
ID   FN422393; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   FN422393;
DT   24-JUN-2009 (Rel. 101, Created)
DT   24-JUN-2009 (Rel. 101, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, allele HLA-B*27,
DE   isolate 254459, exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Lebedeva T.V.;
RT   ;
RL   Submitted (23-JUN-2009) to the INSDC.
RL   Lebedeva T.V., American Red Cross New England Region, HLA laboratory, 180
RL   Rustcraft Rd, Dedham, MA 02026, USA.
RN   [2]
RA   Lebedeva T.V., Harrison K., Mastromarino S.A., Ohashi M., Alosco S., Yu N.;
RT   "New HLA Class I alleles identified in donors of NMDP registry";
RL   Unpublished.
DR   MD5; da28f56b827f159e81c738c81722e867.
DR   IMGT/HLA; B*27:59N; HLA04164.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /isolate="254459"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: B27F, fwd_seq: ctgaccgcgacctgggct,
FT                   rev_name: Bex5-R, rev_seq: aggacagccaggccagcaaca"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /pseudo
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27"
FT                   /note="apparent B*27 null allele"
FT   exon            <1..270
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..>1022
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27"
FT                   /number=4
SQ   Sequence 1022 BP; 176 A; 255 C; 277 G; 114 T; 200 other;
     gctcccactc catgaggtat ttccacacct ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcac cgtgggctac gtggacgaca cgctgttcgt gaggttcgac agcgacgccg       120
     cgagtccgag agaggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     accgggagac acagatctgc aaggccaagg catagactga ccgagaggac ctgcggaccc       240
     tgctccgcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagaat atgtatggct gcgacgtggg gccggacggg       420
     cgcctcctcc gcgggtacca ccaggacgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctga gctcctggac cgccgcggac acggcggctc agatcaccca gcgcaagtgg       540
     gaggcggccc gtgtggcgga gcagctgaga gcctacctgg agggcgagtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcgcggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaccc cccaaagaca cacgtgaccc accaccccat       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gcgaggacca aactcaggac actgagcttg tggagaccag       900
     accagcagga gatagaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagaaga       960
     gcagagatac acatgccatg tacagcatga ggggctgccg aagcccctca ccctgagatg      1020
     gg                                                                     1022