
ID   FM177891; SV 1; linear; genomic DNA; STD; HUM; 865 BP.
AC   FM177891;
DT   26-JUN-2008 (Rel. 96, Created)
DT   23-MAR-2009 (Rel. 100, Last updated, Version 2)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*08new
DE   allele, exons 2-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-865
RA   Johnson J.;
RT   ;
RL   Submitted (25-JUN-2008) to the INSDC.
RL   Johnson J., Welsh Transplantation And Immunogenetics, Welsh Blood Service,
RN   [2]
RX   DOI; 10.1111/j.1399-0039.2008.01199.x.
RX   PUBMED; 19317749.
RA   Johnson J., Street J., Hammond L., Pepperall J., Darke C.;
RT   "A new HLA-B*08 variant--B*0838";
RL   Tissue Antigens 73(4):373-374(2009).
DR   MD5; ced5664ec5104859353711628e878361.
FH   Key             Location/Qualifiers
FT   source          1..865
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /isolate="49595"
FT                   /mol_type="genomic DNA"
FT                   /country="United Kingdom"
FT                   /cell_type="Mixed leucocytes"
FT                   /tissue_type="Peripheral blood"
FT                   /PCR_primers="fwd_name: 5BIn1-TA, fwd_seq:
FT                   tgtaaaacgacggccagtggcgggggcgcaggacctga, rev_name:
FT                   3BIn3-108, rev_seq: attctccattcaagggagggcgac"
FT                   /db_xref="taxon:9606"
FT   mRNA            join(<13..282,529..>804)
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT   CDS             join(<13..282,529..>804)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="IMGT/HLA:B*08:38"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:B3WFG3"
FT                   /protein_id="CAQ68515.1"
FT                   VEWLRRYLENGKDTLERA"
FT   exon            <13..282
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=2
FT   intron          283..528
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=2
FT   exon            529..>804
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*08new"
FT                   /number=3
SQ   Sequence 865 BP; 154 A; 292 C; 308 G; 111 T; 0 other;
     cctcgccccc aggctcccac tccatgaggt atttcgacac cgccatgtcc cggcccggcc        60
     gcggggagcc ccgcttcatc tcagtgggct acgtggacga cacgcagttc gtgaggttcg       120
     acagcgacgc cgcgagtccg agagaggagc cgcgggcgcc atggatagag caggaggggc       180
     cggagtattg ggaccgggag acacagatct tcaagaccaa cacacagact gaccgagaga       240
     gcctgcggaa cctgcgcggc tactacaacc agagcgaggc cggtgagtga ccccggcccg       300
     gggcgcaggt cacgactccc catcccccac ggacggcccg ggtcgccccg agtctccggg       360
     tccgagatcc gcctccctga ggccgcggga cccgcccaga ccctcgaccg gcgagagccc       420
     caggcgcgtt tacccggttt cattttcagt tgaggccaaa atccccgcgg gttggtcggg       480
     gcggggcggg gctcgggggg acggggctga ccgcggggcc ggggccaggg tctcacaccc       540
     tccagagcat gtacggctgc gacgtggggc cggacgggcg cctcctccgc gggcataacc       600
     agtacgccta cgacggcaag gattacatcg ccctgaacga ggacctgcgc tcctggaccg       660
     cggcggacac cgcggctcag atcacccagc gcaagtggga ggcggcccgt gtggcggagc       720
     aggacagagc ctacctggag ggcacgtgcg tggagtggct ccgcagatac ctggagaacg       780
     ggaaggacac gctggagcgc gcgggtacca ggggcagtgg ggagccttcc ccatctccta       840
     taggtcgccg gggatggcct cccac                                             865