
ID   FN430613; SV 1; linear; genomic DNA; STD; HUM; 646 BP.
AC   FN430613;
DT   17-JUL-2009 (Rel. 101, Created)
DT   17-JUL-2009 (Rel. 101, Last updated, Version 1)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, allele HLA-C*07,
DE   isolate 356442, exons 2-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-646
RA   Lebedeva T.V.;
RT   ;
RL   Submitted (15-JUL-2009) to the INSDC.
RL   Lebedeva T.V., HLA laboratory, American Red Cross New England Region, 180
RL   Rustcraft Rd, Dedham, MA 02026, USA.
RN   [2]
RA   Lebedeva T.V., Harrison K., Mastromarino S.A., Ohashi M., Alosco S., Yu N.;
RT   "New HLA Class alleles identified in donors of NMDP registry";
RL   Unpublished.
DR   MD5; f6b0ba0d79e6c5fdacb52c3f3b248b82.
FH   Key             Location/Qualifiers
FT   source          1..646
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /isolate="356442"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: C7F, fwd_seq:
FT                   agtgcggggttgggagggaag, rev_name: CampR, rev_seq:
FT                   ggagatggggaaggctccccact"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..>646)
FT                   /codon_start=3
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="IMGT/HLA:C*07:92"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:C7C4Z8"
FT                   /protein_id="CAZ86765.1"
FT                   VEWLRRYLENGKETLQRA"
FT   exon            1..270
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*07"
FT                   /number=3
SQ   Sequence 646 BP; 105 A; 174 C; 197 G; 70 T; 100 other;
     gctcccactc catgaggtat ttctacaccg ccgtgtcccg gcccggccgc ggagagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagtccgag aggggagccg cgggcgccgt gggtggagca ggaggggccg gagtattggg       180
     accgggagac acagaactac aagcgccagg cacaggctga ccgagtgagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggacg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagagg atgtatggct gcgacctggg gcccgacggg       420
     cgcctcctcc gcgggtatga ccagtccgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctgc gctcctggac cgccgcggac accgcggctc agatcaccca gcgcaagttg       540
     gaggcggccc gtgcggcgga gcagctgaga gcctacctgg agggcacgtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcgcag                      646