttaaactct    141180
     taaactttcg aaatttaaac tatagtttaa acgcctaaaa tgtttaaaac tatagtttta    141240
     gatctaaaac attttaaaag gagtataatg gatatttcat taattatggg gcccatgaga    141300
     tctggaaaat ctcttgaatt attaagacaa gccgaaaaac tccattttag taataaacct    141360
     tatgttttat atagacctaa aaaagataca agggatttta tatcaagaag ttttagacct    141420
     agtttagact taaatataca atactatgac aacgaaaact tcagtgaatc taaatatgat    141480
     tatatattat tagatgaatt tcaatttttt gaacctgaaa ttattaataa tatattagaa    141540
     tctaataaaa catttgtttt atgtgcttta caaagtggta ctaataatat caacgaacct    141600
     tataatgtag aagttttcag aaatgtcaat agaattatac cattttgtag tgatattaga    141660
     ttgttgacca gcatatgcga aaattgtggc agttcttgtg ctactcacag ttataccgac    141720
     gttatcaccg tttctgatga ttataagatt ctttgcaata attgtttgga ttttaagatt    141780
     cgaagcaata tgattcttaa gagattaaaa acttaaagca aagcttaaat tatcttaaga    141840
     tattattaaa aagtacaaaa ggcctagtgg attttaagat tcgaagcaat atgattctta    141900
     agagattaaa aacttaaagc aaagcttaaa ttatcttaag atattattaa aaagtacaaa    141960
     aggcctagaa aatgcttgag tttttgcagt ttatactgta gtataagtct aaaacttaaa    142020
     gcaatattaa aaagtataaa aaatgctaga gtttttagta gtatatacta tagtattatg    142080
     tctaaaactt aaagtaatat taaaaagtat aaaaaatgct agagttttta gtagtatata    142140
     ctatagtatt atgtctaaaa cttaaagtaa tattaaaaag tataaaaatg cttgagtttt    142200
     tagtagtata tactatagta ttatgtctaa aacttaaagt aatattaaaa agtataaaaa    142260
     atgcttgagt tttagtattt tatatatgat agcactgcta tatatatata ctagtatata    142320
     cttaaaactt aaagtaatat taaaaagtat aaaaaatgct tggatatttc acagtatata    142380
     ctacaacaac aaactaaaat tttaagtata ccttaagcat ttatataata taatattaac    142440
     aatacaataa atcaaaggtt gcaaacaatg attaaaacca acaaaaagct cgaaaaatgc    142500
     ttgagttttt gcagtttata ctgtagtata agtctaaaac ttaaagcaat attaaaaagt    142560
     ataaaaaatg ctagagtttt tagtagtata tactatagta ttatgtctaa aacttaaagt    142620
     aatattaaaa agtataaaaa atgctagagt ttttagtagt atatactata gtattatgtc    142680
     taaaacttaa agtaatatta aaaagtataa aaatgcttga gtttttagta gtatatacta    142740
     tagtattatg tctaaaactt aaagtaatat taaaaagtat aaaaaatgct tgagttttag    142800
     tattttatat atgatagcac tgctatatat atatactagt gaatatttca cagcatataa    142860
     catatactta aaacttaaag taatattaaa aagtataaaa aatgcttgga tatttcacag    142920
     tatatactac aacaacaaac taaaatttta agtatacctt aagcatttat ataatataat    142980
     attaacaata caataaatca aaggttgcaa acaatgatta aaaccaacaa aaagctcgaa    143040
     gctattaaag atacattatc aagtccagaa aatttaggaa cacatttcta cattttagag    143100
     agtataaaag gatttaattt cagtgttaag ttcgataaaa taaacggatc aattgaatat    143160
     tttactaaaa gtaaactaat taattttgaa tctaataaaa gttcgaaaat caaagtactt    143220
     aatgatacta tcaatggggt tagcttaatc agtaaattgg tcgaattaat taatatcaaa    143280
     tatccagaag acaaccatat cgaattcttt ttaactttat ttcatgtcgg agctgatgag    143340
     tctaatacca acaatactaa atatgcaatc ataatgtacg atattttagt tgattctaac    143400
     tacgaagatt ttgataatgt tttagattat tgcactttag ctggtatcaa aacaaatcca    143460
     attattaaaa ttgtaaatga tttagattct gctttaagta tctcagtaaa tagtgattca    143520
     atgattccat atcttttcaa caatagttcg aagttggtac ctatgtatgg tattaccatt    143580
     agaccttata aagaattgca atataaatta agatctaaaa cacacagact tattattgag    143640
     ctcgatgagt ctaatacatc agcagattct aaaactgaag attcagaatt tcttaaattt    143700
     ttaaacatag aatcattaaa tgttgtaaaa gctcaaaatc caaaaaattt agaaactgag    143760
     ttaatatatt atataataga aaaaataaat gaaataaaac acttaagtgt agaagaaatt    143820
     aaaaatctaa aatcaaagta tacacaaaac gttagggatt tcatctctat gaactaaaac    143880
     actaaagtgt taagttccag aatttgactg taaattaaag aacgaaagga gtaaaaattg    143940
     tcaatgaaat tttttgtaac tggatccagt ggttttctag gatctaactt tatcaaaatg    144000
     ctatatacat tggatttaaa ctctagagtg atcggcctag atataaaccc aggtgaatac    144060
     actgatagca cacaaggtat taaaaatgcc aagaaatctg ggttacttaa aaacttaatc    144120
     aaaaaatgcg acgtagtcgt tcattttgca agtcatttag gtgtacaaaa tattgtggat    144180
     aacccaaact taccttttaa atcttttaaa aatgataaaa ttgttgtaga cttagcggtt    144240
     aaatacaaca aaaagattgt atatttttct acttctgaag tatatggtga ttctaaagat    144300
     tactcagaat ccagtgattt aattataagt tctaaattaa gatctaatta tgctttagaa    144360
     aaacttttta tggaaagata catacaatca aaaacaaata attatttaat aataagacct    144420
     tttaatgttt acggccctgg ccaaaatccg aataatggat tcattgctaa agtattagca    144480
     gcagctttca atcctaaaga attaatcaaa atcagagtcg actctgagtc aaaacacggc    144540
     actgaaagat gctattgtta tgtagatgac tttaataaaa ttctttataa attaattaaa    144600
     caaaatgtca gcggtgtgtt taacatagga aaccctatgg ctagagcaaa tccattagac    144660
     atcataaaaa tgatcaatga ttttggatat aatataaaat ataaattcga aaccattgaa    144720
     aatgaaaatg attatgaaat acaaagacga gttcctagta ttgttaaatt aagcgaagtt    144780
     gtttataccg attttacaaa tttaaaaact ggtattaaaa atattttgta ttatgttgac    144840
     ccaccatttt gagataaaat ttaaaaccta aaatcaacaa ggagtaaata tgctaaaaca    144900
     tttaataatt gcgggccatc cagatgacga ggtaattggt tgtagttcta tactactaga    144960
     agattctgtt ggtgtcctat acatcacaaa tgattatagt actgctaaca cagaacgtaa    145020
     taaagtcaaa gataaattag ctttggatta tcaaaaatgt ttgaattatc cacttttcag    145080
     aatgcctgat atcaatgaat tagctgataa tattaaagac gttttagact ccgttaaacc    145140
     agaaaatgtt tatgttcacc acccagaaga tttacaccaa gatcacaata ctattacaaa    145200
     agcaacttta atagctgcta gaatgaatag aaatgattat attaaatctt tgagttatta    145260
     ttatgttgaa aatccatttg aattaaaagc ttgtgaattt aaaaaaatag ataaagatga    145320
     aaaactcaag tttttatcta aatacaaaaa ttatatacca gaaaatcata ttaaaactat    145380
     tttagctttt aatgagttcg taggaattta tagcaattta ggttttgcgg agccgtttga    145440
     agttgtttac aaacgttctt agttcaaaag agttcaaaag ttaaatccaa ggaaaataat    145500
