
EBI Dbfetch

ID   FM994937; SV 1; linear; genomic DNA; STD; HUM; 2833 BP.
AC   FM994937;
DT   05-FEB-2009 (Rel. 99, Created)
DT   05-FEB-2009 (Rel. 99, Last updated, Version 1)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, HLA-Cw*0702new
DE   allele, exons 1-8
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-2833
RA   Dormoy A.;
RT   ;
RL   Submitted (02-FEB-2009) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Weschler B.;
RT   "The Cw*0702New allele is identical to the allele Cw*070201 except a silent
RT   substitution at nucleotide position 618 (G->A)";
RL   Unpublished.
DR   MD5; 871012d3923ad6e1559efbfdb67015a0.
FH   Key             Location/Qualifiers
FT   source          1..2833
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: Gly G-9, fwd_seq:
FT                   ctgctgctctcgggaggcc, rev_name: P3' UT (B+C), rev_seq:
FT                   aaatcctgcatctcagtccca"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..26,157..426,677..952,1481..1756,1881..2000,
FT                   2441..2473,2581..2628,2793..2797)
FT                   /codon_start=2
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:B9WPN5"
FT                   /db_xref="IMGT/HLA:C*07:02:04"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR010579"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:B9WPN5"
FT                   /protein_id="CAX33876.1"
FT                   SDESLITCKA"
FT   exon            <1..26
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=1
FT   intron          27..156
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=1
FT   exon            157..426
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=2
FT   intron          427..676
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=2
FT   exon            677..952
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=3
FT   intron          953..1480
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=3
FT   exon            1481..1756
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=4
FT   intron          1757..1880
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=4
FT   exon            1881..2000
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=5
FT   intron          2001..2440
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=5
FT   exon            2441..2473
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=6
FT   intron          2474..2580
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=6
FT   exon            2581..2628
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=7
FT   intron          2629..2792
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=7
FT   exon            2793..>2833
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0702new"
FT                   /number=8
SQ   Sequence 2833 BP; 535 A; 815 C; 909 G; 574 T; 0 other;
     cctggccctg accgagacct gggcctgtga gtgcggggtt gggagggaag cggcctctgc        60
     ggagaggagc gaggggccct cccggcgagg gcgcaggacc cggggagccg cgcagggagg       120
     tgggtcgggc gggtctcagc ccctcctcgc ccccaggctc ccactccatg aggtatttcg       180
     acaccgccgt gtcccggccc ggccgcggag agccccgctt catctcagtg ggctacgtgg       240
     acgacacgca gttcgtgcgg ttcgacagcg acgccgcgag tccgagaggg gagccgcggg       300
     cgccgtgggt ggagcaggag gggccggagt attgggaccg ggagacacag aagtacaagc       360
     gccaggcaca ggctgaccga gtgagcctgc ggaacctgcg cggctactac aaccagagcg       420
     aggacggtga gtgaccccgg cccggggcgc aggtcacgac ccctccccat cccccacgga       480
     cggcccgggt cgcccagagt ctccccgtct gagatccacc ccaaggtgga tctgcggaac       540
     ccgcccagac cctcgaccgg agagagcccc agtcgccttt acccggtttc attttcggtt       600
     taggccaaaa tccccgcggg ttggtcgggg cggggcgggg ctcgggggac tgggctgacc       660
     gcgggggcgg ggccagggtc tcacaccctc cagaggatgt ctggctgcga cctggggccc       720
     gacgggcgcc tcctccgcgg gtatgaccag tccgcctacg acggcaagga ttacatcgcc       780
     ctgaacgagg acctgcgctc ctggaccgcc gcggacaccg cggctcagat cacccagcgc       840
     aagttggagg cggcccgtgc ggcggagcag ctgagagcct acctggaggg cacgtgcgtg       900
     gagtggctcc gcagatacct ggagaacggg aaggagacgc tgcagcgcgc gggtaccagg       960
     ggcagtgggg agccttcccc atctcctata gatctcccgg gatggcctcc cacgaggagg      1020
     ggaggaaaat gggatcagca ctggaatatc gccctccctt gaatggagaa tggcatgagt      1080
     tttcctgagt ttcctctgag ggccccctct gctctctagg acaattaagg gatgaagtct      1140
     ctgaggaaat ggaggggaag acagtccctg gaatactgat caggggtctc ctttgaccac      1200
     tttgaccact gctgtgtctg aaaggtttga ttccagcttt tctgagtcct gcagcctcca      1260
     ctcaggtcag gaccagaagt cgctgttcct ccctcagaga ctagaacttt ccaatgaata      1320
     ggagattatc ccaggtgcct gtgtccaggc tggcgtctgg gttctctgcc gccttcccca      1380
     ccccaggtgt cctgtccatt ctcaggatgg tcacatgggc gctgctggag tgtcccaaga      1440
     gagatgcaaa gtgtctgaat tttctgactc ttcccgtcag aacccccaaa gacacacgtg      1500
     acccaccacc ccctctctga ccatgaggcc accctgaggt gctgggccct gggcttctac      1560
     cctgcggaga tcacactgac ctggcagcgg gatggggagg accagaccca ggacaccgag      1620
     cttgtggaga ccaggccagc aggagatgga accttccaga agtgggcagc tgtggtggtg      1680
     ccttctggac aagagcagag atacacgtgc catatgcagc acgaggggct gcaagagccc      1740
     ctcaccctga gctggggtaa ggaggggaat ggggggtcac atctcttatc agagaaagca      1800
     gaagtccttc tggagccctt cagccgggtc agggctgagg cttgggggtc agggcccctc      1860
     accttctcct cctttcccag agccatcttc ccagcccacc atccccatca tgggcatcgt      1920
     tgctggcctg gctgtcctgg ttgtcctagc tgtccttgga gctgtggtca ccgctatgat      1980
     gtgtaggagg aagagctcag gtagggaagg ggtgaagagc ggggtctggg ttttcttgtc      2040
     ccactgggag tttcaagccc caggtagaag tgtgccccgc cttgttactg gaagcaccat      2100
     ccacacatgg gccatcccag cctgggaccc tgtgtgccag cacttactct tttgtgaagc      2160
     acatgtgaca atgaaggacg gatgtatcac cttgatgatt atggtgttgg ggtcctgatt      2220
     ccagcattca tgagtcaggg gaaggtccct gctaaggaca gaccttagga gggcagttgg      2280
     tccagaaccc acaactgctt tccccatgtt tcctgatcct gccctgggtc tgcagtcgta      2340
     gttctggaaa cttctcttgg gtccaagact aggaggttcc cctaagatca catggccctg      2400
     cctcctccca gtcccctcat agggcatttt cttcccacag gtggaaaagg agggagctgc      2460
     tctcaggctg cgtgtaagtg atggcggcgg gcgtgtggag gagctcacct actccataat      2520
     tcctcttgtc ccacatctcc tgcgggctct gaccaggtct ttttttttgt tctaccccag      2580
     gcagcaacag tgcccagggc tctgatgagt ctctcatcac ttgtaaaggt gagattctgg      2640
     ggagctgaag tggtcggggg tggggcagag ggaaaaggcc tgggtaatgg ggattctttg      2700
     attgggacgt ttcgagtgtg tggtgggccg ttcagagtgt catcgcttac catgactgac      2760
     ctgaatttgt tcatgactat tgtgttctgt agcctgagac agctgcctgt gtgggactga      2820
     gatgcaggat tta                                                         2833
