
ID   FM179681; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   FM179681;
DT   09-JUL-2008 (Rel. 96, Created)
DT   09-JUL-2008 (Rel. 96, Last updated, Version 1)
DE   Homo sapiens partial HLA-DRB1 gene for MHC class II antigen, HLA-DRB1*14New
DE   antigen, exon 2
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Dormoy A.;
RT   ;
RL   Submitted (08-JUL-2008) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Weschler B.;
RT   "The HLA-DRB1*14New allele has 3 nucleotide changes from the DRB1*1402
RT   allele at positions 286, 298 and 299 of exon 2 where : C286->A286 (codon 72
RT   (CTC -> ATC)) resulting in a change of amino acid : Leu -> Ile A298->G298 +
RT   G299->C299 (codon 76 (AGG -> GCG)) resulting in a change of amino acid :
RT   Arg -> Ala";
RL   Unpublished.
DR   MD5; b09fa0f00b332d697841ffd6c84070ee.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5' DRB1*03+11+13+14_intron 1,
FT                   fwd_seq: gtggtgggcgttgcggcg, rev_name: P3' CRX37_revM13,
FT                   rev_seq: caggaaacagctatgaccgaattcccgcgccgcgct"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14New"
FT                   /product="HLA class II antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:Q9GIY3"
FT                   /db_xref="HGNC:HGNC:4948"
FT                   /db_xref="IMGT/HLA:DRB1*14:24"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9GIY3"
FT                   /protein_id="CAQ77159.1"
FT   exon            <1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14New"
FT                   /number=2
SQ   Sequence 270 BP; 57 A; 65 C; 99 G; 49 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga gagatacttc cataaccagg aggagaacgt gcgcttcgac agcgacgtgg       120
     gggagtaccg ggcggtgacg gagctggggc ggcctgatgc cgagtactgg aacagccaga       180
     aggacatcct ggagcaggcg cgggccgcgg tggacaccta ctgcagacac aactacgggg       240
     ttggtgagag cttcacagtg cagcggcgag                                        270