     gagtgaaatt ataatgattc acgaagtaaa tgataaagtt ctcaaagctg tagaatcttt    145560
     agatccagat agtataatca catttgatga tggattatat acacaatttc attatagaag    145620
     tcattttgca ttatttaaac gtgttatatt cttcgtaaat ccgtctataa tttgtgaatc    145680
     ttctgagaaa caatctaaag agtatataca gtgttataac gcccataaaa aggcgtttaa    145740
     aggctgtttt gaaaattata tgacattaga tcaaattcag caaatttcaa gggaaaatat    145800
     gtataatttt gaaataggtt cacattctta taatcataaa tattttaaag attcaaaatc    145860
     tttgataaaa gatattcaag attctttaga tttttttgag aatcataata tacctattaa    145920
     atcattttgt tttccgtata atcaagattc gagaaaacca cattttatcc aagcagttaa    145980
     actaaagttt aaagatttgg atatttttgg taataacaga gtacctattg aatctaagtt    146040
     ctaaatgcta atattagact aaagtcttag attttagact ttaacaatac atcaaattaa    146100
     ggagcttaag tgaagaatat taaagttaaa ttaataacaa attctggtat caatgttttt    146160
     attgatgctg ttagaacttg ctgggatagc catagtaagt gtgatactac tggtgataac    146220
     gtaggagaaa atgacaaagc attaatagat agaatagttc acaaacacaa acatcattct    146280
     acattagaac atttgtttta taattttgaa atcacaggaa tctcaagact ttgcttgcaa    146340
     gagctagcaa gacatagaat ggcttcattt agcgttaaga gtacaagata cacactaaaa    146400
     gaacttaggt gtgcagatat ttctacatta gaagctgcca gtaagtttat tgttttaact    146460
     ggtaatgaat tagtagacac cgcaagccac aaaaacttaa aagaacttca taatacagtt    146520
     aatacaaatg gtattaccca agactacgcc aagtattgtt tacctgaatg ttatagaact    146580
     tcattaagat tttctttaaa tgctagaagt ttaagaaatc tattagaact aagattatct    146640
     aaaggtgctc attttgagat tcggtatttg tctaaattgt tgtttgatgc attaccagat    146700
     ctacacaaag aattaatttt caatgattta gaatattcag aataaacaca aggagttaaa    146760
     atgtatatca caaaagaaga tggtgaagaa attgaagttg aaatagatga atttagagac    146820
     gatgacgtct taagacatgc cagggattta attgaaggtg atagatctaa aatagaatat    146880
     tttgaagatc ttatggaacc agaatttaaa tttgattttt taaatgattt atataatata    146940
     gaatacaaaa aaaattattt tgaatcattt cctgagcata aaaaattaat tgattttata    147000
     aaagatctat ataatttaga atataaaaaa gattattttg aatcatttcc agattataaa    147060
     aaaattaatt gattttatat aaagaaaggg gtttagaatg ttatctagaa agataagaat    147120
     tgatagcttt atctctgata aagaaaaaga agaaatttat cagtattcta aatctctttc    147180
     taccgtctat aatgaatgtc tagatcttct taaagaaaat ttgaatttta aagatctatc    147240
     taaaatcaca aaaggtagat caaaagcaac aggcttacat tcaaaacata tacagaatac    147300
     ctctagagag gttataaacg ctgtaaaatc ttatctagcg aaaaagaaga acgataagtc    147360
     tgctagattt ccaaaattac atagagaata tagtcctatc attatggaca taaatctttc    147420
     ctctaagacg gaggagattg ttaactctag aactggagaa gtgattctcg aaaagaaata    147480
     ctatccaggt ggaggattta aactagaagg taagaaaata aactttactt caataggatt    147540
     tgaattagat ttaagtaaat gcccttacta tgatatagaa cttatcaact atgagacttt    147600
     aaaacagata gtcgtcaaga ttgatgagaa taagagaata gattgtattt ttgttttctc    147660
     agagaaaata caagaaaaag cactaaatca aaattttctt tctatagatc taggagtaag    147720
     cagtatagca tcttgctact caaacaagat tgattgcttg aagatacaaa ctaagagatt    147780
     taaaggtcta gaaagaacta taaatgagct gaagtctaaa agagataaga agaaaaaaga    147840
     ctcaagagca tataagaaac ttaacaaaac aatcagaaga aagcaagcaa aactaactaa    147900
     taaaagaaaa gactatctcc ataagacctc aaaaactata gtagatctct gcattcttaa    147960
     tggtatagat aacatcattt gtggagatat caagactaaa aaattaaaga aagactataa    148020
     aacaagttta aacaaatcaa ctcaaaatga aggactattg agtagattta agggtttctt    148080
     aaagtataaa gcagagaata aagggttgaa ctttttactt gtgaatgaag catatacttc    148140
     tcagactaac tgtcttacag gaaaaagaga gctagactcg aatcttggta ttagagaggt    148200
     agaattaagt ccaggtttca aagttgatag agatataaat tcagctgtca atatagccaa    148260
     aatatgtggg gatttatggt tatcccatat ctttgagaag aatagacttc tcaagataca    148320
     aaaaatgaat attactttgt aatatttgat taaattcttg tagatttcta tagaatttaa    148380
     aaatcataaa agctaattat taacttaaaa ttaaggattt caatgaacgt tttatataat    148440
     aatgaatata tagatttcac aaaagaacct ttattttttg gaacaggtaa gaactcacaa    148500
     agatatgatg ttataaaata tcctatcttt gaaactttgt ttaagaaaat ggctggtttc    148560
     gattggcaag aagatgaagt acaatgtacc aaagatcaag cagatttcaa tgtcttaaat    148620
     gaagcaatga aacattctta cactagagtg ttaaacaagt taattttctt agattctatt    148680
     cagggtagag gtttattaca aactattgga tctattgtta ctaacccaga actagaagtt    148740
     tgtatgacag aatggcaaag atttgaaatt tcaagacatt caagaagtta cacacatatt    148800
     cttagatctg tttatgctaa cccaagtaag atatttgatg aatcttttga aataccagta    148860
     ttattagaac ttgcagatag tatttcaaaa ccatatgaag aagcttttga agctgtaaca    148920
     aagtatcatt taggattaat agatattgaa gatgttaaag taaaagttct caatatgtta    148980
     atagaaatta atatattaga aggtgttaga ttttattctg gttttgcgac aatttggagt    149040
     atgcattata gccaagggtt aatggaaaga actggcaaga ttttacaatt aatttgtaga    149100
     gatgaaaatc tacacttagc aataactcaa aatctaatta agatattatc aagatctcct    149160
     gaagaaggct ttataaatgc ttggaattct attaaagata atataactga tagatattta    149220
     gaagctgctg atcaagagtt taagtggatt gattatttgt ttagtaaagg tgctttctta    149280
     ggtatgacac cagaattagc caagaattat attaaatatc ttattaataa aagattaaaa    149340
     gctattggat tcaaagaagt ttttgctggg tttaataaga accctatacc ttgggtagaa    149400
     acatatatta attatgataa aaatgaagtt ctcccacaag aatctgaaat aacaaattat    149460
     aaaatggata ttttagacac tgaaattaaa gattctgctt ttgaaagact taagaagaaa    149520
     ttaaaaatct aaatttaatg ctttgatgat atttactaga tctgtagtat taaacttagt    149580
     tcgtttgtac tttagatcta aatttaacac taagtgtaaa cttctaagct tgataaatgt    149640
     ataaaatatt taaaaaaata attttatttt aagtttatta ttatataatt atataaaatt    149700
     aaaaggagta aaaatgaaag atttaacaac aaagtttatt aatattatgt tgaataacaa    149760
     ctacgatgaa gctctgcaca aaaaaataca agaaaaatta tttagttccg atttacaagg    149820
