
ID   FM177892; SV 1; linear; genomic DNA; STD; HUM; 972 BP.
AC   FM177892;
DT   26-JUN-2008 (Rel. 96, Created)
DT   23-MAR-2009 (Rel. 100, Last updated, Version 2)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, HLA-C*08new
DE   allele, exons 2-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-972
RA   Johnson J.;
RT   ;
RL   Submitted (25-JUN-2008) to the INSDC.
RL   Johnson J., Welsh Transplantation And Immunogenetics, Welsh Blood Service,
RN   [2]
RX   DOI; 10.1111/j.1399-0039.2008.01200.x.
RX   PUBMED; 19317753.
RA   Johnson J., Street J., Hammond L., Pepperall J., Darke C.;
RT   "A new HLA-C allele: Cw*0819";
RL   Tissue Antigens 73(4):378-379(2009).
DR   MD5; 8976f22fb3f0efe34877a0cf56187f3c.
FH   Key             Location/Qualifiers
FT   source          1..972
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /isolate="42270"
FT                   /mol_type="genomic DNA"
FT                   /country="United Kingdom"
FT                   /cell_type="Mixed leucocytes"
FT                   /tissue_type="Peripheral blood"
FT                   /PCR_primers="fwd_name: 5CwEx1-28TCA, fwd_seq:
FT                   ggcgccccgarccctca, rev_name: Cw3In3.290, rev_seq:
FT                   cagctgctgcagtggtcaaa"
FT                   /db_xref="taxon:9606"
FT   mRNA            join(<34..303,550..>825)
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*08new"
FT   CDS             join(<34..303,550..>825)
FT                   /codon_start=3
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*08new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="IMGT/HLA:C*08:19"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="UniProtKB/TrEMBL:B3WFG4"
FT                   /protein_id="CAQ68516.1"
FT                   VEWLRRYLENGKKTLQRA"
FT   exon            <34..303
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*08new"
FT                   /number=2
FT   intron          304..549
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*08new"
FT                   /number=2
FT   exon            550..>825
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*08new"
FT                   /number=3
SQ   Sequence 972 BP; 176 A; 311 C; 341 G; 144 T; 0 other;
     gtcgggcggg tctcagcccc tcctcgcccc caggctccca ctccatgagg tatttctaca        60
     ccgccgtgtc ccggcccggc cgcggagagc cccgcttcat cgcagtgggc tacgtggacg       120
     acacgcagtt cgtgcagttc gacagcgacg ccgcgagtcc aagaggggag ccgcgggcgc       180
     cgtgggtgga gcaggagggg ccggagtatt gggaccggga gacacagaag tacaagcgcc       240
     aggcacagac tgaccgagtg agcctgcgga acctgcgcgg ctactacaac cagagcgagg       300
     ccggtgagtg accccggccc ggggcgcagg tcacgacccc tccccatccc ccacggacgg       360
     cccgggtcgc cccgagtctc ccggtctgag atccaccccg aggctgcgga acccgcccag       420
     accctcgacc ggagagagcc ccagtcacct ttacccggtt tcattttcag tttaggccaa       480
     aatccccgcg ggttggtcgg ggctggggcg gggctcgggg gacggggctg accacggggg       540
     cggggccagg gtctcacacc ctccagagga tgtttggctg cgacctgggg ccggacgggc       600
     gcctcctccg cgggtataac cagttcgcct acgacggcaa ggattacatc gccctgaatg       660
     aggacctgcg ctcctggacc gccgcggaca aggcggctca gatcacccag cgcaagtggg       720
     aggcggcccg tgaggcggag cagcggagag cctacctgga gggcacgtgc gtggagtggc       780
     tccgcagata cctggagaac gggaagaaga cgctgcagcg cgcgggtacc aggggcagtg       840
     gggagccttc cccatctcct gtagatctcc cgggatggcc tcccacgagg aggggaggaa       900
     aatgggatca gcgctggaat atcgccctcc cttgaatgga gaatgggatg agttttcctg       960
     agtttcttct ga                                                           972