
ID   FN422380; SV 2; linear; genomic DNA; STD; HUM; 1022 BP.
AC   FN422380;
DT   24-JUN-2009 (Rel. 101, Created)
DT   27-OCT-2009 (Rel. 102, Last updated, Version 2)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, allele HLA-C*05,
DE   isolate 329141, exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RC   revised by [3]
RA   Lebedeva T.V.;
RT   ;
RL   Submitted (23-JUN-2009) to the INSDC.
RL   Lebedeva T.V., American Red Cross New England Region, HLA laboratory, 180
RL   Rustcraft Rd, Dedham, MA 02026, USA.
RN   [2]
RA   Lebedeva T.V., Harrison K., Mastromarino S.A., Ohashi M., Alosco S., Yu N.;
RT   "New HLA Class I alleles identified in donors of NMDP registry";
RL   Unpublished.
RN   [3]
RP   1-1022
RA   Lebedeva T.V.;
RT   ;
RL   Submitted (27-OCT-2009) to the INSDC.
RL   Lebedeva T.V., American Red Cross New England Region, HLA laboratory, 180
RL   Rustcraft Rd, Dedham, MA 02026, USA.
DR   MD5; 58ffcdce6bce3901c32b88d2ce1fb15a.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /isolate="329141"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: CampF, fwd_seq:
FT                   agcgaggggcccgcccggcga, rev_name: C5R, rev_seq:
FT                   ccagagggagggcgatattcc"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*05"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="GOA:C6H0N1"
FT                   /db_xref="IMGT/HLA:C*05:01:11"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:C6H0N1"
FT                   /protein_id="CAZ66347.2"
FT   exon            <1..270
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*05"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*05"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..>1022
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*05"
FT                   /number=4
SQ   Sequence 1022 BP; 178 A; 250 C; 283 G; 111 T; 200 other;
     gctcccactc catgaggtat ttctacaccg ccgtgtcccg gcccggccgc ggagagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cgcagttcgt gcagttcgac agcgacgcag       120
     cgagtccaag aggggagccg cgggcgccgt gggtggagca ggaggggccg gagtattggg       180
     accgggagac acagaagtac aagcgccagg cacagactga ccgagtgaac ctgcggaaac       240
     tgcgcggcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagagg atgtatggct gcgacctggg gcccgacggg       420
     cgcctcctcc gcgggtataa ccagttcgcc tacgacggca aggattacat cgccctgaat       480
     gaggacctgc gctcctggac cgccgcggac aaggcggctc agatcaccca gcgcaagtgg       540
     gaggcggccc gtgaggcgga gcagcggaga gcctacctgg agggcacgtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaagaag acgctgcagc gcgcggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaaca cccaaagaca cacgtgaccc accatcccgt       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gcgaggacca aactcaggac accgagcttg tggagaccag       900
     gccagcagga gatggaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagaaga       960
     gcagagatac acgtgccatg tgcagcacga ggggctgcca gagcccctca ccctgagatg      1020
     gg                                                                     1022