     ttcaaattgt gatacaggtt ttgaatcatt tagacttgaa ctcaattgtt caattgatga    149880
     actcaaatca aaattattag gttgtggata ccttgatgac actgatgaag atttgtggga    149940
     cttttttaag ttaaaagatt ctgatggtga ttcacaatgg gataattacg tttacagttt    150000
     accttcatct acaagagagt taagcagcac tacatttaga attaaagacg gaaatactat    150060
     tgttttctac gatatggttt ggggtaacga acaaacttgc catttgactt ttaagaacta    150120
     gtaaagatta cactttagtg ttaacgaact taaacgacac taaagtgtaa acttctaagc    150180
     ttgctgtata ctattgaata tcagtatcct tgaatcttga taaaatcaat tttgtaatat    150240
     aaaattgtga actttctatt ttatctataa acccagttaa aatatactca ccagaaattt    150300
     tagtgtctcc ttcttgtgtt tcattagtat tttcgttaga tttaaataat actttatatt    150360
     ttgtgaatat ttcgggtgcc ttaacaactc caggtactac taattctaac ttagaataat    150420
     ctaaaaacga tttatatgta tcggcaaaaa tattatcatc gtacaaatat tcttgagctt    150480
     gatattcaaa accatcatga tcttgagatt ctactggaac atcgaaatct aaatcttcaa    150540
     gattaatttt cataactttc attgttttag tagctttatc aaatgcaatt atttgtgatt    150600
     tcggtaattt cagggcttgg tttgtgttta taatcttcct agataaaata tcataagggt    150660
     tgttaggatc ttttttaaaa tcatcatatt gtatattttg aagttttaaa ttatttggtt    150720
     taagttcttt ataaggtttc ataacaattt tttgtttatc ctgaaataat attaatcctt    150780
     gtctatcaca ttcttcgaat atgaaatcca atacagattt tcgtgaagtt aaaacgaagt    150840
     tttcaattac gatattacta gataattcca atttaacaga atctggatta tattttaatt    150900
     ttggtttaat ataagtatca tatatatctt taaaaatatc tgaaagtttt ttatttttat    150960
     atgttttagc tatatataat ttactaaaca aataagatat caaatcttgg ccttgtattg    151020
     taaaattgga tttatcagtt gtttgggttt tattattttt aacaacttga aattctcttc    151080
     tatagtaacc ttcactagca tctaatataa aaggaataaa tcgcatatca ccggattgat    151140
     ctaaatagta ttgcaaatcc gtggtaccat tgactgtaaa ataagacaag atgataaaac    151200
     cattgaatga aatttcacca gattttgttt ctccagtttt taattcaagt gatttacttg    151260
     atttattatt aagaatagat aaagtaaaat ctttaacatc gcaagcgtga gaaaatagac    151320
     tttgagttcc cggattcatt agaacctacc aaacacatca tcagaatttg tataaaaatc    151380
     ttttgtttct tgttgttgtt tatctttaat agaactcaat tcatcgaaat atttttcaag    151440
     ctcgttatgc atatctgtat taggtgtttg cttgtctaat aattcgtcag atctaatgac    151500
     aaaatcactt tcaagttcat cagatttttt aaatacataa gttttacatt taaatttata    151560
     aacattttta tattgattat aaagaaatac gttatttaac ccaaaacaat ctaacgtaat    151620
     ttcggtaatt tcaagaatct ttccacttgg aacgattatt aaagatccta ttaaatcgtg    151680
     aattctggaa tctggtaaag ttacatcata ttcattctta gaattcattg aagattgaac    151740
     taaattaaat gtggaaattt tagaaacata taaacctata cttgtatcta atgggacacc    151800
     aaattgtgtt tgcaatcttt catattggtc aaattcttct gaattttctg gcataccaaa    151860
     tatttcaaaa caagctctat tgtccgcttt aaaatgacta aaatcaccaa atgtcaaatc    151920
     tctgttaatt tttttggtaa tgattaattt aagtggtgca ccataaagtc taatgagttc    151980
     ctcggtaact gatccgctca gatcatattc attagtatgt tgattaaagt tcaattcaaa    152040
     gccttatttt tgatatattt attattaaat acctaataaa taaaatcaaa aggttcgaga    152100
     tggtcagcac tgataattct aaagctacaa gtattgaaac aaatcaatat ataaaaaatc    152160
     caaaatatac tacaaaagaa gctattgata aatttgttaa cctattgatc ctgggtagat    152220
     acactgaaaa agatttatca gatgctttga actattgctt aatacgtagt acagaaagtt    152280
     ttgataatat agattctata aaagaagcta tagaagaact taagaaagat tcagaagctt    152340
     ttaaaatatt catagataat acaaataaac ttttagatgc tattcaaggc attaacaaag    152400
     aacagactgc tgaaattgat aaaattaatg agttcttaaa aaccgtagta actttagata    152460
     ccgaacaaac tattacagga actaaaacat ttaataagat ttacgtctct gacccaaccg    152520
     aaaacaaaca agccgccaat gcccaatatg ttatggatta tgttagaaat caattaaatt    152580
     taactattgg agatttaagt aatttaaaaa ctgaatctaa agatttaatt gttaatgcta    152640
     ttaacgaagt tcttgataat ttaaatattt acaaagaaac tataaatgaa actactatta    152700
     atcaaatgat tgatactaag ttaaatccat taatagggcg tatcacgaca attgaatcta    152760
     ctgtggatta caccaaagaa ttagcagaag ccaataagca agctattgat gatttaaata    152820
     ctaaagtagt tgataatact agtgatataa cggatattaa tagaagactt gaagaagctg    152880
     ttttctatag taaaattaat gatactcgta agactataca acttaaaaat tatgatagca    152940
     tttctggcgt tagtactacc ggtgaaggta tcaatattgc tatggtttct aaatgggata    153000
     aagtagattt aggatctaat caaattccta ttaacttaaa tggatcggaa actaggccaa    153060
     cttataacga ttctaaagaa atagctttga tagatgatgt taacttaaaa gccgattctg    153120
     atgccgttta taataaatct gaaattgata ctaaattaga aactaaagca aattcaagtt    153180
     cagtttacaa taaagaagat tctgacgcca gattcgttag tttaactgaa gatcaaagta    153240
     ttgaaggtaa taaaataatt gaaggtattt gggaatataa tggagtattg tctaaaccaa    153300
     aacaattagc aactaccgaa tatgtgatga attatgctga aacacatacc aaccaaaaag    153360
     tcggagattt aacaggtctt aaaacagaag ctaaagacac agcagtggct gctatcaacg    153420
     aattatttga taagattgga tctgggagtg cagacaatgt agcatataat attagtaata    153480
     ttccattagt accttacaat gatgttagtt ctttaaatac aaaaaatatt tgtgtaaaaa    153540
     tatctgcgac aactgatagc tctaattatt catctggtga tacagtagta gttagtaatt    153600
     tcaagataaa acttaaagga gatgatgagt accttaaacc ttatggggtt gaagttattg    153660
     atagagaaaa taataaaata ggtttaaatt taataggaga tgatacagta tataatgata    153720
     atgatgcttt attatctaca agaccttctg attttaattc atctagtgta gatctttcta    153780
     gtgggagtaa cgccttagta actgttaaaa ctaatggagc ttatgattat agtggagttt    153840
     atgatatacc aaatcctttt agagaatata ataaaaaata ctctttattc ttaagtaatg    153900
     atgggttaaa aaatccttat taccaagttg gtataaatag ctccaaacaa gttgataata    153960
     tatcttttca attatttgga actagtgcta caaatccttt tttatattct aaagactgta    154020
     aaattgaatt gtttatagaa aatactattg taaaaacctt caatattaaa ggcagctctg    154080
     gaaataatag tcctgtgaat attaatatag attataaaga tggtatgttt ttaatatctg    154140
