
EBI Dbfetch

ID   FN550110; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   FN550110;
DT   16-SEP-2009 (Rel. 102, Created)
DT   16-SEP-2009 (Rel. 102, Last updated, Version 1)
DE   Homo sapiens partial HLA-DQB1 gene for MHC class II antigen, allele
DE   HLA-DQB1*03new, exon 2
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Yang E.;
RT   ;
RL   Submitted (14-SEP-2009) to the INSDC.
RL   Yang E., Tzu Chi Stem Cells Center, Buddhist Tzu Chi General Hospital, 707
RL   Section 3 Chung Yang Road, Hualien 970, TAIWAN.
RN   [2]
RA   Yang K., Chen M.;
RT   "Novel DQB1*03 found in CAP test sample";
RL   Unpublished.
DR   MD5; 49f81e293c25c965ae2efad0a891bc05.
DR   Ensembl-Gn; ENSG00000225824; homo_sapiens.
DR   Ensembl-Gn; ENSG00000231286; homo_sapiens.
DR   Ensembl-Gn; ENSG00000233209; homo_sapiens.
DR   Ensembl-Tr; ENST00000399088; homo_sapiens.
DR   Ensembl-Tr; ENST00000413089; homo_sapiens.
DR   Ensembl-Tr; ENST00000416192; homo_sapiens.
DR   Ensembl-Tr; ENST00000419914; homo_sapiens.
DR   Ensembl-Tr; ENST00000422950; homo_sapiens.
DR   Ensembl-Tr; ENST00000424806; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: 5DQIN1-L1, fwd_seq:
FT                   gcggattcccgaagcccccag, rev_name: 3DQIn2-R4, rev_seq:
FT                   ctcctgtcmscyggggtggaacg"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DQB1"
FT                   /allele="HLA-DQB1*03new"
FT                   /product="MHC class II antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:P01920"
FT                   /db_xref="HGNC:HGNC:4944"
FT                   /db_xref="IMGT/HLA:DQB1*03:26"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="PDB:1JK8"
FT                   /db_xref="PDB:1NBN"
FT                   /db_xref="PDB:1S9V"
FT                   /db_xref="PDB:1UVQ"
FT                   /db_xref="PDB:2NNA"
FT                   /db_xref="PDB:4GG6"
FT                   /db_xref="UniProtKB/Swiss-Prot:P01920"
FT                   /protein_id="CBE66554.1"
FT   exon            1..270
FT                   /gene="HLA-DQB1"
FT                   /allele="HLA-DQB1*03new"
FT                   /number=2
SQ   Sequence 270 BP; 59 A; 71 C; 94 G; 46 T; 0 other;
     aggatttcgt gtaccagttt aagggcctgt gctacttcac caacgggacg gagcgcgtgc        60
     gtcttgtgac cagatacatc tataaccgag aggagtacgc acgcttcgac agcgacgtgg       120
     gggtgtatcg ggcggtgacg ccgctggggc cgcctgacgc cgagtactgg aacagccaga       180
     aggaagtcct ggagaggacc cgggcggagt tggacacggt gtgcagacac aactaccagt       240
     tggagctccg cacgaccttg cagcggcgag                                        270
