
ID   FN422394; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   FN422394;
DT   24-JUN-2009 (Rel. 101, Created)
DT   24-JUN-2009 (Rel. 101, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, allele HLA-B*51,
DE   isolate 267175, exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Lebedeva T.V.;
RT   ;
RL   Submitted (23-JUN-2009) to the INSDC.
RL   Lebedeva T.V., American Red Cross New England Region, HLA laboratory, 180
RL   Rustcraft Rd, Dedham, MA 02026, USA.
RN   [2]
RA   Lebedeva T.V., Harrison K., Mastromarino S.A., Ohashi M., Alosco S., Yu N.;
RT   "New HLA Class I alleles identified in donors of NMDP registry";
RL   Unpublished.
DR   MD5; 757a103c1715bad951990b1ba6fa1791.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /isolate="267175"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: B51F, fwd_seq: ctgctgctctggggggca,
FT                   rev_name: Bex5-R, rev_seq: aggacagccaggccagcaaca"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="IMGT/HLA:B*51:65"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:C6H0P4"
FT                   /protein_id="CAZ66361.1"
FT   exon            <1..270
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..>1022
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51"
FT                   /number=4
SQ   Sequence 1022 BP; 183 A; 256 C; 268 G; 115 T; 200 other;
     gctcccactc catgaggtat ttctacaccg ccatgtcccg gcccggccgc ggggagcccc        60
     gcttcattgc agtgggctac gtggacgaca cccagttcgt gaggttcgac agcgacgccg       120
     cgagtccgag gacggagccc cgggcgccat ggatagagca ggaggggccg gagtattggg       180
     accggaacac acagatcttc aagaccaaca cacagactta ccgagagaac ctgcggatcg       240
     cgctccgcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac ttggcagacg atgtatggct gcgacgtgga gccggacggg       420
     cgcctcctcc gcgggcataa ccagtacgcc tacgacggca aagattacat cgccctgaac       480
     gaggacctga gctcctggac cgcggcggac accgcggctc agatcaccca gcgcaagtgg       540
     gaggcggccc gtgaggcgga gcagctgaga gcctacctgg agggcctgtg cgtggagtgg       600
     ctccgcagac acctggagaa cgggaaggag acgctgcagc gcgcggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaccc cccaaagaca cacgtgaccc accaccccgt       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gcgaggacca aactcaggac actgagcttg tggagaccag       900
     accagcagga gatagaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagaaga       960
     gcagagatac acatgccatg tacagcatga ggggctgccg aagcccctca ccctgagatg      1020
     gg                                                                     1022