     ttcttgattc tataaattat ataaataata gaatcaataa aaatgcagag ttacttacag    154200
     ggttaggaaa acctaatttt tcactaaacc ctaataaaat aggctctcta tactctgata    154260
     caactaataa agctgtatat atgtgtatag acaatacttt tggtgctaat aaatgggtga    154320
     atatagtaac aggggatgaa attaaaccaa gtcttagaaa aatagagatc acttgtaatg    154380
     taaaactaag aagtggccaa tacggtggtt gtatgagcgg tgttaaaata ggatttgata    154440
     acggatatgc ttctacaaaa caaatagtta aagggttaaa tagcggtcaa atattactat    154500
     ctctagatgg gctgggtaac ctttctggat attctgaagt tagttcttta actcctagcg    154560
     gtcaagatat aaaagttgat gtggatacta ctgggatata taatgatcct tcatatcatt    154620
     gcgttactaa tatatttaaa gagtatcttg gcaatgctga tcaatgttcg ctatggtctg    154680
     atgctagtgt taaacaactt aaaataactt tactgtctga aaagattcct acaaaaatat    154740
     tatatgtagg aaacggatat tatggtcaaa catctgtttc tgatgtaaaa gctgtatggt    154800
     attatgtaaa tgatagtgga gacaaaatag aaggtaatgt agataatgat ctaaaggtaa    154860
     gtgataatgt ttctgaaaca aacgatagtt cttatatata tgcgttcaat ataaattaga    154920
     tatgtaagac tgtattaatg atagatccaa ctaaagactt tttaaaagct attatttgga    154980
     aacatcatta ttatttttga ttcattttat taaagaaaac agagatattt atattgtctt    155040
     tataattata aataaagttc gataaataat ttatatctaa tagatatatc ataagaataa    155100
     tttaaattta atttagtaga acattttaat ttaggtgttt ctgcaaatat gatcaaatgg    155160
     gggttctatt aattttaaaa tagtccctgg tttaactatt gaagctgagg attcttaatg    155220
     gctttctttc attttaatac tttaagaaaa tatactggag ctttgataca tttattttct    155280
     aatttagaaa tacaaactat tcaaagcaat ggtaaaccat tatattctat agttcctatt    155340
     cagtatgcta acagggaaag atttgatatt tatagtcaat tatcttataa tcaaatgttt    155400
     aacggcaata cacaagtttt acccagaggt atacttttgt ttactggtat gaatgctaat    155460
     atcaatagag caaaaaataa atttgctaaa atatatagaa aatcacaaat aattaaaggt    155520
     gaaactaaaa aattaaatta tcaattcaat tcagtccctt atgattttac ttatcaagta    155580
     attatacaat gtcgtggaat gaacgaagct agtatgatat tagaacaagt cgctagttat    155640
     tttaatccca gttattgttt aagaattaaa gaagtagatt taccagattt tggagatacc    155700
     tcttgtatat tagaattaaa ctcaactagt gtagatcaag aatctatgga tgaattaagt    155760
     actaatattg taacttgcac ttttgattta accttaagag gtaatatata cccagcaata    155820
     aaagaacagc atttaataga attagttcaa ttgtttatga gtactgattt accagaatct    155880
     actgaagcta atccagtagt cacgagagtt tattccgaag gttctaaaga aacagaatct    155940
     ggtatccaaa cttttataaa tcaatataaa gcagttatta aggatataaa attcaatcaa    156000
     gattatttac tctgtaaaat agattctgaa tgcgagaaac ttattaaatt tagatttaat    156060
     tggtggatca atgacatcaa acaagacagt gaaattgaaa aattacatta tgtaccacga    156120
     gatggtgata tcgtaaaagt tcaagcattt actgatattg ttgagagtga tatctttgaa    156180
     aaagaatttt attctgatga accaagatat gatttaatta ttaatgattt aatcagagat    156240
     gaagaattct tagaatgtga ttttactgac agtaatccat caaatattaa atatacattt    156300
     gaatggttta taaacggcaa aaaattagat ttaactcaac gaattattaa atataaatct    156360
     aaagttagct ttgattgtga atgtattatt agaagctctg atggtagaga agccaaatat    156420
     tttaaacatt ttcataataa tgaaatgatt tttaaagatt cttttaaagt aaaagattct    156480
     atgaagcttg aactcaaaac agatttgaaa tctatagcca ttggctacaa tgattcaatg    156540
     aatttcgata ctaataacga ttcaaatgat aattcaaatg gcaattaagg tttaaaatgg    156600
     gtactttttc attttcatta tcggatataa agaaacaatt aggtcctggt ttaggagtta    156660
     gatcaaatgc ttacttacta gaagttgctg tagtaggtgc tgtttctaaa aaattggcag    156720
     ttctttgtca aagcacagcg ttacctgaaa gaaatattgg aaccactgat atattctaca    156780
     aaggtagaaa atataagatg cgaggtgaaa cagacttaag tggtacttat actattaata    156840
     taactgacga ttctgaaatg aaacttagaa gaatgttcga tagttggatg agagaagtag    156900
     ataataccac acctaaaggg actaatgctt tagcaggctt atttggtggt gctatgggtg    156960
     atttaatgga ggtagctaac ggaactttga aagcggttaa tgaaattaaa tctgcttggg    157020
     agtttgatgg tggtgtttct tggcttaaaa atatgattat gggcaagcca ctgccagcaa    157080
     attatcaaac aaccgtaaat atttggcaat taactaaagt caaagaaaaa ctatatgggt    157140
     atgctttgac taatgctttt cctattgaag taggtgcagt agaagtttct gacgaaaatg    157200
     aaaatcagtt atctatgttt agtgtaactt ttgcatattc agattttgaa cctattgaag    157260
     ataaaggtat aatcggtcaa atagttgata ctgtaatagg ccaagaaggc caagaaattg    157320
     tacaaggtgt tgaaaatcta ttagattaag acattctttt agtttaaaac tttttaagct    157380
     ttaatattat ataatatatt aaaaatttaa atttaaaaga tttaacactg tagtgttaaa    157440
     tgttagctct acaaaaaact gctaaaatca ccaaaaatta agaatatttt aaggattaat    157500
     acattataat aacattgtaa aggagatcaa atggatattt caattaaaga aatacaacca    157560
     agttctgaac aattgaagca atacaaagct caaagaataa cacaaagaaa acgcatcgta    157620
     aaaggtgggt ttgagcatgt tcttgtaact tcagattctg acttagatgg tattcatata    157680
     ggcgctttat tgatggggtt tatagaaaga tttaggccag aatacaaagg tagatttggc    157740
     cggtttaata cgcctgttaa aatggtttta aaaggtgaaa ctcctatcaa gtggacttac    157800
     gacatcactg aagaattacc agttaaatct ggtgaaaatg cgaagtattt caaaggttta    157860
     ggatcttggc aaaaagaatt attagatttt gttattaaga aggatgggtt agaaaatatg    157920
     atcgatgtct atgatttcga taatattaat ataattaatg acttcttagg ctctgaagag    157980
     agtgataaaa gaaagaatta tattagaaat cattctttta gcatagcaag tctgtaatta    158040
     tttgattgtt ttacattttg gtgatttaat ttgattctaa gttttaaact ttagttttaa    158100
     tttttaaact ttagtttata atatataatc aatattaaat taagtttttt ttaattttta    158160
     caattggttt taaccgatta atttttttta aaggatattt tatggatatt aattttgatt    158220
     ggaattcaat gaatgcggga gctaacccat tcgaatctaa aagttacgaa agtgatactc    158280
     gtttttatac cttggcaaaa gatgaaaatg gaaatggtgc agctttaatc agattcttac    158340
     ctagtgaagt tcacgaaaat ggctcaatga gtaccattat gaaagtattc aaatacaatg    158400
     ttagatctaa aacttctaaa agatttatag ctgagtggag cccaagtaca attggtttac    158460
