
ID   FN392687; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   FN392687;
DT   11-MAY-2009 (Rel. 100, Created)
DT   15-SEP-2010 (Rel. 106, Last updated, Version 2)
DE   Homo sapiens partial HLA-DRB1 gene for MHC class II antigen, allele
DE   HLA-DRB1*03new, exon 2
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Johnson J.S.;
RT   ;
RL   Submitted (07-MAY-2009) to the INSDC.
RL   Johnson J.S., Welsh Transplantation and Immunogeneitcs Laboratory, Welsh
RL   Blood Service, Ely Valley Road, Talbot Green, CF72 9WB, UNITED KINGDOM.
RN   [2]
RX   DOI; 10.1111/j.1399-0039.2010.01496.x.
RX   PUBMED; 20492593.
RA   Street J., Johnson J., Pepperall J., Cao K., Darke C.;
RT   "A new HLA-DRB1 allele: DRB1*0343";
RL   Tissue Antigens 76(3):255-256(2010).
DR   MD5; 6d93cafc8bf9f783f3117a2b0fcc8015.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /isolate="13598740"
FT                   /mol_type="genomic DNA"
FT                   /country="United Kingdom"
FT                   /cell_type="mixed lymphocytes"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: I1-RB5, fwd_seq:
FT                   agcactaaggaagggttcag, rev_name: I2-RB28, rev_seq:
FT                   acacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*03new"
FT                   /product="MHC class II antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:C4R9G8"
FT                   /db_xref="IMGT/HLA:DRB1*03:43"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:C4R9G8"
FT                   /protein_id="CAY68338.1"
FT   exon            1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*03new"
FT                   /number=2
SQ   Sequence 270 BP; 57 A; 65 C; 97 G; 51 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcatttctt caatgggacg gagcgggtgc        60
     ggtacctgga cagatacttc cataaccagg aggagttcct gcgcttcgac agcgacgtgg       120
     gggagttccg ggcggtgacg gagctggggc ggcctgatgc cgagtactgg aacagccaga       180
     aggacctcct ggagcagaag cggggccggg tggacaacta ctgcagacac aactacgggg       240
     ttgtggagag cttcacagtg cagcggcgag                                        270