
EBI Dbfetch

ID   FN422384; SV 1; linear; genomic DNA; STD; HUM; 646 BP.
AC   FN422384;
DT   24-JUN-2009 (Rel. 101, Created)
DT   24-JUN-2009 (Rel. 101, Last updated, Version 1)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, allele HLA-C*08,
DE   isolate 347187, exons 2-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-646
RA   Lebedeva T.V.;
RT   ;
RL   Submitted (23-JUN-2009) to the INSDC.
RL   Lebedeva T.V., American Red Cross New England Region, HLA laboratory, 180
RL   Rustcraft Rd, Dedham, MA 02026, USA.
RN   [2]
RA   Lebedeva T.V., Harrison K., Mastromarino S.A., Ohashi M., Alosco S., Yu N.;
RT   "New HLA Class I alleles identified in donors of NMDP registry";
RL   Unpublished.
DR   MD5; 46de783b68d6d5b3bbdec9df86d0b828.
FH   Key             Location/Qualifiers
FT   source          1..646
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /isolate="347187"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: C8F, fwd_seq: ctgggcctgtgagtgcga,
FT                   rev_name: CampR, rev_seq: ggagatggggaaggctccccact"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..>646)
FT                   /codon_start=3
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*08"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="GOA:C6H0N5"
FT                   /db_xref="IMGT/HLA:C*08:30"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:C6H0N5"
FT                   /protein_id="CAZ66351.1"
FT                   VEWLRRYLENGKKTLQRA"
FT   exon            <1..270
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*08"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..>646
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*08"
FT                   /number=3
SQ   Sequence 646 BP; 110 A; 170 C; 196 G; 70 T; 100 other;
     gctcccactc catgaggtat ttctacaccg ccgtgtcccg gcccggccgc ggagagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cgcagttcgt gcagttcgac agcgacgccg       120
     cgagtccaag aggggagccg cgggcgccgt gggtggagca ggaggggccg gagtattggg       180
     accgggagac acagaagtac aagcgccagg cacagactga ccgagtgagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagagg atgtatggct gcgacctggg gcccgacggg       420
     cgcctcctcc gcgggtataa ccagttcgcc tacgacggca aggattacat cgccctgaat       480
     gaggacctgc gctcctggac cgccgcggac aaggcggctc agatcaccca gcgcaagtgg       540
     gaggcgcccc gtgaggcgga gcagcggaga gcctacctgg agggcacgtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaagaag acgctgcagc gcgcgg                      646