     ctgatccaat tcaagaaaag tgggcgtctc tttggaatgc tggcaaacaa gatgaagcaa    158520
     gaagatatgc aaggtctaca agatacattg ctaatattaa agttattaaa gatccaaaaa    158580
     acccagcaaa tgaaggtaaa attttcttat ttgatatgtc gcaaacactt ggtgaaaaaa    158640
     ttaaatctat tttaacacca aatgaacaag aattagcact aggtgctgtt gctaaaaatc    158700
     tttttgatcc tataaaagga tttaacttta aattgattgc aactaaagga gccaatgggt    158760
     ttacagaata ttcaaaaagt gacgctgaag caaatccaag tgcaatttac aatagtgtag    158820
     aagaagcggt agcagatatt aaaaataatg cttataaatt gtcagattgg caaaaaccag    158880
     aaagctacaa atcttacgaa gcattaaaag aattgctaga tggtttggat gcaccagtaa    158940
     aatctaacaa tttggattca atggttcaag cagcgccagt aacaagtttt actgaaccgg    159000
     aagcaccaaa agccccacaa ggtacattat cggtagcaac tccaaaagca gaagctccaa    159060
     aagctccaag tactaaccaa gcagacaatc ttgatgattt aatggctgac ttattaaagt    159120
     aacatcgaag ccccaatggg cttcttaata tacacaaaag ctttaataga cttcaatcca    159180
     aaggagaatt atgatcgata ttgaaaactt taaaccactt caagattttg ttctaataaa    159240
     aacagaaccc gttaaatttg aaactgagtc tggcatcatt acaaaaatac aaaaatcaaa    159300
     tctttacgac agaccaacca aaggtgttgt aattaaacaa ggtcctaaat gtcaatatga    159360
     tttggttaat aaaacagttc aatgggatat cacaaaaggt caagatattg aagaaaatta    159420
     tattctcttg actgaggatt caatcctagg aattatagag taatgagagc acagcttttt    159480
     gaattacacc aagaactcaa caatgatgat aataccagta gtgatataat cttgttacat    159540
     tgtgatatgt ttccttatac aggaaagaat atcataaatt tacatataca agaacaaact    159600
     atgattaatg tagcggctgg tattgcttat actggtaaac cagtcataat ttatggggtt    159660
     cttggatttg tttttcttaa agctcttgag caaatcaagt ttagtatatt agattttagt    159720
     gcaaaatatg ctccaataat tatgtgtaat gctggatata ctgggtgtta tgaaatgtat    159780
     ggtaaaggtc atatttttaa tgaagaatta gatctttgcc gaatttataa tatagatttc    159840
     tttgcaccaa ataaagaaaa ttttaaagat ttaataaaag attgtttaaa aacaaatggt    159900
     ttcaaatata ttctaatata ctaaatatat taaaatatta aaacatttta agctaaagct    159960
     ttaatttttt aaagcgctag cttttaagct ttagcttata gttatcaaat attttaagct    160020
     ttagcttttt taaaactttt gtaactttaa attaaaaata aataattcaa aacataggat    160080
     ttttaatgaa agaattaacg gcatcgtggt taagccgtag atttacagat aatgacttta    160140
     gaagtgttct taaaaatatc gttctaaaag atggtatagg taaaggtact aaacgcccgg    160200
     acaatgctac caattttgtt gatacaaaaa ctggcgagtt aatagaacct actaaaattc    160260
     gtgaatttat caaagctatg aatgtagaag ttcagactcg caataatttc tataaaggta    160320
     ataccactta tcaaaatatt tcacaagttt cacaaaatgg agttttgcag ggttctgtga    160380
     tttcaagcac tccttatacc gctatgcagg ttgttttaga atcgttcgtg ggtgatggaa    160440
     ttataaattt tggaaccgca gttcaagccg atttcaatca agttaaatta aatcaaaaat    160500
     ctttattttt agcatacgat aattattttg caagattaga atttacagca agtgcaattg    160560
     ttaatatttc aggtggtgtg agattaactt ataatcaatc ccaactttgg tatgaccaag    160620
     gtagatcaga agttaacatt aattatgatg ctttgacaaa aatattagct cttgaaaatt    160680
     ttacagatgt tgaagttggt atagcagatt ttagttctaa gaaaattaaa tggtttaata    160740
     acgttaaact taaagcaagt acattaaatt tcacagtttc tcaaaataca gaaaatgcta    160800
     ataaaacagt tcaaaaacgt atagtttctg gatatttaga ttttacaatt gatcaaacta    160860
     ttgaggatac aatatctgag aaattaagag gtgctttgat tacagctgct agatttaata    160920
     aattcaaaca attattaaat aaagctgaag ttgcttgttt atgtgattgt aattattgta    160980
     cttgcgattg taattattgt acttgcgatt gtaattattg tacttgtaac tgtaactatt    161040
     gtacttgtga ttgtaattat tgtacttgtg attgcaatta ttgtacttgt aataataata    161100
     aagaatacac tgatagtgtc aattattgga atggtgttgt ctgtacttgt aatgctaata    161160
     ttgtttgtca aactcaaggc cctggatata caccagttta tgaaaacaaa tatatgactg    161220
     agtgttcttg tcaaggtgat agaagtgttc cacaatacaa ccaatacggt caaatatatg    161280
     gatatacttg taagtgtaat gctaactgga ttaattctgt tagacaacat gctactgtaa    161340
     ctcaagtatg ttcttgtaac gttgataaac aatggaccaa aaatattaca ggtaaaccaa    161400
     tttgggataa aaaatctaca ggacaaatcg ataatattgt caataataat acttttagtt    161460
     cacaaacagg tactactgta agagtttgta tttgtgatac aaacgtcaca atagctgcac    161520
     aatgtgctac aaatagaaca atggcttatg ttgatggcac aactggaaat caaggtggtt    161580
     acagatgtgt ttgtgatatt aacacaaata gacaagttac ttgttctgct aatagagaat    161640
     acaaatacgt cactgactac actcaatttc aaaacaaaaa atacaattaa aacacaatta    161700
     acatataatc agcttgaagt tcttaaaaag agcttcaatg cttttaaaat ttaagattaa    161760
     agttttaaaa ctaaagttta aattttaaaa tatttttaag tcaaaatata ttataattat    161820
     ttcatcaaag atgtatatga aggagataga atgaattatt tagaactaaa aaatatggca    161880
     gagaatttaa aagattctaa ttatagatca acaaaattaa ataattttaa attctatact    161940
     tatatattat cagattataa aaacttcaaa gaaaataata cttttttcat aagaggttta    162000
     atgatagatt ctaaatctat attaaacaaa gatactttag cacctggtat atcaatacca    162060
     atgccaaaat tctttaatat taatgaaaac gaagattggt tattaccaga ttctgcaaat    162120
     cttgaagatt tcactatagt gacaaaatac gatggttctt taatgatacc ttatgaatac    162180
     gatggtataa aatttagaac taaaatgtct attgacaatg atcaaactaa attagctaat    162240
     aagtatatca aaaataatcc agatatatta gatctaataa aaaataatcc agatactcag    162300
     tacttttttg agttgatttc acctttaaat agaatagtag tagattataa taaaactgaa    162360
     ttaaaattaa tagctgaatt agatcttaga acattagaat ttaaaattca cgaaactaac    162420
     gagtttaatt ttaaagattt aaatattaag acgctaaaag atcttaaaga ttatataaac    162480
     accatatcta attacgaagg tgttatactg cagcataaag taactaaaaa agtctacaag    162540
     ttaaaaacac aagaatattt agacttgcat aatactgtaa ccaatttaga tttaaaagtg    162600
     atatacaaaa tggtattaga agaaactata gatgatgtgt taccaaaatt atcaccagaa    162660
     gctgtagctt acattgattc tatatctaat tcagtaaaag ttaagttaaa tgaaatatta    162720
     gattctatag attctaatta tattaaagct aaagatcttg aagctccagc tttatatata    162780
