
EBI Dbfetch

ID   FN422387; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   FN422387;
DT   24-JUN-2009 (Rel. 101, Created)
DT   24-JUN-2009 (Rel. 101, Last updated, Version 1)
DE   Homo sapiens partial HLA-A gene for MHC class I antigen, allele HLA-A*03,
DE   isolate 233509, exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Lebedeva T.V.;
RT   ;
RL   Submitted (23-JUN-2009) to the INSDC.
RL   Lebedeva T.V., American Red Cross New England Region, HLA laboratory, 180
RL   Rustcraft Rd, Dedham, MA 02026, USA.
RN   [2]
RA   Lebedeva T.V., Harrison K., Mastromarino S.A., Ohashi M., Alosco S., Yu N.;
RT   "New HLA Class I alleles identified in donors of NMDP registry";
RL   Unpublished.
DR   MD5; 687e3a4f6149b47b544d2c3accac2ca4.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /isolate="233509"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: A3F, fwd_seq: ggggagccgcgcccggac,
FT                   rev_name: Aex4-Rn, rev_seq: ccctcatgctgcacatggcag"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="GOA:C6H0N8"
FT                   /db_xref="IMGT/HLA:A*03:62"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:C6H0N8"
FT                   /protein_id="CAZ66354.1"
FT   exon            <1..270
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..>1022
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03"
FT                   /number=4
SQ   Sequence 1022 BP; 169 A; 248 C; 284 G; 121 T; 200 other;
     gctcccactc catgaggtat ttcttcacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     accaggagac acggaatgtg aaggcccagt cacagactga ccgagtggac ctggggaccc       240
     tgcgcggcta ctacaaccag agcgaggcca nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn gttctcacac catccagata atgtatggct gcgacgtggg gtcggacggg       420
     cgcttcctcc gcgggtaccg gcaggacgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctgc gctcttggac cgcggcggac atggcggctc agatcaccaa gcgcaagtgg       540
     gaggcggccc atgaggcgga gcagttgaga gcctacctgg atggcacgtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcacggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaccc ccccaagaca catatgaccc accaccccat       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gggaggacca gacccaggac acggagctcg tggagaccag       900
     gcctgcaggg gatggaacct tccagaagtg ggcggctgtg gtggtgcctt ctggagagga       960
     gcagagatac acctgccatg tgcagcatga gggtctgccc aagcccctca ccctgagatg      1020
     gg                                                                     1022
