
ID   FM174682; SV 1; linear; genomic DNA; STD; HUM; 1924 BP.
AC   FM174682;
DT   27-JUN-2008 (Rel. 96, Created)
DT   27-JUN-2008 (Rel. 96, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*4402New
DE   allele, exons 1-5
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1924
RA   Dormoy A.;
RT   ;
RL   Submitted (16-JUN-2008) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Weschler B.;
RT   "The HLA-B*4402New allele has 1 nt change from the B*44020101 allele at
RT   position 285 of exon 2 where A->G (codon 71 (ACA-> ACG) ; no change of
RT   amino acid is observed.";
RL   Unpublished.
DR   MD5; 0a48dcfd757f1fe773d873443fdc8a63.
FH   Key             Location/Qualifiers
FT   source          1..1924
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5' Ala C-1, fwd_seq:
FT                   ctgaccgagacctgggcc, rev_name: P3' Exon 5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..3,133..402,646..921,1497..1772,1866..>1924)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:B*44:02:05"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:B3W6N3"
FT                   /protein_id="CAQ65001.1"
FT                   VPIVGIVAGLAVL"
FT   exon            <1..3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=1
FT   intron          4..132
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=1
FT   exon            133..402
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=2
FT   intron          403..645
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=2
FT   exon            646..921
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=3
FT   intron          922..1496
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=3
FT   exon            1497..1772
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=4
FT   intron          1773..1865
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=4
FT   exon            1866..1924
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*4402New"
FT                   /number=5
SQ   Sequence 1924 BP; 366 A; 596 C; 624 G; 338 T; 0 other;
     ccggtgagtg cggggtcggg agggaaatgg cctctgtggg gaggagagag gggaccgcag        60
     gcgggggcgc aggacccggg gagccgcgcc gggaggaggg tcgggcgggt ctcagcccct       120
     cctcgccccc aggctcccac tccatgaggt atttctacac cgccatgtcc cggcccggcc       180
     gcggggagcc ccgcttcatc accgtgggct acgtggacga cacgctgttc gtgaggttcg       240
     acagcgacgc cacgagtccg aggaaggagc cgcgggcgcc atggatagag caggaggggc       300
     cggagtattg ggaccgggag acacagatct ccaagaccaa cacgcagact taccgagaga       360
     acctgcgcac cgcgctccgc tactacaacc agagcgaggc cggtgagtga ccccggcccg       420
     gggcgcaggt cacgactccc catcccccac gtacggcccg ggtcgccccg agtctccggg       480
     tccgagatcc gcccccgagg ccgcgggacc cgcccagacc ctcgaccggc gagagcccca       540
     ggcgcgttta cccggtttca ttttcagttg aggccaaaat ccccgcgggt tggtcggggc       600
     ggggcggggc tcgggggacg gggctgaccg cggggccggg gccagggtct cacatcatcc       660
     agaggatgta cggctgcgac gtggggccgg acgggcgcct cctccgcggg tatgaccagg       720
     acgcctacga cggcaaggat tacatcgccc tgaacgagga cctgagctcc tggaccgcgg       780
     cggacaccgc ggctcagatc acccagcgca agtgggaggc ggcccgtgtg gcggagcagg       840
     acagagccta cctggagggc ctgtgcgtgg agtcgctccg cagatacctg gagaacggga       900
     aggagacgct gcagcgcgcg ggtaccaggg gcagtgggga gccttcccca tctcctatag       960
     gtcgccgggg atggcctccc acgagaagag gaggaaaatg ggatcagcgc tagaatgtcg      1020
     ccctcccttg aatggagaat ggcatgagtt ttcctgagtt tcctctgagg gccccctctt      1080
     ctctctagga caattaaggg atgacgtctc tgaggaaatg gaggggaaga cagtccctag      1140
     aatactgatc aggggtcccc tttgacccct gcagcagcct tgggaaccgt gacttttcct      1200
     ctcaggcctt gttctctgcc tcacactcag tgtgtttggg gctctgattc cagcacttct      1260
     gagtcacttt acctccactc agatcaggag cagaagtccc tgttccccgc tcagagactc      1320
     gaactttcca atgaatagga gattatccca ggtgcctgcg tccaggctgg tgtctgggtt      1380
     ctgtgcccct tccccacccc aggtgtcctg tccattctca ggctggtcac atgggtggtc      1440
     ctagggtgtc ccatgagaga tgcaaagcgc ctgaattttc tgactcttcc catcagaccc      1500
     cccaaagaca catgtgaccc accaccccat ctctgaccat gaggtcaccc tgaggtgctg      1560
     ggccctgggc ttctaccctg cggagatcac actgacctgg cagcgggatg gcgaggacca      1620
     aactcaggac accgagcttg tggagaccag accagcagga gatagaacct tccagaagtg      1680
     ggcagctgtg gtggtgcctt ctggagaaga gcagagatac acatgccatg tacagcatga      1740
     ggggctgccg aagcccctca ccctgagatg gggtaaggag ggggatgagg ggtcatatct      1800
     cttctcaggg aaagcaggag cccttcagca gggtcagggc ccctcatctt cccttccttt      1860
     cccagagccg tcttcccagt ccaccgtccc catcgtgggc attgttgctg gcctggctgt      1920
     ccta                                                                   1924