     aaagatttaa atatagatcc tatagccaaa gattgtttat ttaaattatg cagaaataaa    162840
     cttaatttag acaacgtctt agatcaagtt aaaaaatcta tgttaaaata taacaaattg    162900
     cgagatatta aggttttttt aaagctatga attatataat attaaaaatc aagtcttaaa    162960
     aggtttttct taaatggatt cattaatata ttatattgca gtttacggtg gaatatgcgc    163020
     gattttgagc gtttttgcag tatatatttc tcataagttt taaaggtata aaatgagtac    163080
     aattaaacta acttggaatg atattcacca agctttgcat aatcttacaa atgaagtaga    163140
     tcttaaaaat tttgattgta tattaactcc taatagaggg ggattaatca taactggtat    163200
     gttgcaatac ttacaagata ttaaattacc agtctgtgta attaatgatt ctggtgtaat    163260
     caatattcaa aattataaaa aaattttgtt tttagatgat attaatgata caagtaaaac    163320
     aatatttaaa atacaaaaag tttttaacgg tctcataaca tttaaaacat tatttgaaag    163380
     atataatagt ccatttaaaa ctgagactat caatattatc ttgaatgatg cttggctaat    163440
     ttttccttgg gatgttgaac cagaagtttt aaatctaaga aagtgagtaa ttaatatgct    163500
     agtaccaaaa ataatcagaa attcaaaagt ttgtagattt ataaaaaatg tcattaaatt    163560
     cagaaatgaa ttaacaattt ggggacctta tgagccaata tttgatttaa aattgattta    163620
     taaaatgctt aaaatcaaaa gagaatattg gcttgatgat tgtggcgggg cagtttatga    163680
     aggtgtagaa aaagaattaa atactttaaa tagactctta aatgagttag acttagtatt    163740
     taaatattca aatggtggtg atgaacaaac tgctatgatt cattttgata tttttatgga    163800
     aacttataag aaaaatgctt ttaaattgtg gtgctgataa taacactata gtgtccgaat    163860
     ctaaaatact aaaatactaa aatatttaag ttgtatttat cgaactttat ttataattat    163920
     aaagacaata taaatatctc tgttttcttt aataaaatga atcaaaataa ttaatcataa    163980
     atagtatata atatatctaa aggagaatta tggaatattt accaaaaaca caagggccta    164040
     aaaaacttta taattttgat attaatatga ctcaagcgtg tacgctaaga tgtacatact    164100
     gtattcaaga ttttaataaa caaaaatttg aaaaattatc accagaactt actaagaaaa    164160
     tgatagaaaa gtttgatttt ctgttaaatt cagtagaatt caacaaacat tatgctggta    164220
     ttagaatttc attctggggt ggtgaaccta caactaatct agaaggtgtt aaagagtttg    164280
     tagaatacta cagacataac ccaagagttt gtttctttat gtattcaaat ggttataaat    164340
     acaaccacgt ttttgattac ttggaaacat ttaagtatat gtcaaatgtc gggtcagaac    164400
     cgaaattctt gactcaaata tcctatgatg gtatggccag ccacgattca gatagactta    164460
     atctacaagg taagggctca gcacaacaag ttaaagaaac tgtttttgaa ctagcaaaaa    164520
     gaaatatacc ttttattgtc catcctacga ttgcagctaa gaatttcgat aagattgcta    164580
     ttaattattt cgaatttaaa agaatgtccg atgtcttagg tattgaactt aattataacc    164640
     ctacgataga ttatatgtct aaatacgatt ttacaagaga acaattagaa gcattaacga    164700
     atactttaaa agaagaattc ttaaaaatac gtgatgctga agttgagttc tttaaaagaa    164760
     aaggatattt taattttggc tggatgaatc caaatagaag tatttgtaca gcaggtgatg    164820
     gctattctgg tattgaattg gatggtaaaa tgtatgcttg tcacggtgtt tttagtgaag    164880
     aatacaaacc aaataatgtt ttaaatgata ttaattttga gaatgtaaaa tttactgaaa    164940
     ccttgattaa gagttcacaa gatcatagaa aaatattaaa tgaaaatatg cctaaagttt    165000
     gtcaagaatg ttttacacat tattgtttaa aatgtaattc tacaaaattt ggtatttcta    165060
     ataaagaaac ctatgcagaa agatggactg attatagttg tcaacctggt ttatgttata    165120
     tgtttaaatt cataggtaaa tatagaatag ctttgatgaa atatattcaa gcttcttaga    165180
     attctaaaat agttctaaat tgatactata gagctagcat ctaacacttt agtgttaacg    165240
     aactaaattg taaaagttaa cactttagtg ttgtatgctc agatccaaaa taaatataca    165300
     aaaaatagga tttattttgg gtataataaa atcagctgcc agaggtatta gaggtactta    165360
     tagagcaggt aaaaatacaa ttaatggtgt caattctgct tataatagtg ctatcagtgg    165420
     cataaacaaa gtaaattctg ctttagatcc tacgaatgta gttagaagcg catcccaaag    165480
     acttaataac tggatggatt cggattctaa agtatctaag acaacacaaa aaaataatga    165540
     cgcaatcgtc aacgaattaa acaacgtagg taatgaagtt attagtgctg ctaaagcttt    165600
     agatcctatg aatgctagaa aattaacaga aatttcagaa tctcttaaaa atctttcaaa    165660
     acaaatctcg gatattaaaa aaggattaat agataatcaa gatacagaaa taagacacca    165720
     aggttttgat aaaaacgttc aaaatgtttc agaatctaaa gtaaatgtac ctcagaataa    165780
     aagttttttt gataaacttt taggttggtt aggaggttta ttaggtgtat cggcaggtac    165840
     tttattacca ttattgggtt cattaggaag ttttttaaca aagcctttag atttcatttt    165900
     agatctatta aaaggtggta ttaataaatt atggacttta tttgagccat tattaggccc    165960
     tattatagac cctttaaaaa atggatttga attcttaaaa aataaatgga actcattagt    166020
     agattttatt aataaaaaat ttaatattgg tgataaatgg aaaatctcag ataatgataa    166080
     tccaaaaaat ccaaaatccc caaaagtaag ttcatctaat ccagctaaag aacaatcttg    166140
     gttgtctaag aaatgggatt cttttaaagg tgctatgcaa aatggatatg attgggcttc    166200
     acaaaaagta gatgatttaa aatcatatgc tagtaagaaa tatcaagata ttaaaaattc    166260
     taaagtaggt aaaattatat ctgcaggata tgataaatta aaagcagcac aaaaatatat    166320
     tgtagaaaaa gctattgaag gatttgatgc tgttaaaaat atggtaagct ctgcttggga    166380
     ttcagcagtt aaagcagcac aaaaaggctt taatatgctt aaaaagttta ctttagctcc    166440
     tatggagaaa tttgttagtt cagtaggtaa gaaactattt ggaagttcta agttattttc    166500
     agttctacct agtatacttg gaaatcttga aaaaatagga gcaagattag ctgctagtgg    166560
     tgctaaaata gcttcaaaag ctttaccagg tgttggattt gcggtaggta tataccaagc    166620
     ttgggatttc tttactcgtg gtagatgggt attgggttca atagccgcac ttagtgcttg    166680
     tatttcatta ttgccaggta ttggtggaat catatctatg tgtttagact taggtttatt    166740
     tgctactgat attataacaa gtccagaaga tgttgataat cttaataaag aacaaaatga    166800
     tttagtaaat acagcaaata aaatggttca aaataatgat actggaggta ttttagaacc    166860
     aagtcaagta gaaaaagata aagcgcaatc tggagttcaa gattcaagtt ctaattcaag    166920
     ttcaagtaat aaaggattaa atgctaaagt acttgatggt aaatctgcta acgattttgc    166980
     tgcttcgtat acaccacata aagtggattc taacggaacc gttatagctg ctaaaactgg    167040
     ttctatatat aaaggtttga cctgggtaga atctgaaaaa tatgatactg aaaagcaagc    167100
     ttattttaag aaacgtgaag aaaaagaagc acaattagat gcgctttttg aacaaggtca    167160
     aaaagctatg aattctggag atactgaaac ctttaataaa ttagttacac aaagaaataa    167220
     attatctgat gaattatcta aaatgagctt agattctatc gattctaaat atcaagctat    167280
     tggacaagca agaattaaaa aattgcaaag ccaaggagct aatgtagatt tatcggtatt    167340
     tagaactaat ggagattcaa gtactagttc agggggaact gatacaaaac cagattctac    167400
     aaatgctagt gctagtgtag cttcacaagc ttctggttca atctctccgg cacaagtcca    167460
     aggagctcaa tccacagaag cccaaggctc gagttcagga ggatctccag gagcaagagc    167520
     tgcagcagaa ttcagtaaaa aatataactt aggaactaga gcaacaggcg cttgcgccaa    167580
     gtatgttaga tcttatttga tggcagcagg atatccatta tctggttggc cggtagcagc    167640
     tgcagattat ataaatttct tacctaaata tggttttaca ccagttcaag gtagagcttc    167700
     acaaataagt ccagaagtag gtgacgtttc aataacccag agatttggaa atcacaaata    167760
     tggacatatt gctatttgga atggttctaa ttgggtttca gattttaaac aaaactcagt    167820
     ttcaatttat agagacgtaa atgctttcgg tgggccggat gctaatataa ctattctaag    167880
     agatacttca ggtcaaaatc catctcaaga acttgtaaat caacaattat ccaatatgaa    167940
     tagttctttt aaagttgcgt tagggggagg gggagctaaa ggtgctgttt atagtttggc    168000
     ttctggagtt tcaaatgtcg ttacaaatac agcaggcgct gcagctagtg ttataagttc    168060
     tggtattagc agtgcacaat cttttgctaa tgctaattct attacaacta gaaaatcttt    168120
     aactcaaatg tatacagaat ctagattaag tactagtttt gggtcaagtt cagccccaca    168180
     agctgctagc ccagctgcaa attcaacacc aaaagaaaca aaagcagata ttaagccagc    168240
     ttcaaaacca gtagcgtcag caccaaaagc agttcctaaa gctgctagct atggtacacc    168300
     acacagaggt caatatgatg cagaaacaat ggaagacttt aataacttag gagataactt    168360
     tagtaaatcc aaatcaccaa tttctttacc tggagattcg aaatctaacg ttcaaactaa    168420
     caatgctggc tcagtagcac cagtaactcc tgtagttaat ataaagaata attcatctcc    168480
     aagtgattat tcttgggctt ctaaaaacag ttttaaaatt gctagaatgt ttgggttaga    168540
     tggcatcagc gattacgaaa tacttaatga aggttcagaa tctgactttt tacaatctta    168600
     tggtatgtct aaaagacaag caattcaatc agcagggtta aacaatacag tacaaaccaa    168660
     agttgctagt aatgttaaaa caaaagatgt gataccagct gtcaataaaa cccaaataaa    168720
     taataccaat atacagacta aaacaaaaga aacttctaat aaagatttga ctgattcttt    168780
     tgttttgagc taaggttcat taaatacaaa ggattaaatt ttgggattat ttggttctgt    168840
     cagtagtgtt atttcaggtg ttgatttacc aaaagctacg aaaactttct cagctagcaa    168900
     tggtgctgaa attctaaaat ttactaaagc tttagaatca gataatttta aacataaaca    168960
     aataatatta actgtttatg acccaaatga tttctataaa aaagtcaaag acgctattgg    169020
     tcaaaaaatg tcaagcctga tggcagcagg aacttcagca ttttctggtg atgggtatga    169080
     ttcttcagat gctagccaaa ctctcaaaga tgcgggccaa gacattgtag atatgtcagc    169140
     agtcaatata ttatatacaa tacatttacc attaatgaat gcgttccaag aacaaaactc    169200
     tcataattat tctgaagata ctggtatttt aggttctatg tcaaatgctg ctaatgaatt    169260
     atcaagtaca gctagttctg gtataattga agcttatggt agatttggag attttggtgg    169320
     aaacacagat aatatggcat ttgctccgca actaccacaa gtagatccat taaaatggca    169380
     aaactttaaa ggttccaact taagaacatt tcaatttact tttaaaatat ctcctagaaa    169440
     tatagatgaa gcttctaata tgatgagaat attttggtta ttaaaaagaa gttcatatcc    169500
     taaaaaagaa gctggtggtg tcttattgat accaccagca agaataggtg tacaattttc    169560
     aaacccacta ctacataagt taatagctcc tggtatttgt gtaatagacg gtgtttctat    169620
     ggtttatgaa aatggtgatg atattgctgt aacattagat ggtgtaccga agaaaataga    169680
     gtttacatta tcattaaaag aatttagaca aaaatatcag gatgattgga attttgaaaa    169740
     tgctagtcta taggagttaa aatgtatatt aataaacaac ttacaaatta tttagataat    169800
     tattcgttca gtgaagctaa taaaactgaa gcagaagttt gtaatgtcag agattataga    169860
     tccgtagatt acagttcaat aacaaaatat attaatgatt ctaatactat taatgttaaa    169920
     ataaatgcaa atgatttcat tgaaagtgtt tctaatagat tgtataatga tcctaattta    169980
     tgggatttat taatgcttat taacaataaa gatgccttga gtgacatgcc ttatgataat    170040
     gatagaatag cagatatggc tgatgaattg atagccaatt attttaataa tcctgagaaa    170100
     ccataccaag gtaatgttac tgaacaatta ataactgaat acagggaata tttgatagat    170160
     ttattgacac aaaagaatta tcaaaatatg attataaaag ctttagatcc tacttattta    170220
     ggtgacttct taagactttt taagtacaag taatttaata agccaagcat tttttatact    170280
     ttttaatatt agtttaagct ttgcttttaa gctttagact tatataggat atatagcatt    170340
     gctatatact acaaaaaagc caagcatttt ttatactttt taatattgct ttaagcttta    170400
     gacttatata ggatatatag gatatatagg atatatagca ttgctatata ctacaaaaaa    170460
     gccaagcatt ttttatactt tttaatattg ctttaagctt tagacttata taggatatat    170520
     aggatatata gcattgctat atactacaaa aaagccaagc attttttata ctttttaata    170580
     ttgctttaag ctttgttttg aattttaata tgagattcca agcccttgaa aagcttaaag    170640
     caatattaaa aagtataaaa aatgcttggc ttttttgtag tatatagcaa tgctatatat    170700
     cctatatatc ctatataagt ctaaagctta aagcaatatt aaaaagtata aaaaatgctt    170760
     ggcttttttg tagtatatag caatgctata tatcctatat atcctatata tcctatataa    170820
     gtctaaagct taaagcaata ttaaaaagta taaaaaatgc ttggcttttt tgtagtatat    170880
     agcaatgcta tatatcctat ataagtctaa agcttaaaag caaagcttaa actaatatta    170940
     aaaagtataa aaaatgcttg gcttttagtt taagttttaa aatctaaact aaagttttgg    171000
     ttttaaaaac ccgaaaaaac ttttttaaaa atttttttta aaaagcttta tattataata    171060
     tatcatatta aagagtaaaa aatttttaaa aattttcaag ggcttggaat ctcatattaa    171120
     aattcaaaac aaacttaaac taatattaaa aagtataaaa aatgcttggc ttttttgtag    171180
     tatatactat agtattatat cctagtatat gcttaaatct taaaagcaaa gcttaaagca    171240
     atattaaaaa gtataaaaaa tgcttggctt ttttgtagta tatagcaatg ctacatatcc    171300
     tatataagtc taaagcttaa agcaatatta aaaagtataa aaaatgcttc tatttcgcaa    171360
     tactcgacga tgacccgttt taattaaaat tcagttatat ttaatataac accataagca    171420
     taaaaaataa atacttgaat ataatataac cccacaagga aaatatatga ctagtaatag    171480
     ctattcacaa tctagtaatt ataaaatatt tttacctttt ctaggcgatg aatggatata    171540
     tgctcaaaat atagcattac cggggtttag tctgaatcca agtcaagtca actttggtgg    171600
     taaaagtctt tatattggtg gtgaccacat tgattatgac ccagtaactg taggtttcct    171660
     tgtgggtgaa gatttcaaaa tatatacaaa attaatcaaa tatattttcg atagagttca    171720
     cccaaataat ggtaatatcg aaccattaaa agaatttact tgcggggtgg aaataaccga    171780
     caataaagga gaatcgttag tcagtatgac tatgtatggt tgtaaaatca caaacttagg    171840
     tgctttacaa ctaatatcga atgctgatga tgctgaacaa acttttgatc ttacttttaa    171900
     tttcgataat ttcgaattaa ttgattattt cgaatctatt aaattaaaag aagctgttat    171960
     aaaatcataa agggttctaa tggaacaagt ccttgaagct gaaatcgttg agttcgattc    172020
     tgagaaagct aaaatcaata aagctcaatt aaatcctgat gaaataatcc aattagattt    172080
     agtagtagat gattataata aattaagaca aattatttta gctaatgttg cgcaattaaa    172140
     agttatgagt gataacctag ttcaagaaat ggaaattgaa ggatataacc cagacttagt    172200
     aactgcttat agtaaactaa ttgaaacttc aaataagtct ttaaaaattc taaccgattc    172260
     ttataaaggg atatctgata ttttaattaa tattaataaa attaatgtat tacatccaag    172320
     cacagaagtt aaagaagatt ttgaagtcat ttcgactgct gatgtcatca aaagaattcg    172380
     agattcaaaa aaggattaaa tattaaaaca aagtatttca gataggacaa attaaatgcc    172440
     tttaagtgta aatgaattta ttaagaaacc aaaatatttt aaaccttttc ttaataaatt    172500
     agaaacaaat gattttttat tagaaggcga tcttggtgtt tttagttttg atttaaaaga    172560
     ccccacaaat attagattat ttgaattaat taaaagtatg aatgttgatg ctgtagaact    172620
     tttaatatat gacaaagaca ctaaaaaata taaaaacttt aaaggttcta ttaatggaaa    172680
     gaaaggtgaa gtacctttta gcaaaattca taaatctaat gtatctggta ttacattaaa    172740
     aggacaaaaa agtgataaca aagacgactt agcggagtgc ggtgttgtat attatttgga    172800
     tatgttttta aatactaaat taactgatat taaattctac actgaaactc aagttaaaaa    172860
     tactaggact aggacaccat tagattctgt taaaacattt ttatttgaaa atccagattg    172920
     ggataaagct tgtaaagatg ctgctaaatg tattctaaat gaaattattt taaaacaaaa    172980
     tcttagaaat tatgaatttc atcataaaac tgatgttttt aatgatctta aaaaacaagg    173040
     taaacaatta actaaattag cagaggataa atggaatcca ggagatttct ttttagtcaa    173100
     acctacatat aaaatcaaaa aatataaaac atatcaagaa cttaacaaag aaattaatgc    173160
     ttttgataat ataataccta taagtcttaa gaaatctact aaagaagctt taggtggttc    173220
     ttatgctttg aataatttat caggtaatta tggtttacca aattttaaaa gtattaaata    173280
     caaatcattc gatgataatt tttttaagtt ttttaaagaa tgtatggttg aattaaagaa    173340
     acataaaaat tcagacatca ttagggttag aactaataac aataacttag ccaccattta    173400
     tggtgaaatt gctggtaacg cgaaagctgc taattttttt gaaggatttc caccaagttt    173460
     agcatttata gctatgagtt caaaatattt taatgatata atatttgaag ttgtttgtaa    173520
     ttgtttaagt agatctccat taagttctaa tttttataaa gtttctggaa atcatttaga    173580
     aatattcgat agtttgcctt cggattttaa aatcgaatat tgtgttgtct cctgtgatgg    173640
     taatgctgat atcaaatgga atgttaagat agacggtaaa ttatggaaat tacaattaag    173700
     atctaaaggt tctttaccac aatttatgtt agttccacaa ccagtaagtt cttcaagcca    173760
     agataaaaaa attcaagcta ttaaagttta aaaatctaca ctcgagtgtt agatctagca    173820
     ctatatttag tatccaaata agcgaataaa tactcaaaaa ggaacataat ggcaaaatta    173880
     atattgcaaa gagtacaaga atgtgctaat gttagaaaac caagtaaaga aaaaatcgaa    173940
     ggttcgacat tatctgattt aatattatac gatgataacg atcaaattct ttggaaaggc    174000
     gctgcttgtg aaaatgccgg cccaagcaca gaagaatcag gaactgataa gcgtataaca    174060
     gcaggctctt acaaattaga atggtgtgct agttctaaaa atgttggatt agctaaaaaa    174120
     tacccacaat ggtacaacaa agatcgatca actatagcaa tttgggttaa aaggccaaat    174180
     gatactaatt tcaacaatag attaattaga atacatattg gaaattaccc acaagatact    174240
     gaaggttgta ttctacctgg taaaaccaga ggtgctggca ttgtttctag ttcagcagat    174300
     gcatgcaacg aactctatac taaaataaaa gaaattggaa ttaaaacagt agattttatt    174360
     attaaagaaa tcgaagctta aggattaaaa tgaaggggtt agtctataaa tcaccactta    174420
     aagttgattt agatttagta gaatcttaca aaggtaatat atttttatat gatgaaccaa    174480
     taaagaacga tccagaatat agtattcaag attctattaa tttggtatct aaaccagatc    174540
     ctgtgacttt tagagaatct gtgactttag acgatgctaa ccacttcaat attgatttta    174600
     attttagtga atctgtgata ttaaaagatt ctaagtttga tataacttcc acgactattg    174660
     attctgattt tagcagagag tcagattcga atactgacaa ataaataaat acaaaaaaac    174720
     aaggatttta aatgtcagat aagttaaaat tactttatga atatcacgat gctaatgtac    174780
     ttatcgaaga atcagttaac gacaaaaaag aaaaagttaa aaaatataaa attgctggta    174840
     ttttttcaac aataggtgaa aaaaaccgca acggtagaat ttacccaaaa gaactctggg    174900
     aaagtaatgt taaaaaatat caagacgtta taaaaagcgg ttctatcaat agactttgtg    174960
     agtgggaaca ccctgaaaga ggaacagttg atcctatgga agcagttgct gctatcaata    175020
     aacttgaaat caatggtaag tatgttatgg gtgaagctac attgttagat aatccaagag    175080
     ctaaccaatt aaaatcctta atagataatg gtatcaaatt gtcggtatct agtagaggtt    175140
     ctggcagagt taaaaatggt attgttgaat catttgattt gattacgtat gatttagtat    175200
     ctgcaccaag tgattataat gctactatgg aaggaacctc tatatatgaa tcacaaaaag    175260
     aatttgtaat ggtagatggt aaattagtag aatctttaga ttctagtaaa gttgaaacta    175320
     aagattccaa cagcgaaact aaagattcta acagcgatga taccactgat gctaaagatt    175380
     taaaactaaa agaatctatt cttaaagaat atttcttaga atttatcgag attcttaaaa    175440
     ataaaaacaa ataattataa tcacaggagt taaaaatgta tgacgatatt gtaatgaatg    175500
     taattcaaaa taaagggcta gcacaagcaa gtaatgattt cagagccatt ctaattaata    175560
     agtttgatga tatgccagaa attaggtcaa gactagcttc tatcgaaaaa tataaaaata    175620
     tgagagcttc acaaatttct gcaaacactg catataaacc agatccagat ttaatttctt    175680
     aaacatttaa aatccaatca cagcagagct aacattttaa                          175720
